Provided herein, in some embodiments, are devices, systems and methods for high-throughput single-cell polyomics (e.g., genomic, epigenomic, proteomic and/or phenotypic profile) analyses.
|
1. A polyomic multiplexing device, comprising:
a substrate comprising x rows intersecting (i) Y columns to form x*Y patches, and (ii) Zn+1 columns to form x*Z patches, wherein each of the x*Y patches comprises a unique nucleic acid barcode that is immobilized to the substrate and comprises a polyt sequence, wherein:
each of the rows comprises a different subset of barcoded nucleic acid strands of a first set of nucleic acid strands, and each of the Y columns comprises a different subset of barcoded nucleic acid strands of a second set of nucleic acid strands,
the nucleic acid strands of the first set are bound to nucleic acid strands of the second set to form the unique nucleic acid barcode at each of the x*Y patches,
the unique nucleic acid barcode comprises, in the 5′ to 3′ direction, a barcode sequence of the first set, a barcode sequence of the second set, and a polyt sequence,
each of the x*Z patches comprises an antibody immobilized to the substrate, and
n is zero or greater;
and
an array of microwells coupled to the substrate, wherein each microwell comprises one of the unique molecular barcodes immobilized the substrate and at least one of the antibodies immobilized to the substrate.
6. The polyomic multiplexing device of
7. The polyomic multiplexing device of
8. The polyomic multiplexing device of
9. The polyomic multiplexing device of
10. The polyomic multiplexing device of
11. The polyomic multiplexing device of
12. The polyomic multiplexing device of
13. The polyomic multiplexing device of
14. The polyomic multiplexing device of
16. The polyomic multiplexing device of
17. The polyomic multiplexing device of
|
This application is a national stage filing under 35 U.S.C. § 371 of international application number PCT/US2018/017900, filed Feb. 13, 2018, which was published under PCT Article 21(2) in English and claims the benefit under 35 U.S.C. § 119(e) of U.S. provisional application No. 62/458,283, filed Feb. 13, 2017, which is incorporated by reference herein in its entirety.
Provided herein, in some embodiments, are devices, systems and methods for high-throughput single-cell polyomics (e.g., genomic, epigenomic, proteomic and/or phenotypic profile) analyses. The technology as provided herein may be used, for example, to process in parallel tens of thousands of single cells using deterministic molecular barcodes in a spatially-defined array. With this technology, multiple “omics” (polyomic) information can be linked to the same cell (or subpopulation of cells) based on the spatial location of the cell and the corresponding molecular barcode(s). More than 400,000 single cells can be processes in parallel in one microfluidic unit, for example. This throughput is higher than (e.g., 5-10× higher than) current sequencing and genomic technologies.
Deterministic barcoding is used to assign each cell a predetermined molecular (e.g., nucleic acid and/or protein) barcode sequence, which is associated with a predetermined location such that multiple measurements on the same cell (or subpopulation of cells) can be linked together through the barcode and location.
This technology enables the acquisition of the entire repertoire of information in cells of a biological system (including low cell number/low quality samples), enabling unprecedented access to the multimodal layers of molecular regulation that underlie biological complexity, and can be used to unveil the mechanisms that underlie such complexity (e.g., how epigenetic alterations regulate transcriptional expression and/or protein signaling).
The devices, systems and methods of the present disclosure are ideal for use in the clinical setting, for example. This technology can be used with low quality samples (e.g., including low cell numbers), reduces sequencing cost per cell, and improves resolution for distinguishing rare cell subsets and detecting rare disease-causing cells (e.g., pathogenic cells).
Thus, some aspects of the present disclosure provide a polyomic multiplexing device, comprising a substrate comprising X columns intersecting Y rows to form X*Y patches, wherein each of the X*Y patches comprises a unique nucleic acid barcode that is immobilized to the substrate and comprises a polyT sequence, wherein each column comprises a different subset of barcoded nucleic acid strands of a first set of nucleic acid strands, and each row comprises a different subset of barcoded nucleic acid strands of a second set of nucleic acid strands, and wherein the nucleic acid strands of the first set are bound to nucleic acid strands of the second set to form a unique nucleic acid barcode. See, e.g.,
In some embodiments, X is at least 10. Thus, in some embodiments, the device comprises at least 10 columns. In some embodiments, X is at least 20, at least 50, at least 100, at least 1000, at least 10000, or at least 20000. In some embodiments, X is 10 to 20000.
In some embodiments, Y is at least 10. Thus, in some embodiments, the device comprises at least 10 rows. In some embodiments, Y is at least 20, at least 50, at least 100, at least 1000, at least 10000, or at least 20000. In some embodiments, Y is 10 to 20000.
In some embodiments, the device further comprises Zn+1 columns intersecting the Y rows to form Y*Z patches, wherein each of the Y*Z patches comprises a molecular binding partner (e.g., antibody) immobilized to the substrate, and wherein n is zero or greater (e.g., n is 1, 2, 3, 4, or 5). In some embodiments, n is at least 1, and each of the Zn+1 columns comprises a different molecular binding partner (e.g., a different antibody, e.g., antibody A, antibody B, etc.). In some embodiments, n is at least 2, and each of the Zn+1 columns comprises a different molecular binding partner (e.g., a different antibody, e.g., antibody A, antibody B, antibody C, etc.). In some embodiments, the molecular binding partner is an antibody. The term “antibody” includes whole antibodies and antibody fragments (e.g., scFv and/or Fab fragments).
In some embodiments, the device further comprises an array of microwells coupled to the substrate (e.g., such that each microwell formed a seal with the substrate), wherein each microwell comprises one of the unique molecular barcodes of the substrate. See, e.g.,
It should be understood that the term “unique” is with respect to the components of a single device and means “only one” of a particular component (or subset of components) of the device. Thus, a patch comprising a unique nucleic acid barcode (or a unique subset of nucleic acid barcodes) is the only patch on the device that includes that particular unique nucleic acid barcode (or unique subset of nucleic acid barcodes), such that the patch (and any microwell associated with the patch and any cell(s) within that microwell) can be identified based on that unique nucleic acid barcode (or a unique subset of nucleic acid barcodes).
In some embodiments, the microwell array (and thus the device) comprises at least 20 microwells. For example, the microwell array may comprise at least 50, at least 100, at least 1000, or at least 10000 microwells. In some embodiments, the microwell array comprises 10, 20, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 20000, 30000, or 40000 microwells.
In some embodiments, the nucleic acid strands of the first set of nucleic acid strands comprise, optionally in the 5′ to 3′ direction: a promoter sequence (e.g., a T7 promoter sequence), a sequencing adaptor sequence, a first barcode sequence (e.g., unique to the first set of nucleic acid strands and/or unique to subsets of nucleic acid strands within the first set) and a first anchor sequence. In some embodiments, the nucleic acid strands of the second set of nucleic acid strands comprise, optionally in the 5′ to 3′ direction: a polyT sequence, a unique molecular identifier sequence, a second barcode sequence (e.g., unique to the second set of nucleic acid strands and/or unique to subsets of nucleic acid strands within the second set) and a second anchor sequence, wherein the second anchor sequence is complementary to the first anchor sequence. In some embodiments, the unique nucleic acid barcode comprises, optionally in the 5′ to 3′ direction: a promoter sequence, a sequencing adaptor sequence, a first barcode sequence, a second barcode sequence, optionally a unique molecular identifier, and a polyT sequence.
In some embodiments, the substrate comprises glass, silicon or silica. In some embodiments, the substrate is coated with poly-1-lysine.
In some embodiments, the each column and/or row has a width of 50-200 microns. In some embodiments, each column and/or row has a width of 100 microns.
In some embodiments, each patch has an area of 400-40,000 μm2. In some embodiments, each patch has an area of 10,000 μm2.
In some embodiments, the patches within a single row and/or within a single column are separated from each other by 20-200 microns. In some embodiments, the patches within a single row and/or within a single column are separated from each other by 100 microns.
In some embodiments, the patches between adjacent rows and/or between adjacent columns are separated from each other by 20-200 microns. In some embodiments, the patches between adjacent rows and/or between adjacent columns are separated from each other by 100 microns.
Some aspects of the present disclosure provide a polyomic multiplexing device, comprising a microwell array comprising at least 20 microwells, wherein each microwell of the array comprises a molecular barcode specific to a single microwell, and wherein each molecular barcode comprises (a) a nucleic acid barcode that comprises a polyT sequence and (b) at least one antibody. In some embodiments, the device comprises at least 2, at least 3, or at least 4 different antibodies. In some embodiments, the microwell (and thus the device) comprises at least 50, at least 100, at least 1000, or at least 10000 microwells. In some embodiments, the unique nucleic acid barcode comprises, optionally in the 5′ to 3′ direction: a promoter sequence, a sequencing adaptor sequence, a first barcode sequence, a second barcode sequence, optionally a unique molecular identifier, and the polyT sequence.
Other aspects of the present disclosure provide a method of producing a barcoded array, comprising (a) flow patterning and immobilizing onto a surface of a substrate a first set of barcoded nucleic acid strands of a first solution to produce columns that are parallel to and space apart relative to each other, wherein each column comprises X patches of barcoded nucleic acid strands of the first set, wherein the patches within each column are spaced apart relative to each other, wherein each column comprises a different subset of barcoded nucleic acid strands, and wherein X is a number greater than 2; (b) flow patterning and immobilizing onto the surface of the substrate a second set of barcoded nucleic acid strands of a second solution to produce rows that are parallel to and space apart relative to each other, wherein each row comprises Y patches of barcoded nucleic acid strands of the second set, wherein the patches within each row are spaced apart relative to each other, wherein each row comprises a different subset of barcoded nucleic acid strands, wherein the rows are perpendicular relative to the columns, and wherein Y is a number greater than 2, thereby producing a X*Y array of patches, each patch comprising (i) a subset of barcoded nucleic acid strands of the first set bound to (ii) a subset of barcoded nucleic acid strands of the second set to form a unique nucleic acid barcode.
In some embodiments, the barcoded nucleic acid strands of the first set comprise, optionally in the 5′ to 3′ direction: a promoter sequence, a sequencing adaptor sequence, a first barcode sequence and a first anchor sequence. In some embodiments, the barcoded nucleic acid strands of the second set comprise, in the 5′ to 3′ direction: a polyT sequence, a unique molecular identifier sequence, a second barcode sequence and a second anchor sequence, wherein the second anchor sequence is complementary to the first anchor sequence.
In some embodiments, the method further comprises hybridizing the second set of barcoded nucleic acid strands to the first set of barcoded nucleic acid strands and producing patches that comprise partially double-stranded barcoded nucleic acids.
In some embodiments, the method further comprises combining the array of overlapping patches with a polymerase, a primer that binds to the second barcode sequence, and dNTPs, and producing a nucleic acid strand comprising, in the 5′ to 3′ direction: a promoter sequence, a sequencing adaptor sequence, a first barcode sequence, a first anchor sequence, a second barcode sequence, a unique molecular identifier sequence and a polyT sequence.
In some embodiments, the method further comprises removing from the array of overlapping patches the second set of barcoded nucleic acid.
In some embodiments, the method further comprises flow patterning and immobilizing onto the surface of the substrate a set of molecular binding partners of a third solution to produce columns that are parallel to and space apart relative to each other and relative to the columns of (b), wherein each column comprises Z patches of molecular binding partners, wherein each column comprises a different molecular binding partner, and wherein Z is a number greater than 2,
In some embodiments, the method further comprises coupling a microwell array to the surface of the substrate to produce a device, wherein each microwell of the microwell array comprises a patch that includes a unique nucleic acid barcode and optionally at least one antibody.
In some embodiments, the first and/or second set of barcoded nucleic acid strands and/or molecular binding partners (e.g., antibodies) are patterned and immobilized onto the surface of the substrate using a microfluidic flow patterning chip.
Also provided herein is a polyomic multiplexing device, comprising at least 20 (e.g., at least 50, at least 100, at least 1000, at least 10000, or at least 20000) enclosed microwells formed by a substrate coupled to a microwell array, wherein each microwell of the device comprises a unique molecular barcode immobilized on the substrate, wherein each unique molecular barcode comprises (a) a first patch that comprises a first antibody, wherein the first patch is adjacent to (b) a second patch that comprises a second antibody, wherein the second patch is adjacent to (c) a third patch that comprises a unique nucleic acid barcode that optionally comprises a terminal polyT sequence, wherein the third patch is adjacent to (d) a fourth patch that comprises a third antibody, wherein the fourth patch is adjacent to (f) a fifth patch that comprises a fourth antibody, wherein the first antibody is of the same type as the fourth antibody, and the second antibody is of the same type as the third antibody. In some embodiments, the unique molecular barcode further comprises (g) a sixth patch that comprises a fifth antibody and (h) a seventh patch that comprises a sixth antibody, wherein the fifth antibody is of the same type as the sixth antibody.
In some embodiments, microwells of the device comprise a single cell or a single subset (e.g., 2 or 3) cells. The cells may be obtained from a biological sample, such as a blood, urine, or saliva sample. Other biological samples are encompassed herein.
In some embodiments, 100 to 1000 (e.g., 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000) cells are assayed (e.g., for the presence of particular nucleic acids and/or antibodies) using a single device as provided herein.
Single-cell sequencing, in particular, sequencing of a whole transcriptome for gene expression profiling and phenotype analysis, is an enabling scientific discovery tool in nearly all fields of biology. Nonetheless, several major problems still exist. First, in order to quantitatively dissect phenotypic and functional heterogeneity of complex cell populations, one must simultaneously sequence more than 10,000 single cells. To date, there is no technology to achieve this goal. Second, in order to be utilized in the clinical setting, the technology should work for low-input samples (e.g., <50,000 cells) and rare cell populations isolated from clinical specimens. Third, the field is still unable to measure polyomics information in the same cell, for example, to directly correlate gene expression (transcriptome sequencing) to regulatory elements (e.g., microRNAs, epigenetic modification), which is important for understanding the mechanism of cellular heterogeneity. The technology of the present disclosure addresses the three foregoing problems.
Methods
Provided herein are methods of producing a barcoded array, comprising (a) flow patterning and immobilizing onto a surface of a substrate a first set of barcoded nucleic acid (e.g., DNA) strands of a first solution to produce columns that are parallel to and space apart relative to each other, wherein each column comprises X patches of barcoded nucleic acid strands of the first set, wherein the patches within each column are spaced apart relative to each other, wherein each column comprises a different subset of barcoded nucleic acid strands, and wherein X is a number greater than 2; and (b) flow patterning and immobilizing onto the surface of the substrate a second set of barcoded nucleic acid (e.g., DNA) strands of a second solution to produce rows that are parallel to and space apart relative to each other, wherein each row comprises Y patches of barcoded nucleic acid strands of the second set, wherein the patches within each row are spaced apart relative to each other, wherein each row comprises a different subset of barcoded nucleic acid strands, wherein the rows are perpendicular relative to the columns, and wherein Y is a number greater than 2, thereby producing a X*Y array of overlapping patches, each overlapping patch comprising (i) a subset of barcoded nucleic acid strands of the first set and (ii) a subset of barcoded nucleic acid strands of the second set.
General methods of flow patterning are known, and include, for example, streamline flow patterning, which is the flow of fluid in which its velocity at any point is constant or varies in a regular manner.
In some embodiments, the barcoded nucleic acid strands of the first set comprise, in the 5′ to 3′ direction: a promoter sequence, a sequencing adaptor sequence, a first barcode sequence and a first anchor sequence. In some embodiments, the barcoded nucleic acid strands of the first set comprise, in the 3′ to 5′ direction: a promoter sequence, a sequencing adaptor sequence (“sequencing adaptor”), a first barcode sequence and a first anchor sequence.
Promoter sequences are DNA sequences that define where transcription of a gene or other downstream nucleotide sequence by polymerase (e.g., RNA polymerase) begins. Examples of promoter sequences include, but are not limited to, T7 promoter sequences, T3 promoter sequences, and SP6 promoter sequences.
Sequence adaptors are short (known) nucleotide (e.g., DNA) sequences added to an end of a nucleic acid of interest. A complementary sequencing primer binds to the sequence adaptor. The length of a sequence adaptor may vary. For example, a sequence adaptor may have a length of 10 to 50 nucleotide. In some embodiments, a sequence adaptor has a length of 10, 20, 30, 40, or 50 nucleotides.
Anchor sequences enable binding of barcoded nucleic acids to each other. As shown in
A barcode sequence is a sequence of nucleotides (e.g., deoxyribonucleotides) that is specific to a set or a subset of nucleic acids strands. For example, as shown in
In some embodiments, the barcoded nucleic acid strands of the second set comprise, in the 5′ to 3′ direction: a polyT sequence (e.g., T19V), a unique molecular identifier (UMI) sequence, a second barcode sequence and a second anchor sequence, wherein the second anchor sequence is complementary to the first anchor sequence. In some embodiments, the barcoded nucleic acid strands of the second set comprise, in the 3′ to 5′ direction: a polyT sequence, a unique molecular identifier sequence, a second barcode sequence and a second anchor sequence, wherein the second anchor sequence is complementary to the first anchor sequence. Examples of UMIs are described by Kivioja T et al. Nature Methods 9, 72-74 (2012), incorporated herein by reference.
The methods may further comprise maintaining (incubating) the array of overlapping patches under conditions that result in hybridization of the second set of barcoded nucleic acid strands to the first set of barcoded nucleic acid strands to produce patches that comprise partially double-stranded barcoded nucleic acids. Nucleic acid hybridization conditions are known.
The methods may also comprise maintaining the array of overlapping patches in the presence of a polymerase, a primer that binds to the second barcode sequence, and dNTPs (e.g., dATP, dTTP, dCTP, and dGTP), under conditions that result in DNA polymerization (production/synthesis of strand of DNA) to produce a nucleic acid strand comprising (e.g., in the 5′ to 3′ direction): a promoter sequence, a sequencing adaptor sequence, a first barcode sequence, a first anchor sequence, a second barcode sequence, a unique molecular identifier sequence and a polyT sequence. Nucleic acid synthesis conditions are known.
In some embodiments, the methods comprise removing (e.g., washing) from the array of overlapping patches the second set of barcoded nucleic acid. In some embodiments, the polymerization/synthesis reaction is quenched with sodium hydroxide to strip off the shorter second barcoded nucleic acid strand,
The surface may be a glass surface, a silicon surface or a silica surface. Other surfaces are encompassed by the present disclosure. In some embodiments, the glass surface is coated with poly-1-lysine.
In some embodiments, the substrate is a microwell array or is coupled to a microwell array, and wherein each overlapping patch occupies or is aligned with a single microwell of the microwell array.
In some embodiments, X equals 20-20,000. For example, X may equal 20-50, 20-100, 20-500, 20-1000, 20-5000, 20-10000, 50-100, 50, 500, 50-1000, 50-5000, 50-10000, 50-20000, 100-500, 100-1000, 100-5000, 100-10000, or 100-20000. In some embodiments, X equals 100-20,000.
In some embodiments, Y equals 20-20,000. For example, Y may equal 20-50, 20-100, 20-500, 20-1000, 20-5000, 20-10000, 50-100, 50, 500, 50-1000, 50-5000, 50-10000, 50-20000, 100-500, 100-1000, 100-5000, 100-10000, or 100-20000. In some embodiments, Y equals 100-20,000.
At least one (e.g., at least 2, 3, 4, 5, 10, 20) column, or each (all) row, may have a width of 10-500 microns, or 50-200 microns. For example, a column may have a width of 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190 or 200 microns. In some embodiments, a column has a width of 100 microns.
At least one (e.g., at least 2, 3, 4, 5, 10, 20) column, or each (all) row, may have a width of 10-500 microns, or 50-200 microns. For example, a row may have a width of 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190 or 200 microns. In some embodiments, a row has a width of 100 microns.
Typically, at least one, or each (all), overlapping patch has an area of 100-40,000 μm2. For example, an overlapping path may have an area of 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 20000, 30000 or 40000 μm2. In some embodiments, an overlapping patch has an area of 10,000 μm2. Thus, in some embodiments, the dimensions of a patch may be 10×10 μm to 200×200 μm. Larger or smaller overlapping patches are encompassed by the present disclosure.
In some embodiments, the overlapping patches within a single row are separated from each other by 10-500 microns, or 20-200 microns. For example, the overlapping patches within a single row may be separated from each other by 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 125, 150, 175 or 200 microns. In some embodiments, the overlapping patches within a single row are separated from each other by 100 microns.
In some embodiments, the overlapping patches within a single column are separated from each other by 10-500 microns, or 20-200 microns. For example, the overlapping patches within a single column may be separated from each other by 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 125, 150, 175 or 200 microns. In some embodiments, the overlapping patches within a single column are separated from each other by 100 microns.
In some embodiments, the overlapping patches between adjacent rows are separated from each other by 20-200 microns. For example, the overlapping patches between adjacent rows may be separated from each other by 20, 50, 75, 100, 125, 150, 175 or 200 microns. In some embodiments, the overlapping patches between adjacent rows are separated from each other by 20-30, 20-50, 20-100, 50-100 or 50-200 microns. In some embodiments, the overlapping patches between adjacent rows are separated from each other by (about) 100 microns.
In some embodiments, the overlapping patches between adjacent columns are separated from each other by 20-200 microns. For example, the overlapping patches between adjacent columns may be separated from each other by 20, 50, 75, 100, 125, 150, 175 or 200 microns. In some embodiments, the overlapping patches between adjacent columns are separated from each other by 20-30, 20-50, 20-100, 50-100 or 50-200 microns. In some embodiments, the overlapping patches between adjacent columns are separated from each other by (about) 100 microns.
The first set of barcoded nucleic acid strands may be patterned and immobilized onto the surface of the substrate using, for example, a microfluidic flow patterning chip (see, e.g.,
Barcoded Arrays and Multiplexing Devices
Also provided herein are barcoded arrays, for example, produced by any of the methods described herein. For example, a barcoded array may be produced by a method, comprising: (a) flow patterning and immobilizing onto a surface of a substrate a first set of barcoded nucleic acid strands of a first solution to produce columns that are parallel to and space apart relative to each other, wherein each column comprises X patches of barcoded nucleic acid strands of the first set, wherein the patches within each column are spaced apart relative to each other, wherein each column comprises a different subset of barcoded nucleic acid strands, and wherein X is a number greater than 2; and (b) flow patterning and immobilizing onto the surface of the substrate a second set of barcoded nucleic acid strands of a second solution to produce rows that are parallel to and space apart relative to each other, wherein each row comprises Y patches of barcoded nucleic acid strands of the second set, wherein the patches within each row are spaced apart relative to each other, wherein each row comprises a different subset of barcoded nucleic acid strands, wherein the rows are perpendicular relative to the columns, and wherein Y is a number greater than 2, thereby producing a X*Y array of overlapping patches, each overlapping patch comprising (i) a subset of barcoded nucleic acid strands of the first set and (ii) a subset of barcoded nucleic acid strands of the second set.
Also provided herein are multiplexing devices comprising the barcoded array coupled to a microwell array, wherein each overlapping patch is aligned with a single microwell of the array such that each overlapping patch corresponds to a single microwell.
Further provided herein are multiplexing devices comprising a barcoded array, wherein the substrate is a microwell array, and wherein each overlapping patch occupies a single microwell of the microwell array.
In some embodiments, each microwell of the microwell array contains no more than 5 cells. For example, each microwell of the microwell array may contain no more than 4, no more than 3, or no more than 2 cells. In some embodiments, each microwell of the microwell array contains no more than 2 cells. some embodiments, each microwell of the microwell contains a single cell.
The microwell array may be located, for example, between the barcoded array and another substrate such that microwells of the microarray are sealed (e.g., fluid cannot leave or enter the microwell).
In some embodiments, the other substrate is coated with dried (e.g., lyophilized) lysis buffer.
In some embodiments, the other substrate comprises a nucleic acid capture array, such as a microRNA capture array.
In some embodiments, the other substrate comprises an antibody capture array (see, e.g., U.S. Pat. No. 9,188,586, incorporated herein by reference).
The present disclosure further encompasses the embodiments described in the following numbered paragraphs:
1. A method of producing a barcoded array, comprising:
(a) flow patterning and immobilizing onto a surface of a substrate a first set of barcoded nucleic acid strands of a first solution to produce columns that are parallel to and space apart relative to each other, wherein each column comprises X patches of barcoded nucleic acid strands of the first set, wherein the patches within each column are spaced apart relative to each other, wherein each column comprises a different subset of barcoded nucleic acid strands, and wherein X is a number greater than 2;
(b) flow patterning and immobilizing onto the surface of the substrate a second set of barcoded nucleic acid strands of a second solution to produce rows that are parallel to and space apart relative to each other, wherein each row comprises Y patches of barcoded nucleic acid strands of the second set, wherein the patches within each row are spaced apart relative to each other, wherein each row comprises a different subset of barcoded nucleic acid strands, wherein the rows are perpendicular relative to the columns, and wherein Y is a number greater than 2,
thereby producing a X*Y array of overlapping patches, each overlapping patch comprising (i) a subset of barcoded nucleic acid strands of the first set and (ii) a subset of barcoded nucleic acid strands of the second set.
2. The method of paragraph 1, wherein the barcoded nucleic acid strands of the first set comprise, optionally in the 5′ to 3′ direction: a promoter sequence, a sequencing adaptor sequence, a first barcode sequence and a first anchor sequence.
3. The method of paragraph 1 or 2, wherein the barcoded nucleic acid strands of the second set comprise, in the 5′ to 3′ direction: a polyT sequence, a unique molecular identifier sequence, a second barcode sequence and a second anchor sequence, wherein the second anchor sequence is complementary to the first anchor sequence.
4. The method of any one of paragraphs 1-3, further comprising maintaining the array of overlapping patches under conditions that result in hybridization of the second set of barcoded nucleic acid strands to the first set of barcoded nucleic acid strands to produce patches that comprise partially double-stranded barcoded nucleic acids.
5. The method of paragraph 4, further comprising maintaining the array of overlapping patches in the presence of a polymerase, a primer that binds to the second barcode sequence, and dNTPs, under conditions that result in DNA polymerization to produce a nucleic acid strand comprising, in the 5′ to 3′ direction: a promoter sequence, a sequencing adaptor sequence, a first barcode sequence, a first anchor sequence, a second barcode sequence, a unique molecular identifier sequence and a polyT sequence.
6. The method of paragraph 5 further comprising removing from the array of overlapping patches the second set of barcoded nucleic acid.
7. The method of any one of paragraphs 1-6, wherein the surface is a glass surface, silicon or silica.
8. The method of paragraph 7, wherein the glass surface is coated with poly-1-lysine.
9. The method of any one of paragraph 1-6, wherein the substrate is a microwell array, and were each overlapping patch occupies a single microwell of the microwell array.
10. The method of any one of paragraphs 1-9, wherein X equals 20-20,000 and/or Y equals 20-20,000.
11. The method of paragraph 10, wherein X equals 100-20,000 and/or Y equals 100-20,000.
12. The method of paragraph 11, wherein X equals 1000-20,000 and/or Y equals 1000-20,000.
13. The method of paragraph 12, wherein X equals 10,000-20,000 and/or Y equals 10,000-20,000.
14. The method of any one of paragraphs 1-13, wherein each column and/or row has a width of 50-200 microns.
15. The method of paragraph 14, wherein each column and/or row has a width of 100 microns.
16. The method of any one of paragraphs 1-15, wherein each overlapping patch has an area of 400-40,000 μm2.
17. The method of paragraph 16, wherein each overlapping patch has an area of 10,000 μm2.
18. The method of any one of paragraphs 1-17, wherein the overlapping patches within a single row and/or within a single column are separated from each other by 20-200 microns.
19. The method of paragraph 18, wherein the overlapping patches within a single row and/or within a single column are separated from each other by 100 microns.
20. The method of any one of paragraphs 1-19, wherein the overlapping patches between adjacent rows and/or between adjacent columns are separated from each other by 20-200 microns.
21. The method of paragraph 20, wherein the overlapping patches between adjacent rows and/or between adjacent columns are separated from each other by 100 microns.
22. The method of any one of paragraphs 1-21, wherein the first and/or second set of barcoded nucleic acid strands are patterned and immobilized onto the surface of the substrate using a microfluidic flow patterning chip.
23. A barcoded array produced by a method, comprising:
(a) flow patterning and immobilizing onto a surface of a substrate a first set of barcoded nucleic acid strands of a first solution to produce columns that are parallel to and space apart relative to each other, wherein each column comprises X patches of barcoded nucleic acid strands of the first set, wherein the patches within each column are spaced apart relative to each other, wherein each column comprises a different subset of barcoded nucleic acid strands, and wherein X is a number greater than 2;
(b) flow patterning and immobilizing onto the surface of the substrate a second set of barcoded nucleic acid strands of a second solution to produce rows that are parallel to and space apart relative to each other, wherein each row comprises Y patches of barcoded nucleic acid strands of the second set, wherein the patches within each row are spaced apart relative to each other, wherein each row comprises a different subset of barcoded nucleic acid strands, wherein the rows are perpendicular relative to the columns, and wherein Y is a number greater than 2,
thereby producing a X*Y array of overlapping patches, each overlapping patch comprising (i) a subset of barcoded nucleic acid strands of the first set and (ii) a subset of barcoded nucleic acid strands of the second set.
24. The barcoded array of claim 23, wherein the barcoded nucleic acid strands of the first set comprise, optionally in the 5′ to 3′ direction: a promoter sequence, a sequencing adaptor sequence, a first barcode sequence and a first anchor sequence.
25. The barcoded array of claim 23 or 24, wherein the barcoded nucleic acid strands of the second set comprise, in the 5′ to 3′ direction: a polyT sequence, a unique molecular identifier sequence, a second barcode sequence and a second anchor sequence, wherein the second anchor sequence is complementary to the first anchor sequence.
26. The barcoded array of any one of claims 23-25, further comprising hybridizing the second set of barcoded nucleic acid strands to the first set of barcoded nucleic acid strands and producing patches that comprise partially double-stranded barcoded nucleic acids.
27. The barcoded array of claim 26, further comprising combining the array of overlapping patches with a polymerase, a primer that binds to the second barcode sequence, and dNTPs, and producing a nucleic acid strand comprising, in the 5′ to 3′ direction: a promoter sequence, a sequencing adaptor sequence, a first barcode sequence, a first anchor sequence, a second barcode sequence, a unique molecular identifier sequence and a polyT sequence.
28. The barcoded array of claim 27 further comprising removing from the array of overlapping patches the second set of barcoded nucleic acid.
29. The barcoded array of any one of claims 23-28, wherein the surface is a glass surface, silicon or silica.
30. The barcoded array of claim 9, wherein the glass surface is coated with poly-1-lysine.
31. The barcoded array of any one of claim 23-30, further comprising applying a microwell array to the surface of the substrate to produce a device wherein each overlapping patch, each row or overlapping patches, or each column of overlapping patches occupies a single microwell of the microwell array.
32. The barcoded array of any one of claims 23-31, wherein X equals 20-20,000 and/or Y equals 20-20,000, X equals 100-20,000 and/or Y equals 100-20,000, X equals 1000-20,000 and/or Y equals 1000-20,000, or X equals 10,000-20,000 and/or Y equals 10,000-20,000.
33. The barcoded array of any one of claims 23-32, wherein each column and/or row has a width of 50-200 microns, or each column and/or row has a width of 100 microns.
34. The barcoded array of any one of claims 23-33, wherein each overlapping patch has an area of 400-40,000 μm2, or each overlapping patch has an area of 10,000 μm2.
35. The barcoded array of any one of claims 23-34, wherein the overlapping patches within a single row and/or within a single column are separated from each other by 20-200 microns, or the overlapping patches within a single row and/or within a single column are separated from each other by 100 microns.
36. The barcoded array of any one of claims 23-35, wherein the overlapping patches between adjacent rows and/or between adjacent columns are separated from each other by 20-200 microns, or the overlapping patches between adjacent rows and/or between adjacent columns are separated from each other by 100 microns.
37. The barcoded array of any one of claims 23-36, wherein the first and/or second set of barcoded nucleic acid strands are patterned and immobilized onto the surface of the substrate using a microfluidic flow patterning chip.
38. A multiplexing device comprising the barcoded array of any one of paragraphs 23-37 coupled to a microwell array, wherein each overlapping patch is aligned with a single microwell of the array such that each overlapping patch corresponds to a single microwell.
39. A multiplexing device comprising the barcoded array of any one of paragraphs 23-37, wherein the substrate is a microwell array, and wherein each overlapping patch occupies a single microwell of the microwell array.
40. The multiplexing device of paragraph 38 or 39, wherein each microwell of the microwell array contains no more than 5 cells.
41. The multiplexing device of paragraph 40, wherein each microwell of the microwell array contains no more than 2 cells.
42. The multiplexing device of paragraph 41, wherein each microwell of the microwell array contains a single cell.
43. The multiplexing device of any one of paragraphs 23-42, wherein the microwell array is located between the barcoded array and another substrate such that microwells of the microarray are sealed.
44. The multiplexing device of paragraph 43, wherein the other substrate is coated with lyophilized lysis buffer.
45. The multiplexing device of paragraph 43 or 44, wherein the other substrate comprises a nucleic acid capture array.
46. The multiplexing device of paragraph 45, wherein the nucleic acid capture array is a microRNA capture array.
47. The multiplexing device of paragraph 45, wherein the other substrate comprises an antibody capture array.
Two hundred unique DNA barcodes (
An array of 200×200 (40,000) square distinct barcode patches were formed by overlapping Barcode A and Barcode B areas on the slide (intersection of A and B) (
Microwell devices (individual wells˜picoliter to nanoliter volume) were used as single cell capture platforms. Two types of microwell devices were used (
For reliable mRNA capture from single cells using the high density barcode array, each barcoded patch is interfaced with a single cell. At least two techniques may be used to interface the microwell device with a barcode array: an alignment-free technique, described in this Example, and a deterministic alignment technique, described in Example 4.
With the alignment-free technique, the first version of microwell arrays is used, and the microwell dimensions and cell loading protocols are set such that when the high-density barcode array is randomly overlaid on top of the microwell devices, 10-30% of the barcodes were interfaced with single cells (
In this approach, the second version of microwell arrays (through-hole) are used and the microwells are aligned onto the barcode array using a precision alignment tool (
An alternative deterministic approach was also developed (
While the random cell loading such as the one described in Example enables a straightforward operation, a more deterministic approach helps improve throughputs by ensuring that almost all barcoded patches are interfaced with a single cell. For this purpose, a cell trapping and transfer method to reliable placing single cells into microwell/chambers for molecular analysis is demonstrated (
Once the cells are captured in microwells and overlaid with the high-density barcode array (or sealed with a second glass slide on top in case of devices described in Example 4), they can be lysed using a few cycles of freezing and thawing (
Library preparation follows the Cel-seq2 protocol. After the mRNA capture, the mRNA is reverse-transcribed followed by second strand synthesis. The generated cDNA is then in vitro transcribed to amplify the material captured. Amplified RNA (aRNA) is reverse transcribed and sequencing adapters are added through PCR amplification to finalize the libraries. The quality of library preparation is checked using a high sensitivity bioanalyzer (
The approach described here affords the capability to obtain polyomic measurements from same single cells. This can be achieved either through serial measurements where, for example, first up to 45 secreted proteins can be measured by interfacing the microwells with an antibody barcode followed by transcriptomic measurement by interfacing the same cells with high-density barcode array for mRNA capture (
Row and column barcodes are separated by a constant sequence. Row barcodes are designed to be between 8 and 11 bases, such that the constant region will shift a base with each longer row barcode and this will prevent any sequencing issues related to sequencing problems with constant regions.
Individual sequences containing row barcodes and column barcodes
Barcode
Name
Sequence
Barcodes
complement
Row_V1_
CGATTGAGCCGGTTTTTTTAAGCAGTGGTATC
AGTACATC
GATGTACT
8 bp
AACGCAGAGTACAGTACATCGAGTGATTGCT
TGTGACG (SEQ ID NO: 1)
Row_V1_
CGATTGAGCCGGTTTTTTTAAGCAGTGGTATC
CACGTCAGT
ACTGACGTG
9 bp
AACGCAGAGTACCACGTCAGTGAGTGATTGC
TTGTGACG (SEQ ID NO: 2)
Row_V1_
CGATTGAGCCGGTTTTTTTAAGCAGTGGTATC
GTACGTGAGC
GCTCACGTAC
10 bp
AACGCAGAGTACGTACGTGAGCGAGTGATTG
(SEQ ID
(SEQ ID
CTTGTGACG (SEQ ID NO: 3)
NO: 9)
NO: 11)
Row_V1_
CGATTGAGCCGGTTTTTTTAAGCAGTGGTATC
TCGTAGCTCGT
ACGAGCTACGA
11 bp
AACGCAGAGTACTCGTAGCTCGTGAGTGATT
(SEQ ID
(SEQ ID
GCTTGTGACG (SEQ ID NO: 4)
NO: 10)
NO: 12)
Column_
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AGCTCGTA
TACGAGCT
V1_1
NNNNNNNNTACGAGCTGTCATCAGCGTCACA
AGCAATCACTC (SEQ ID NO: 5)
Column_
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
CTGAGTCG
CGACTCAG
V1_2
NNNNNNNNCGACTCAGGTCATCAGCGTCACA
AGCAATCACTC (SEQ ID NO: 6)
Column_
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
GCTCACAT
ATGTGAGC
V1_3
NNNNNNNNATGTGAGCGTCATCAGCGTCACA
AGCAATCACTC (SEQ ID NO: 7)
Column_
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
V1_4
NNNNNNNNGCGACATAGTCATCAGCGTCACA
TATGTCGC
GCGACATA
AGCAATCACTC (SEQ ID NO: 8)
Fully extended sequences with both row and column barcode sequences
Full 1
CGATTGAGCCGGTTTTTTTAAGCAGTGGTATCAACGCAGA
GTACAGTACATCGAGTGATTGCTTGTGACGCTGATGACAG
CTCGTANNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTT
TTTT (SEQ ID NO: 13)
Full 2
CGATTGAGCCGGTTTTTTTAAGCAGTGGTATCAACGCAGA
GTACCACGTCAGTGAGTGATTGCTTGTGACGCTGATGACC
TGAGTCGNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTT
TTTTT (SEQ ID NO: 14)
Full 3
CGATTGAGCCGGTTTTTTTAAGCAGTGGTATCAACGCAGA
GTACGTACGTGAGCGAGTGATTGCTTGTGACGCTGATGAC
GCTCACATNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTT
TTTTTT (SEQ ID NO: 15)
Full 4
CGATTGAGCCGGTTTTTTTAAGCAGTGGTATCAACGCAGA
GTACTCGTAGCTCGTGAGTGATTGCTTGTGACGCTGATGA
CTATGTCGCNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTT
TTTTTTT (SEQ ID NO: 16)
All references, patents and patent applications disclosed herein are incorporated by reference with respect to the subject matter for which each is cited, which in some cases may encompass the entirety of the document.
The indefinite articles “a” and “an,” as used herein in the specification and in the claims, unless clearly indicated to the contrary, should be understood to mean “at least one.”
It should also be understood that, unless clearly indicated to the contrary, in any methods claimed herein that include more than one step or act, the order of the steps or acts of the method is not necessarily limited to the order in which the steps or acts of the method are recited.
In the claims, as well as in the specification above, all transitional phrases such as “comprising,” “including,” “carrying,” “having,” “containing,” “involving,” “holding,” “composed of,” and the like are to be understood to be open-ended, i.e., to mean including but not limited to. Only the transitional phrases “consisting of” and “consisting essentially of” shall be closed or semi-closed transitional phrases, respectively, as set forth in the United States Patent Office Manual of Patent Examining Procedures, Section 2111.03.
Patent | Priority | Assignee | Title |
12105086, | Aug 24 2012 | Yale University | System, device and method for high-throughput multi-plexed detection |
12139748, | Nov 11 2016 | IsoPlexis Corporation | Compositions and methods for the simultaneous genomic, transcriptomic and proteomic analysis of single cells |
12180531, | Dec 03 2014 | IsoPlexis Corporation | Analysis and screening of cell secretion profiles |
Patent | Priority | Assignee | Title |
10274486, | Aug 24 2012 | Yale University | System, device and method for high-throughput multi-plexed detection |
10928389, | Jul 16 2007 | California Institute of Technology | Arrays, substrates, devices, methods and systems for detecting target molecules |
9188586, | Aug 24 2012 | Yale University | System, device and method for high-throughput multi-plexed detection |
9506917, | Aug 24 2012 | Yale University | System, device and method for high-throughput multi-plexed detection |
20080268451, | |||
20090137413, | |||
20150204864, | |||
20150298091, | |||
20160054308, | |||
20160251714, | |||
20190276880, | |||
20210095331, | |||
20220057388, | |||
WO2007035633, | |||
WO2014031997, | |||
WO2014200767, | |||
WO2015044428, | |||
WO2016090148, | |||
WO2016138496, | |||
WO2016168825, | |||
WO2017087873, | |||
WO2018017469, | |||
WO2018064640, | |||
WO2021067246, |
Executed on | Assignor | Assignee | Conveyance | Frame | Reel | Doc |
Feb 13 2018 | Yale University | (assignment on the face of the patent) | / | |||
Jul 17 2023 | FAN, RONG | Yale University | ASSIGNMENT OF ASSIGNORS INTEREST SEE DOCUMENT FOR DETAILS | 064292 | /0267 | |
Jul 17 2023 | DURA, BURAK | Yale University | ASSIGNMENT OF ASSIGNORS INTEREST SEE DOCUMENT FOR DETAILS | 064292 | /0267 |
Date | Maintenance Fee Events |
Aug 12 2019 | BIG: Entity status set to Undiscounted (note the period is included in the code). |
Aug 16 2019 | SMAL: Entity status set to Small. |
Date | Maintenance Schedule |
Sep 12 2026 | 4 years fee payment window open |
Mar 12 2027 | 6 months grace period start (w surcharge) |
Sep 12 2027 | patent expiry (for year 4) |
Sep 12 2029 | 2 years to revive unintentionally abandoned end. (for year 4) |
Sep 12 2030 | 8 years fee payment window open |
Mar 12 2031 | 6 months grace period start (w surcharge) |
Sep 12 2031 | patent expiry (for year 8) |
Sep 12 2033 | 2 years to revive unintentionally abandoned end. (for year 8) |
Sep 12 2034 | 12 years fee payment window open |
Mar 12 2035 | 6 months grace period start (w surcharge) |
Sep 12 2035 | patent expiry (for year 12) |
Sep 12 2037 | 2 years to revive unintentionally abandoned end. (for year 12) |