Methods and materials for the treatment of humans suffering from hemorrhage due to trauma are provided, in which therapeutically effective amounts of BPI protein products are administered.

Patent
   5756464
Priority
May 23 1996
Filed
Sep 10 1997
Issued
May 26 1998
Expiry
May 23 2016
Assg.orig
Entity
Small
10
52
EXPIRED
1. A method of treating a human suffering from hemorrhage due to trauma comprising the step of administering a therapeutically effective amount of a bactericidal/permeability-increasing (BPI) protein product to said human.
2. The method of claim 1 wherein the BPI protein product is an amino-terminal fragment of BPI protein having a molecular weight of about 21 kD to 25 kD.
3. The method of claim 1 wherein the BPI protein product is rBPI23 or a dimeric form thereof.
4. The method of claim 1 wherein the BPI protein product is rBPI21.
5. The method of claim 1 wherein the human suffering from hemorrhage due to trauma is additionally administered at least two units of packed red blood cells.

This is a Continuation of U.S. application Ser. No. 08/652,292, filed May 23, 1996, now abandoned.

The present invention relates generally to methods and materials for treating humans suffering from hemorrhage due to trauma, by administration of bactericidal/permeability-increasing (BPI) protein products.

Acute traumatic hemorrhage, generally requiring immediate surgical intervention, is a major contributor to morbidity and mortality in the U.S. [Bickell et al., New Eng. J. Med., 331:1105-1109 (1994), Tran et al., Surgery, 114:21-30 (1993).] In 1982, there were approximately 165,000 deaths in the U.S. due to trauma, with at least two additional cases of permanent disability for each death. About 50% of these traumatic deaths occur immediately, due to direct injury to the central nervous system, heart, or one of the major blood vessels. Additional early deaths, approximately 30%, occur within several hours after injury, usually due to uncontrolled hemorrhage. The remaining 20% of deaths are so-called "late deaths", occuring during days to weeks after injury, due to complications from the traumatic hemorrhage that include infection or multiple organ system failure (MOSF) in about 80% of the cases. [Trunkey, Sci. Am., 249:28-35 (1983), Trunkey, New Eng. J. Med., 324:1259-1263 (1991).]

Among those patients who survive the immediate resuscitative and surgical interventions, approximately 10-40% suffer from a variety of morbidities, including, for example, systemic inflammation, wound infections, pneumonia, sepsis, respiratory failure, renal failure, coagulopathy, and pancreatitis. Hemorrhage and transfusion requirements may be specifically linked to increased risk of postoperative infection, respiratory complications, and multiorgan system failure [Agarwal et al., Arch. Surg., 128:171-177 (1993), Duke et al., Arch. Surg., 128:1125-1132 (1993), Tran et al., supra].

The causes of these complications from traumatic hemorrhage are multifactorial and interrelated. Many morbidities may be related to systemic inflammation following injury. It has also been hypothesized that physical trauma to tissue, direct tissue hypoperfusion, and translocation of endogenous bacteria and absorption of endotoxin from the gut lumen (due to hypoperfusion and/or other injury to the gastrointestinal tract) may play a role in the pathogenesis of these complications. The relevance of these proposed factors in the pathophysiology of the morbidities and late deaths associated with acute hemorrhagic shock in humans, however, is not clear.

Although acute traumatic hemorrhage is one potential cause of hypovolemic shock (i.e., shock due to decreased intravascular volume), there are numerous other potential causes, such as internal bleeding, e.g., gastrointestinal hemorrhage, intraperitoneal or retroperitoneal hemorrhage, hemorrhage into the femoral compartment, intrathoracic hemorrhage, aortic dissection and ruptured aortic aneurysm; excessive fluid loss due to, e.g., severe vomiting due to an intestinal or pyloric obstruction, severe diarrhea, sweating, dehydration, excessive urination (due to diabetes mellitus, diabetes insipidus, excessive diuretics, or the diuretic phase of acute renal failure) peritonitis, pancreatitis, planchnic ischemia, gangrene, bums; vasodilation due to, e.g., nervous system damage, anesthesia, ganglionic and adrenergic blockers, barbiturate overdose, poisons; and metabolic, toxic, or humoral vasodilatation, such as acute adrenal insufficiency, or an anaphylactic reaction. Other causes of shock unrelated to circulatory volume loss include cardiogenic shock (e.g., acute myocardial infarction, cardiac tamponade) and obstructive shock (e.g., acute pulmonary embolism). [See, e.g., Manual of Medical Therapeutics, 28th ed., Ewald et al., eds., Little, Brown and Company, Boston (1995); Cecil's Textbook of Medicine, 17th ed., Wyngaarden et al., eds., W. B. Saunders Co., Philadelphia (1985).]

As outlined below in Table I below, a normal individual can rapidly lose up to 20 per cent of the blood volume without any signs or symptoms. Limited signs of cardiovascular distress appear with losses up to 30 per cent of the blood volume, but signs and symptoms of hypovolemic shock generally appear when the blood loss exceeds 30 to 40 per cent of the blood volume.

TABLE I
______________________________________
Percentage
Amount
of Blood
Lost
Volume Lost
(ml) Clinical Manifestations
______________________________________
10-20% 500- Usually none, perhaps mild postural hypotension
1000 an tachycardia in response to exercise;
vasovagal syncope may occur in 5% of cases
20-30% 1000- Few changes supine; light-headedness and
1500 hypotension commonly occur when upright;
marked tachycardia in response to exertion
30-40% 1500- Blood pressure, cardiac output, central venous
2000 pressure, and urine volume are reduced even
when supine; thirst, shortness of breath, clammy
skin, sweating, clouding of consciousness and
rapid, thready pulse may be noted
40-50% 2000- Severe shock, often resulting in death
2500
______________________________________

The patient is frequently oliguric, with a urinary output of less than 20 mL per hour. Frequently, the physical findings follow a progressive pattern as shock evolves from the early compensated phase to the advanced stages. In Stage I, physiologic compensatory mechanisms, such as increased cardiac output or elevated systemic vascular resistance, are effective and minimal clinical symptoms and signs are observed. In Stage II these mechanisms cannot effectively compensate for the blood volume loss, and the patient may exhibit hypotension, tachycardia, and hyperventilation. The decreased perfusion of vital organs can result in an altered mental state ranging from agitation to stupor to coma, reduced urinary output, and myocardial ischemia (in patients with coronary artery disease). The external appearance of the patient also reflects excessive sympathetic discharge, with cyanosis, coldness, and clamminess of the skin. In Stage III, which may be irreversible, the excessive and prolonged reduction of tissue perfusion leads to significant alterations in cellular membrane function, aggregation of blood corpuscles, and "sludging" in the capillaries. The vasoconstriction which has taken place in the less vital organs in order to maintain blood pressure in now excessive and has reduced flow to such an extent that cellular damage occurs.

Following traumatic hemorrhage, conventional therapy is directed at stopping the hemorrhage, combating shock, and restoring the blood volume. Prompt fluid resuscitation is preferably given through large-bore catheters placed in large peripheral veins. The pneumatic antishock garment, with sequential inflation of legs and abdominal compartments to 15-40 mm Hg, may temporily stabilize patients by increasing peripheral systemic vascular resistance. Restoration of the blood volume may be achieved by intravenous infusion of electrolyte solutions; colloid solutions of plasma protein, albumin, or dextran; or fresh whole blood. In the emergency situation, electrolyte solutions, albumin, or dextran are preferred over fresh whole blood because of the large amounts of fluid required, the possible delay in transfusion if typing and cross-matching are performed, and the possibility of allergic transfusion reactions. When shock is due to hemorrhage, packed red blood cells should be given as soon as feasible. When hemorrhage is massive, type-specific unmatched blood can be given safely. Rarely, type O blood may be needed.

Rapid infusion of Ringer's lactated or normal saline solution is the most widely used fluid therapy following hemorrhage. An initial infusion of two to three times the volume of the estimated blood loss is administered. Because these solutions are rapidly distributed throughout the intravascular and extravascular compartments, they must be supplemented with colloid solutions. When large volumes of electrolyte solutions are infused, patients often develop peripheral edema and elderly patients may develop pulmonary edema.

The colloidal preparations in wide use include a 6 per cent solution of high molecular weight dextran (dextran 70), a 10 per cent solution of low molecular weight dextran (dextran 40), and a 5 per cent solution of albumin in normal saline. Infusions of dextran 70 produce an initial volume effect slightly greater than the amount infused. Dextran 70 is slowly cleared over one to two days, allowing time for normal physiologic mechanisms to replace the volume lost. Dextran 40 has the advantage of an initial volume effect of nearly twice the amount infused. The lower molecular weight material is more rapidly cleared, however, and the volume-expanding effect is dissipated by 24 hours, before normal volume replacement mechanisms are maximal. Acute renal failure has occurred in a few patients receiving dextran 40. With either dextran solution, volumes in excess of one liter may interfere with platelet adhesiveness and the normal coagulation cascade. A solution of 5 per cent albumin in normal saline has the advantage of producing a known volume effect in the hypovolemic patient, but this preparation is relatively costly and time-consuming to prepare. A hypertonic albumin preparation containing 120 mEq of sodium lactate, 120 mEq of sodium chloride, and 12.5 grams of albumin per liter provides a predictable volume effect and minimizes interstitial fluid leakage. Use of hypertonic solutions requires careful monitoring of arterial and central venous pressures to avoid fluid overload. Coexisting problems such as congestive heart failure, valvular heart disease, myocardial ischemia, or renal insufficiency must be carefully monitored, and invasive hemodynamic monitoring must be considered during acute management. Associated coagulopathy and electrolyte imbalance must also be corrected.

BPI is a protein isolated from the granules of mammalian polymorphonuclear leukocytes (PMNs or neutrophils), which are blood cells essential in the defense against invading microorganisms. Human BPI protein has been isolated from PMNs by acid extraction combined with either ion exchange chromatography [Elsbach, J. Biol. Chem., 254:11000 (1979)] or E. coli affinity chromatography [Weiss, et al., Blood, 69:652 (1987)]. BPI obtained in such a manner is referred to herein as natural BPI and has been shown to have potent bactericidal activity against a broad spectrum of gram-negative bacteria. The molecular weight of human BPI is approximately 55,000 daltons (55 kD). The amino acid sequence of the entire human BPI protein and the nucleic acid sequence of DNA encoding the protein have been reported in Figure 1 of Gray et al., J. Biol. Chem., 264:9505 (1989), incorporated herein by reference. The Gray et al. amino acid sequence is set out in SEQ ID NO: 1 hereto. U.S. Pat. No. 5,198,541 discloses recombinant genes encoding and methods for expression of BPI proteins, including BPI holoprotein and fragments of BPI.

BPI is a strongly cationic protein. The N-terminal half of BPI accounts for the high net positive charge; the C-terminal half of the molecule has a net charge of -3. [Elsbach and Weiss (1981), supra.] A proteolytic N-terminal fragment of BPI having a molecular weight of about 25 kD possesses essentially all the anti-bacterial efficacy of the naturally-derived 55 kD human BPI holoprotein. [Ooi et al., J. Bio. Chem., 262: 14891-14894 (1987)]. In contrast to the N-terminal portion, the C-terminal region of the isolated human BPI protein displays only slightly detectable anti-bacterial activity against gram-negative organisms. [Ooi et al., J. Exp. Med., 174:649 (1991).] An N-terminal BPI fragment of approximately 23 kD, referred to as "rBPI23," has been produced by recombinant means and also retains anti-bacterial activity against gram-negative organisms. Gazzano-Santoro et al., Infect. Immun. 60:4754-4761 (1992).

The bactericidal effect of BPI has been reported to be highly specific to gram-negative species, e.g., in Elsbach and Weiss, Inflammation: Basic Principles and Clinical Correlates, eds. Gallin et al., Chapter 30, Raven Press, Ltd. (1992). The precise mechanism by which BPI kills gram-negative bacteria is not yet completely elucidated, but it is believed that BPI must first bind to the surface of the bacteria through electrostatic and hydrophobic interactions between the cationic BPI protein and negatively charged sites on LPS. In susceptible gram-negative bacteria, BPI binding is thought to disrupt LPS structure, leading to activation of bacterial enzymes that degrade phospholipids and peptidoglycans, altering the permeability of the cell's outer membrane, and initiating events that ultimately lead to cell death. [Elsbach and Weiss (1992), supra]. LPS has been referred to as "endotoxin" because of the potent inflammatory response that it stimulates, i.e., the release of mediators by host inflammatory cells which may ultimately result in irreversible endotoxic shock. BPI binds to lipid A, reported to be the most toxic and most biologically active component of LPS.

BPI protein has never been used previously for the treatment of humans suffering from hemorrhage due to trauma or the shock associated with traumatic blood loss (i.e., hypovolemic shock). Bahrami et al., presentation at Vienna International Endotoxin Society Meeting, August, 1992, report the administration of BPI protein to rats subjected to hemorrhage. Yao et al., Ann. Surg., 221:398-405 (1995), report the administration of rBPI21 (described infra) to rats subjected to prolonged hemorrhagic insult for 180 minutes followed by resuscitation. U.S. Pat. Nos. 5,171,739, 5,089,724 and 5,234,912 report the use of BPI in various in vitro and in vivo animal model studies asserted to be correlated to methods of treating endotoxin-related diseases, including endotoxin-related shock. In co-owned, co-pending U.S. application Ser. Nos. 08/378,228, filed Jan. 24, 1995, 08/291,112, filed Aug. 16, 1994, and 08/188,221, filed Jan. 24, 1994, incorporated herein by reference, the administration of BPI protein product to humans with endotoxin in circulation was described. [See also, von der Mohlen et al., J. Infect. Dis. 172:144-151 (1995); von der Mohlen et al., Blood 85:3437-3443 (1995); de Winter et al., J. Inflam. 45:193-206 (1995)]. In co-owned, co-pending U.S. application Ser. No. 08/644,287, filed May 10, 1995 the administration of BPI protein product to humans suffering from severe meningococcemia was described.

In spite of treatment with antibiotics and state-of-the-art medical intensive care therapy, human mortality and morbidities associated with hemorrhage due to trauma remain significant and unresolved by current therapies. New therapeutic methods are needed that could reduce or ameliorate the adverse events and improve the clinical outcome of such patients.

The present invention provides novel methods for treating humans suffering from hemorrhage due to trauma, involving the administration of BPI protein products to provide clinically verifiable alleviation of the adverse effects of, or complications associated with, this disease state, including mortality and complications or morbidities.

According to the invention, BPI protein products such as rBPI21 are administered to humans suffering from acute traumatic hemorrhage in amounts sufficient to reduce or prevent mortality and/or to reduce the incidence (i.e., occurrence) or severity of complications or morbidities, including infection (e.g., surgical site infection) or organ dysfunction (e.g., disseminated intravascular coagulation, acute respiratory distress syndrome, acute renal failure, or hepatobiliary dysfunction).

Numerous additional aspects and advantages of the invention will become apparent to those skilled in the art upon consideration of the following detailed description of the invention which describes presently preferred embodiments thereof.

Acute hemorrhage due to trauma is a life-threatening condition with significant mortality and morbidities despite state-of-the-art medical intensive care. The administration of BPI protein products to humans suffering from acute traumatic hemorrhage is expected to effectively decrease mortality and reduce the incidence (i.e., occurrence) or severity of complications or morbidities associated with or resulting from hemorrhage due to trauma. Complications include infection (e.g., in surgical sites, wounds, organs, anatomical spaces, the bloodstream, the urinary tract, or pneumonia) or organ dysfunction (e.g., disseminated intravascular coagulation, acute respiratory distress syndrome, acute renal failure, or hepatobiliary dysfunction), and may include serious complications. These unexpected effects on the mortality and complications associated with and resulting from hemorrhage due to trauma indicate that BPI protein products effectively interfere with or block a number of the multiple poorly-understood pathophysiologic processes that have led to poor outcomes in this condition.

BPI protein products are expected to provide beneficial effects for patients suffering from hemorrhage due to trauma, such as reduced injury severity score, reduced length of time on ventilatory support and inotropic (vasoactive) therapy, reduced duration or severity of associated coagulopathy, reduced stay in the ICU, reduced stay in the hospital overall, and reduced incidence and duration of complications such as coagulopathy, respiratory failure, renal failure, hepatic failure, coma or altered mental state, adrenal cortical necrosis, and severe infection, including in wounds, organs, anatomical spaces, the bloodstream, the urinary tract, or pneumonia.

Therapeutic compositions comprising BPI protein product may be administered systemically or topically. Systemic routes of administration include oral, intravenous, intramuscular or subcutaneous injection (including into a depot for long-term release), intraocular and retrobulbar, intrathecal, intraperitoneal (e.g. by intraperitoneal lavage), intrapulmonary using aerosolized or nebulized drug, or transdermal. The preferred route is intravenous administration. When given parenterally, BPI protein product compositions are generally injected in doses ranging from 1 μg/kg to 100 mg/kg per day, preferably at doses ranging from 0.1 mg/kg to 20 mg/kg per day, more preferably at doses ranging from 1 to 20 mg/kg/day and most preferably at doses ranging from 2 to 10 mg/kg/day. The treatment may continue by continuous infusion or intermittent injection or infusion, at the same, reduced or increased dose per day for, e.g., 1 to 3 days, and additionally as determined by the treating physician. BPI protein products are preferably administered intravenously by an initial bolus followed by a continuous infusion. One preferred regimen is a 1 to 20 mg/kg intravenous bolus of BPI protein product followed by intravenous infusion at a dose of 1 to 20 mg/kg/day, continuing for up to one week. Another preferred dosing regimen is a 2 to 10 mg/kg initial bolus followed by intravenous infusion at a dose of 2 to 10 mg/kg/day, continuing for up to 72 hours. Presently preferred is a continuous intravenous infusion of BPI protein product at a dose of 8 mg/kg over 48 hours. Topical routes include administration in the form of salves, ophthalmic drops, ear drops, irrigation fluids (for, e.g., irrigation of wounds) or medicated shampoos. For example, for topical administration in drop form, about 10 to 200 μL of a BPI protein product composition may be applied one or more times per day as determined by the treating physician. Those skilled in the art can readily optimize effective dosages and administration regimens for therapeutic compositions comprising BPI protein product, as determined by good medical practice and the clinical condition of the individual patient.

As used herein, "BPI protein product" includes naturally and recombinantly produced BPI protein; natural, synthetic, and recombinant biologically active polypeptide fragments of BPI protein; biologically active polypeptide variants of BPI protein or fragments thereof, including hybrid fusion proteins and dimers; biologically active polypeptide analogs of BPI protein or fragments or variants thereof, including cysteine-substituted analogs; and BPI-derived peptides. The BPI protein products administered according to this invention may be generated and/or isolated by any means known in the art. U.S. Pat. No. 5,198,541, the disclosure of which is incorporated herein by reference, discloses recombinant genes encoding and methods for expression of BPI proteins including recombinant BPI holoprotein, referred to as rBPI50 (or rBPI) and recombinant fragments of BPI. Co-owned, copending U.S. patent application Ser. No. 07/885,501 and a continuation-in-part thereof, U.S. patent application Ser. No. 08/072,063 filed May 19, 1993 and corresponding PCT Application No. 93/04752 filed May 19, 1993, which are all incorporated herein by reference, disclose novel methods for the purification of recombinant BPI protein products expressed in and secreted from genetically transformed mammalian host cells in culture and discloses how one may produce large quantities of recombinant BPI products suitable for incorporation into stable, homogeneous pharmaceutical preparations.

Biologically active fragments of BPI (BPI fragments) include biologically active molecules that have the same or similar amino acid sequence as a natural human BPI holoprotein, except that the fragment molecule lacks amino-terminal amino acids, internal amino acids, and/or carboxy-terminal amino acids of the holoprotein. Nonlimiting examples of such fragments include a N-terminal fragment of natural human BPI of approximately 25 kD, described in Ooi et al., J. Exp. Med., 174:649 (1991), and the recombinant expression product of DNA encoding N-terminal amino acids from 1 to about 193 or 199 of natural human BPI, described in Gazzano-Santoro et al., Infect. Immun. 60:4754-4761 (1992), and referred to as rBPI23. In that publication, an expression vector was used as a source of DNA encoding a recombinant expression product (rBPI23) having the 31-residue signal sequence and the first 199 amino acids of the N-terminus of the mature human BPI, as set out in Figure 1 of Gray et al., supra, except that valine at position 151 is specified by GTG rather than GTC and residue 185 is glutamic acid (specified by GAG) rather than lysine (specified by AAG). Recombinant holoprotein (rBPI50) has also been produced having the sequence (SEQ ID NOS: 1 and 2) set out in FIGURE 1 of Gray et al., supra, with the exceptions noted for rBPI23 and with the exception that residue 417 is alanine (specified by GCT) rather than valine (specified by GTT). Other examples include dimeric forms of BPI fragments, as described in co-owned and co-pending U.S. patent application Ser. No. 08/212,132, filed Mar. 11, 1994, and corresponding PCT Application No. PCT/US95/03125, the disclosures of which are incorporated herein by reference. Preferred dimeric products include dimeric BPI protein products wherein the monomers are amino-terminal BPI fragments having the N-terminal residues from about 1 to 175 to about 1 to 199 of BPI holoprotein. A particularly preferred dimeric product is the dimeric form of the BPI fragment having N-terminal residues 1 through 193, designated rBPI42 dimer.

Biologically active variants of BPI (BPI variants) include but are not limited to recombinant hybrid fusion proteins, comprising BPI holoprotein or biologically active fragment thereof and at least a portion of at least one other polypeptide, and dimeric forms of BPI variants. Examples of such hybrid fusion proteins and dimeric forms are described by Theofan et al. in co-owned, copending U.S. patent application Ser. No. 07/885,911, and a continuation-in-part application thereof, U.S. patent application Ser. No. 08/064,693 filed May 19, 1993 and corresponding PCT Application No. US93/04754 filed May 19, 1993, which are all incorporated herein by reference and include hybrid fusion proteins comprising, at the amino-terminal end, a BPI protein or a biologically active fragment thereof and, at the carboxy-terminal end, at least one constant domain of an immunoglobulin heavy chain or allelic variant thereof. Similarly configured hybrid fusion proteins involving part or all Lipopolysaccharide Binding Protein (LBP) are also contemplated for use in the present invention.

Biologically active analogs of BPI (BPI analogs) include but are not limited to BPI protein products wherein one or more amino acid residues have been replaced by a different amino acid. For example, co-owned, copending U.S. patent application Ser. No. 08/013,801 filed Feb. 2, 1993 and corresponding PCT Application No. US94/01235 filed Feb. 2, 1994, the disclosures of which are incorporated herein by reference, discloses polypeptide analogs of BPI and BPI fragments wherein a cysteine residue is replaced by a different amino acid. A preferred BPI protein product described by this application is the expression product of DNA encoding from amino acid 1 to approximately 193 or 199 of the N-terminal amino acids of BPI holoprotein, but wherein the cysteine at residue number 132 is substituted with alanine and is designated rBPI21 Δcys or rBPI21. Other examples include dimeric forms of BPI analogs; e.g. co-owned and co-pending U.S. patent application Ser. No. 08/212,132 filed Mar. 11, 1994, and corresponding PCT Application No. PCT/US95/03125, the disclosures of which are incorporated herein by reference.

Other BPI protein products useful according to the methods of the invention are peptides derived from or based on BPI produced by recombinant or synthetic means (BPI-derived peptides), such as those described in co-owned and co-pending U.S. patent application Ser. No. 08/504,841 filed Jul. 20, 1995 and in co-owned and copending PCT Application No. PCT/US94/10427 filed Sep. 15, 1994, which corresponds to U.S. patent application Ser. No. 08/306,473 filed Sep. 15, 1994, and PCT Application No. US94/02465 filed Mar. 11, 1994, which corresponds to U.S. patent application Ser. No. 08/209,762, filed Mar. 11, 1994, which is a continuation-in-part of U.S. patent application Ser. No. 08/183,222, filed Jan. 14, 1994, which is a continuation-in-part of U.S. patent application Ser. No. 08/093,202 filed Jul. 15, 1993 (for which the corresponding international application is PCT Application No. US94/02401 filed Mar. 11, 1994), which is a continuation-in-part of U.S. patent application Ser. No. 08/030,644 filed Mar. 12, 1993, the disclosures of all of which are incorporated herein by reference.

Presently preferred BPI protein products include recombinantly-produced N-terminal fragments of BPI, especially those having a molecular weight of approximately between 21 to 25 kD such as rBPI23 or rBPI21, or dimeric forms of these N-terminal fragments (e.g., rBPI42 dimer). Additionally, preferred BPI protein products include rBPI50 and BPI-derived peptides. Particularly preferred is rBPI21.

The administration of BPI protein products is preferably accomplished with a pharmaceutical composition comprising a BPI protein product and a pharmaceutically acceptable diluent, adjuvant, or carrier. The BPI protein product may be administered without or in conjunction with known surfactants, other chemotherapeutic agents or additional known anti-microbial agents. One pharmaceutical composition containing BPI protein products (e.g., rBPI50, rBPI23) comprises the BPI protein product at a concentration of 1 mg/ml in citrate buffered saline (5 or 20 mM citrate, 150 mM NaCl, pH 5.0) comprising 0.1% by weight of poloxamer 188 (Pluronic F-68, BASF Wyandotte, Parsippany, N.J.) and 0.002% by weight of polysorbate 80 (Tween 80, ICI Americas Inc., Wilmington, Del.). Another pharmaceutical composition containing BPI protein products (e.g., rBPI21) comprises the BPI protein product at a concentration of 2 mg/mL in 5 mM citrate, 150 mM NaCl, 0.2% poloxamer 188 and 0.002% polysorbate 80. Such combinations are described in co-owned, co-pending PCT Application No. US94/01239 filed Feb. 2, 1994, which corresponds to U.S. patent application Ser. No. 08/190,869 filed Feb. 2, 1994 and U.S. patent application Ser. No. 08/012,360 filed Feb. 2, 1993, the disclosures of all of which are incorporated herein by reference.

Other aspects and advantages of the present invention will be understood upon consideration of the following illustrative examples. Example 1 addresses the effect of BPI protein product administration in humans on the mortality and complications associated with hemorrhage due to trauma.

PAC Clinical Study Protocol--Therapeutic Effects of BPI Protein Product

A human clinical study was designed to examine the effect of an exemplary BPI protein product, rBPI21, in the treatment of patients with acute hemorrhage due to trauma. Thus, a multicenter, randomized, double-blind, placebo-controlled trial was implemented comparing placebo treatment and rBPI21 treatment given over 48 hours in patients with acute hemorrhage due to trauma. Approximately 400 patients admitted to the emergency department with acute hemorrhage due to trauma and requiring transfusion of at least two units of blood are randomized in a 1:1 ratio for treatment with either rBPI21 or placebo. In addition to standard therapy, each patient receives by continuous intravenous infusion either rBPI21 at 8 mg/kg over 48 hours (4 mg/kg/day×2 days) or the equivalent volume of placebo. In most instances the weight of the patient in kilograms is determined as a best estimate.

Efficacy is monitored from Day 1 to Day 15 by following patients for development of complications, such as impaired organ function and infection, and for survival. Safety is monitored by pre-treatment and serial post-treatment testing of chemistries and hematology parameters, as well as daily assessments for adverse events through Day 15. A final survival assessment occurs on Day 29. Immune response to and pharmacokinetics of rBPI21 are measured at selected study sites by drawing blood to assay for rBPI21 at appropriate time points.

Patients brought to the hospital with acute hemorrhage due to trauma are selected for enrollment in the study if they meet the following inclusion and exclusion criteria. Inclusion criteria are: (1) age 18 (or age of consent) to 75 years, inclusive; (2) patient suffering from acute hemorrhage secondary to trauma; (3) study drug given within 6 hours of occurrence of the traumatic event (if precise time of event was unknown best estimate was provided); (4) patient requires and has begun to receive a second unit of packed red blood cells; and (5) patient provides verbal informed consent or next of kin provides written informed consent. Exclusion criteria are: (1) a triage Revised Trauma Score (RTS, scale 0-12) less than 2.0 upon admission to the Emergency Department, see Table II below [Champion et al., Crit. Care Med., 9(9):672-676 (1981); Greenfield et al., Chapter 10, in Surgery Scientific Principles and Practices, J. B. Lippincott Co., Philadelphia, pp. 252-255 (1993)]; (2) severe head trauma (Glasgow Coma Score≦5), see Table III below [Teasdale et al., Lancet, 1: 81 (1974)]; (3) isolated cranial injury; (4) spinal injury with paralysis; (5) burn injuries with at least 20% body surface area with second degree bums; (6) known positive HIV (test not mandatory at entry); (7) known pre-existing renal disease (creatinine>2.0); (8) known pre-existing cardiac disease (NY Heart Association class greater than III, see Table IV below [Braunwald, in Braunwald et al., Heart Disease, The Textbook of Cardiovascular Medicine, 3rd ed., W. B. Saunders Company, Philadelphia, Pa., page 12 (1988); J. Am. Med. Ass'n, 249:539-544 (1988)]); (9) known pre-existing primary or metastatic malignancy in visceral organs; (10) arterial pH (at initial evaluation)<6.8 or base deficit>15 (if measured); (11) known current steroid therapy (>10 mg prednisone/day for>one month); (12) known pre-existing cirrhosis or active hepatitis; (13) pregnancy or lactation; (14) participation in other investigational drug studies (including investigational blood products) within previous 30 days; (15) weight (estimated) greater than 120 kg; and (16) a "do not resuscitate" (DNR) or equivalent order.

TABLE II
______________________________________
Triage Revised Trauma Score*
ASSESSMENT METHOD CODING
______________________________________
1. Respiratory
Count respiratory rate in 15
10-29 =
4
Rate sec and multiply by 4
>29 = 3
(RR) 6-9 = 2
1-5 = 1
0 = 0
2. Systolic Blood
Measure systolic cuff
>89 = 4
Pressure pressure in either arm by
76-89 =
3
(SBP) auscultation or palpation
50-75 =
2
1-49 = 1
0 = 0
3. Glasgow Calculate according to Table
Convert GCS to
Coma Score III below the Following
(GCS) Code:
13-15 =
4
9-12 = 3
6-8 = 2
4-5 = 1
<4 = 0
______________________________________
*The triage revised trauma score is the sum of the codes for RR, SBP and
GCS (range 0-12).
TABLE III
______________________________________
Glasgow Coma Scale*
______________________________________
Eye Opening
Spontaneous 4
Response to sound
3
Response to pain
2
Never 1
Motor Response
Obey commands 6
Localized pain 5
Normal flexion: 4
(withdrawal)
Abnormal flexion
3
(Decorticate)
No response 1
Verbal Response
Oriented 5
Confused conversation
4
Inappropriate words
3
Incomprehensible sounds
2
None 1
______________________________________
*Scores range from 3 to 15
TABLE IV
______________________________________
Modified New York Heart Association
Functional Classification
______________________________________
Class I.
Patients with cardiac disease but with no limitation of
physical activity. Ordinary physical activity causes no
undue dyspnea, anginal pain, fatigue, or palpitation.
Class IIS.
Patients with slight limitation of physical activity.
They are comfortable at rest and with moderate
exertion. They experience symptoms only with the
more strenuous grades of ordinary activity.
Class IIM.
Patients with moderate limitation of physical ability.
They are comfortable at rest and with mild exertion.
They experience symptoms with moderate grades of
ordinary activity.
Class III.
Patients with marked limitation of physical activity.
They are comfortable at rest but experience symptoms
even with the milder forms of ordinary activity.
Class IV.
Patients with inability to carry on any physical activity
without discomfort. Symptoms of cardiac insufficiency
or of the anginal syndrome may be present, even at
rest, and are intensified by activity.
______________________________________

The following are recorded for all patients randomized to treatment: (1) date and estimated time of incident, and date and time of admission to the Emergency Department; (2) for patients randomized and not treated, the reason for not treating; (3) from arrival at hospital until approximately 48 hours post-operatively, date, time, volume, and location that patient receives blood, blood products, and fluids such as packed red blood cells, whole blood, autotransfusion, platelets, fresh frozen plasma, crystalloid, or colloid, at locations such as Emergency Department, Operating Room, Post-anesthesia Care Unit, or Surgical Intensive Care Unit; however, if the patient does not undergo surgery, the above items that are applicable are collected during study days 1, 2, and 3; (4) date and time the second unit of blood is administered (should precede surgery, to assure that hemorrhage is due to trauma, not surgery), and date and start and stop times of anesthesia; (5) date and start and stop times of surgery, estimated blood loss in operating room, and date and time in post-anesthesia care unit; (6) date and time study drug infusion begins and ends, volume infused, and reasons for temporary or permanent discontinuation; if applicable, and if discontinued, quantity infused; (7) directed medical history (including extent and nature of injuries, intercurrent diseases, conditions contributing to bleeding, etc.), demographic and directed physical exam information, such as gender, age, weight (estimated or measured), height (estimated or measured), vital signs, physical signs of injury; (8) results of the pregnancy test performed during screening for eligibility of appropriate female patients (refers to all women of child bearing potential, i.e., all women who are not either surgically sterile or documented to be post-menopausal); and (9) results of the triage RTS performed during screening for eligibility (including actual measurements).

After transfusion of the second unit of blood is initiated, the investigator administers an unknown test drug from kits in numbered consecutive order. Each kit contains either rBPI21 or placebo. The rBPI21 is supplied as a clear, colorless, sterile non-pyrogenic solution in 10 mL single use glass vials at a concentration of 2 mg/mL, in 5 mM sodium citrate/0.15M sodium chloride buffer, pH 5.0 with 0.2% poloxamer 188 and 0.002% polysorbate 80, containing no preservative. The rBPI21 is stored refrigerated at 2°-8°C at all times prior to administration. The placebo is supplied as a clear, colorless sterile non-pyrogenic solution in 10 mL single use glass vials. It is composed of 0.2 mg/mL human serum albumin in 5 mM sodium citrate/0. 15M sodium chloride buffer, pH 5.0, containing no preservative. The placebo is stored refrigerated at 2°-8°C at all times prior to administration. The kit assigned to each patient contains a sufficient number of vials of study medication for all doses for that patient. Each vial contains 10 mL of test article.

The study is administered to two groups ("active" rBPI21 and placebo control) as outlined above. The study medication is brought to room temperature prior to infusion. Throughout the dosing procedure, good aseptic technique for intravenous administration is followed. The study medication is administered by intravenous infusion into a central or peripheral vein over 48 hours. The infusion bag/tubing administration set is completely changed after 24 hours. Suitability of intravenous access is determined by easy withdrawal of blood from the access, as well as easy infusion of intravenous fluids without infiltration. The study medication is the sole agent administered in the chosen port during the course of the infusion protocol. The venous access port is not heparinized, but is flushed as necessary with physiologic saline. Any sign of a reaction at a site of infusion is recorded on the patient's case record form and source document as an adverse experience.

All patients treated at selected study sites are assessed for: (1) blood levels of rBPI21 : blood for the assessment of the rBPI21 level is drawn at the following times (at selected study sites only): prior to the start of the infusion (up to 60 minutes prior to the start of the infusion), the following times (hours) after the start of the infusion; 1, 4, 8, 12, 20, 24, 32, 36, 40, within 15 minutes prior to the completion of the 48 hour infusion, and the following times after completion of the infusion; 7 minutes (48:07), 15 minutes (48:15), 30 minutes (48:30), 1 hour (49:00), 3 hours (51:00), 6 hours (54:00), and 24 hours (72:00); (2) antibodies to rBPI21 : blood for assessment of antibodies to rBPI21 is drawn at selected study sites at the following times: Day 1 prior to study drug infusion, and Days 15 and 29, if the patient is still in hospital or returns to clinic. Actual draw days may vary from Days 10-20 and Days 21-29; and (3) cytokines: blood for assessment of cytokines is drawn at selected study sites.

The following safety laboratory panels are assessed at Day 1 prior to test drug infusion, Day 3 (after end of infusion) and Day 8, however, if patient is discharged on or prior to Day 8, assessment is made prior to discharge if possible: (1) hematology panel: hemoglobin, hematocrit, erythrocyte count, leukocyte count and differential, and platelet count; (2) serum chemistry panel: sodium, potassium, chloride, calcium, phosphorous, blood urea nitrogen, creatinine, uric acid, glucose (fasting), CPK, cholesterol, albumin, total protein, AST (SGOT), ALT (SGPT), bilirubin (total), GGT, LDH, and alakaline phosphatase.

The following are recorded for all treated patients through Day 15 post-initiation of study drug infusion: (1) adverse events; (2) survival status including date and cause(s) of death (continued through Day 29); (3) dates in ICU; (4) dates in hospital; (5) dates on ventilator; (6) dates on dialysis or hemofiltration, specifying method; (7) concomitant medications, including daily amounts of blood transfused; (8) primary surgical procedures performed, for example, including re-operations but excluding procedures like placement of central lines, Swan-Ganz catheters, arterial lines; lumbar punctures, etc.; (9) injury severity score (ISS) based on diagnostic evaluations performed during current hospital stay; (10) daily assessment of infections and organ dysfunctions; (11) daily vital signs associated with and including daily maximum and daily minimum temperatures; and (12) inspection of infusion site used for study drug administration at least every eight hours, with observations documented in progress notes or the equivalent.

Organ dysfunctions were assessed as follows. The patient is considered to have disseminated intravascular coagulation when there are: (1) abnormally low values for platelets (or there is a >25% decrease from a previously documented value) and either an elevated prothrombin time or an elevated partial thromboplastin time and clinical evidence of bleeding, or (2) if obtained, a confirmatory test is positive (FDP>1:40 or D-Dimers>2.0). These abnormalities must occur in the absence of medically significant confounding factors such as liver failure, major hematoma, or anticoagulant therapy.

The patient is considered to have acute respiratory distress syndrome when: bilateral pulmonary infiltrates consistent with pulmonary edema are present, and PaO2 /FiO2 <200. These signs must occur in the absence of congestive heart failure or primary lung disease such as pulmonary embolus or pneumonia. The Pulmonary Artery Wedge Pressure (PAWP), when measured, must be <18 mm Hg.

The patient is considered to have acute renal failure when: (1) dialysis or hemofiltration is required (definition used for primary analysis), or (2) serum creatinine becomes abnormal with an increase of ≧2.0 mg/dL in patient with documented normal baseline creatinine, or (3) serum creatinine is ≧3.0 mg/dL in a patient not known to have renal insufficiency, but whose (pretrauma) baseline creatinine is unknown, or (4) serum creatinine is doubled from admission or pre-rBPI21 treatment level in a patient with previous renal insufficiency. These findings must not be prerenal in nature (e.g. associated with dehydration or gastrointestinal bleeding) or due to rhabdomyolysis.

Post-surgical hepatobiliary dysfunction is evaluated only in patients without primary hepatic disease (e.g., hepatitis or cirrhosis), alcoholism, or biliary disease. The patient is considered to have hepatobiliary dysfunction when: the bilirubin exceeds 3.0 mg/dL, and either the alkaline phosphatase, gamma glutamyl transpeptidase (GGT), or alanine aminotransferase (ALT, or SGPT) exceeds twice the upper limit of normal. These findings must occur in the absence of confounding disease.

Patients are also evaluated for infections in wounds, surgical sites (both superficial and deep incisional sites), organs, anatomical spaces, the bloodstream, the urinary tract, or the respiratory tract (pneumonia).

Numerous modifications and variations of the above-described invention are expected to occur to those of skill in the art. Accordingly, only such limitations as appear in the appended claims should be placed thereon.

__________________________________________________________________________
SEQUENCE LISTING
(1) GENERAL INFORMATION:
(iii) NUMBER OF SEQUENCES: 2
(2) INFORMATION FOR SEQ ID NO:1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1813 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 31..1491
(ix) FEATURE:
(A) NAME/KEY: mat-- peptide
(B) LOCATION: 124..1491
(ix) FEATURE:
(A) NAME/KEY: misc-- feature
(D) OTHER INFORMATION: "rBPI"
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:
CAGGCCTTGAGGTTTTGGCAGCTCTGGAGGATGAGAGAGAACATGGCCAGGGGC54
MetArgGluAsnMetAlaArgGly
31-30-25
CCTTGCAACGCGCCGAGATGGGTGTCCCTGATGGTGCTCGTCGCCATA102
ProCysAsnAlaProArgTrpValSerLeuMetValLeuValAlaIle
20-15- 10
GGCACCGCCGTGACAGCGGCCGTCAACCCTGGCGTCGTGGTCAGGATC150
GlyThrAlaValThrAlaAlaValAsnProGlyValValValArgIle
515
TCCCAGAAGGGCCTGGACTACGCCAGCCAGCAGGGGACGGCCGCTCTG198
SerGlnLysGlyLeuAspTyrAlaSerGlnGlnGlyThrAlaAlaLeu
10152025
CAGAAGGAGCTGAAGAGGATCAAGATTCCTGACTACTCAGACAGCTTT246
GlnLysGluLeuLysArgIleLysIleProAspTyrSerAspSerPhe
303540
AAGATCAAGCATCTTGGGAAGGGGCATTATAGCTTCTACAGCATGGAC294
LysIleLysHisLeuGlyLysGlyHisTyrSerPheTyrSerMetAsp
455055
ATCCGTGAATTCCAGCTTCCCAGTTCCCAGATAAGCATGGTGCCCAAT342
IleArgGluPheGlnLeuProSerSerGlnIleSerMetValProAsn
606570
GTGGGCCTTAAGTTCTCCATCAGCAACGCCAATATCAAGATCAGCGGG390
ValGlyLeuLysPheSerIleSerAsnAlaAsnIleLysIleSerGly
758085
AAATGGAAGGCACAAAAGAGATTCTTAAAAATGAGCGGCAATTTTGAC438
LysTrpLysAlaGlnLysArgPheLeuLysMetSerGlyAsnPheAsp
9095100105
CTGAGCATAGAAGGCATGTCCATTTCGGCTGATCTGAAGCTGGGCAGT486
LeuSerIleGluGlyMetSerIleSerAlaAspLeuLysLeuGlySer
110115120
AACCCCACGTCAGGCAAGCCCACCATCACCTGCTCCAGCTGCAGCAGC534
AsnProThrSerGlyLysProThrIleThrCysSerSerCysSerSer
125130135
CACATCAACAGTGTCCACGTGCACATCTCAAAGAGCAAAGTCGGGTGG582
HisIleAsnSerValHisValHisIleSerLysSerLysValGlyTrp
140145150
CTGATCCAACTCTTCCACAAAAAAATTGAGTCTGCGCTTCGAAACAAG630
LeuIleGlnLeuPheHisLysLysIleGluSerAlaLeuArgAsnLys
155160165
ATGAACAGCCAGGTCTGCGAGAAAGTGACCAATTCTGTATCCTCCAAG678
MetAsnSerGlnValCysGluLysValThrAsnSerValSerSerLys
170175180185
CTGCAACCTTATTTCCAGACTCTGCCAGTAATGACCAAAATAGATTCT726
LeuGlnProTyrPheGlnThrLeuProValMetThrLysIleAspSer
190195200
GTGGCTGGAATCAACTATGGTCTGGTGGCACCTCCAGCAACCACGGCT774
ValAlaGlyIleAsnTyrGlyLeuValAlaProProAlaThrThrAla
205210215
GAGACCCTGGATGTACAGATGAAGGGGGAGTTTTACAGTGAGAACCAC822
GluThrLeuAspValGlnMetLysGlyGluPheTyrSerGluAsnHis
220225230
CACAATCCACCTCCCTTTGCTCCACCAGTGATGGAGTTTCCCGCTGCC870
HisAsnProProProPheAlaProProValMetGluPheProAlaAla
235240245
CATGACCGCATGGTATACCTGGGCCTCTCAGACTACTTCTTCAACACA918
HisAspArgMetValTyrLeuGlyLeuSerAspTyrPhePheAsnThr
250255260265
GCCGGGCTTGTATACCAAGAGGCTGGGGTCTTGAAGATGACCCTTAGA966
AlaGlyLeuValTyrGlnGluAlaGlyValLeuLysMetThrLeuArg
270275280
GATGACATGATTCCAAAGGAGTCCAAATTTCGACTGACAACCAAGTTC1014
AspAspMetIleProLysGluSerLysPheArgLeuThrThrLysPhe
285290295
TTTGGAACCTTCCTACCTGAGGTGGCCAAGAAGTTTCCCAACATGAAG1062
PheGlyThrPheLeuProGluValAlaLysLysPheProAsnMetLys
300305310
ATACAGATCCATGTCTCAGCCTCCACCCCGCCACACCTGTCTGTGCAG1110
IleGlnIleHisValSerAlaSerThrProProHisLeuSerValGln
315320325
CCCACCGGCCTTACCTTCTACCCTGCCGTGGATGTCCAGGCCTTTGCC1158
ProThrGlyLeuThrPheTyrProAlaValAspValGlnAlaPheAla
330335340345
GTCCTCCCCAACTCCTCCCTGGCTTCCCTCTTCCTGATTGGCATGCAC1206
ValLeuProAsnSerSerLeuAlaSerLeuPheLeuIleGlyMetHis
350355360
ACAACTGGTTCCATGGAGGTCAGCGCCGAGTCCAACAGGCTTGTTGGA1254
ThrThrGlySerMetGluValSerAlaGluSerAsnArgLeuValGly
365370375
GAGCTCAAGCTGGATAGGCTGCTCCTGGAACTGAAGCACTCAAATATT1302
GluLeuLysLeuAspArgLeuLeuLeuGluLeuLysHisSerAsnIle
380385390
GGCCCCTTCCCGGTTGAATTGCTGCAGGATATCATGAACTACATTGTA1350
GlyProPheProValGluLeuLeuGlnAspIleMetAsnTyrIleVal
395400405
CCCATTCTTGTGCTGCCCAGGGTTAACGAGAAACTACAGAAAGGCTTC1398
ProIleLeuValLeuProArgValAsnGluLysLeuGlnLysGlyPhe
410415420425
CCTCTCCCGACGCCGGCCAGAGTCCAGCTCTACAACGTAGTGCTTCAG1446
ProLeuProThrProAlaArgValGlnLeuTyrAsnValValLeuGln
430435440
CCTCACCAGAACTTCCTGCTGTTCGGTGCAGACGTTGTCTATAAA1491
ProHisGlnAsnPheLeuLeuPheGlyAlaAspValValTyrLys
445450455
TGAAGGCACCAGGGGTGCCGGGGGCTGTCAGCCGCACCTGTTCCTGATGGGCTGTGGGGC1551
ACCGGCTGCCTTTCCCCAGGGAATCCTCTCCAGATCTTAACCAAGAGCCCCTTGCAAACT1611
TCTTCGACTCAGATTCAGAAATGATCTAAACACGAGGAAACATTATTCATTGGAAAAGTG1671
CATGGTGTGTATTTTAGGGATTATGAGCTTCTTTCAAGGGCTAAGGCTGCAGAGATATTT1731
CCTCCAGGAATCGTGTTTCAATTGTAACCAAGAAATTTCCATTTGTGCTTCATGAAAAAA1791
AACTTCTGGTTTTTTTCATGTG1813
(2) INFORMATION FOR SEQ ID NO:2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 487 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: protein
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:
MetArgGluAsnMetAlaArgGlyProCysAsnAlaProArgTrpVal
31-30-25-20
SerLeuMetValLeuValAlaIleGlyThrAlaValThrAlaAlaVal
15-10-51
AsnProGlyValValValArgIleSerGlnLysGlyLeuAspTyrAla
51015
SerGlnGlnGlyThrAlaAlaLeuGlnLysGluLeuLysArgIleLys
202530
IleProAspTyrSerAspSerPheLysIleLysHisLeuGlyLysGly
354045
HisTyrSerPheTyrSerMetAspIleArgGluPheGlnLeuProSer
50556065
SerGlnIleSerMetValProAsnValGlyLeuLysPheSerIleSer
707580
AsnAlaAsnIleLysIleSerGlyLysTrpLysAlaGlnLysArgPhe
859095
LeuLysMetSerGlyAsnPheAspLeuSerIleGluGlyMetSerIle
100105110
SerAlaAspLeuLysLeuGlySerAsnProThrSerGlyLysProThr
115120125
IleThrCysSerSerCysSerSerHisIleAsnSerValHisValHis
130135140145
IleSerLysSerLysValGlyTrpLeuIleGlnLeuPheHisLysLys
150155160
IleGluSerAlaLeuArgAsnLysMetAsnSerGlnValCysGluLys
165170175
ValThrAsnSerValSerSerLysLeuGlnProTyrPheGlnThrLeu
180185190
ProValMetThrLysIleAspSerValAlaGlyIleAsnTyrGlyLeu
195200205
ValAlaProProAlaThrThrAlaGluThrLeuAspValGlnMetLys
210215220225
GlyGluPheTyrSerGluAsnHisHisAsnProProProPheAlaPro
230235240
ProValMetGluPheProAlaAlaHisAspArgMetValTyrLeuGly
245250255
LeuSerAspTyrPhePheAsnThrAlaGlyLeuValTyrGlnGluAla
260265270
GlyValLeuLysMetThrLeuArgAspAspMetIleProLysGluSer
275280285
LysPheArgLeuThrThrLysPhePheGlyThrPheLeuProGluVal
290295300305
AlaLysLysPheProAsnMetLysIleGlnIleHisValSerAlaSer
310315320
ThrProProHisLeuSerValGlnProThrGlyLeuThrPheTyrPro
325330335
AlaValAspValGlnAlaPheAlaValLeuProAsnSerSerLeuAla
340345350
SerLeuPheLeuIleGlyMetHisThrThrGlySerMetGluValSer
355360365
AlaGluSerAsnArgLeuValGlyGluLeuLysLeuAspArgLeuLeu
370375380385
LeuGluLeuLysHisSerAsnIleGlyProPheProValGluLeuLeu
390395400
GlnAspIleMetAsnTyrIleValProIleLeuValLeuProArgVal
405410415
AsnGluLysLeuGlnLysGlyPheProLeuProThrProAlaArgVal
420425430
GlnLeuTyrAsnValValLeuGlnProHisGlnAsnPheLeuLeuPhe
435440445
GlyAlaAspValValTyrLys
450455
__________________________________________________________________________

Scannon, Patrick J., Wedel, Nancy

Patent Priority Assignee Title
6013631, Jun 19 1998 XOMA CORPORATION, A DELAWARE CORPORATION Bactericidal/permeability-increasing protein (BPI) deletion analogs
6087126, Jun 19 1998 XOMA Corporation Bactericidal/permeability-increasing protein (BPI) deletion analogs
6093573, Jun 20 1997 XOMA TECHNOLOGY LTD ; Regents of the University of California, The Three-dimensional structure of bactericidal/permeability-increasing protein (BPI)
6162237, Apr 19 1999 Temporary intravascular stent for use in retrohepatic IVC or hepatic vein injury
6344197, Oct 22 1998 Eli Lilly and Company Methods for treating sepsis
6482796, Nov 01 1996 XOMA Corporation Therapeutic uses of N-terminal BPI protein products in ANCA-positive patients
6528255, Dec 30 1997 Genencor International, Inc. Proteases from gram positive organisms
6599880, Jun 19 1998 XOMA Corporation Bactericidal/permeability-increasing protein (BPI) deletion analogs
7101862, Dec 31 2001 LIGHTY, CRAIG E Hemostatic compositions and methods for controlling bleeding
7291451, Dec 01 2000 Xoma Technology Ltd. Modulation of pericyte proliferation
Patent Priority Assignee Title
5089274, Feb 14 1989 INCYTE PHARMACEUTICALS, INC Use of bactericidal/permeability increasing protein or biologically active analogs thereof to treat endotoxin-related disorders
5171739, Feb 14 1989 INCYTE PHARMACEUTICALS, INC Treatment of endotoxin-associated shock and preventation thereof using a BPI protein
5198541, Aug 11 1987 New York University DNA encoding bactericidal/permeability-increasing proteins
5234912, Feb 14 1989 INCYTE PHARMACEUTICALS, INC Pharmaceutical compositions comprising recombinant BPI proteins and a lipid carrier and uses thereof
5245013, Apr 30 1985 SCRIPPS RESEARCH INSTITUTE, THE, A CORP OF CA Acute phase protein modulating endotoxic activity of lipopolysaccharides, assay methods and polypeptides
5308834, Feb 14 1989 Incyte Pharmaceuticals, Inc. Treatment of endotoxin-associated shock and prevention thereof using a BPI protein
5334584, Feb 14 1989 Incyte Pharamaceuticals, Inc. Recombinant, non-glycosylated bpi protein and uses thereof
5348942, Mar 12 1993 XOMA CORPORATION A CORPORATION OF DELAWARE Therapeutic uses of bactericidal/permeability increasing protein products
5420019, Feb 02 1993 XOMA Corporation Stable bactericidal/permeability-increasing protein muteins
5439807, May 19 1992 XOMA Corporation Methods for the preparation of endotoxin-binding proteins
5447913, Mar 11 1994 XOMA CORPORATION A CORP OF DELAWARE Therapeutic uses of bactericidal/permeability-increasing protein dimer products
5466580, Sep 22 1993 XOMA CORPORATION A CORPORATION OF DELAWARE Method for quantifying BPI in body fluids
5466581, Sep 22 1993 XOMA CORPORATION A DELAWARE CORPORATION Method for quantifying BPI in body fluids
5484705, Jan 24 1994 XOMA CORPORATION, A DE CORP Method for quantifying lipopolysaccharide binding protein
5488034, Feb 02 1993 XOMA Corporation Pharmaceutical composition comprising BPI proteins
5494896, Mar 31 1995 XOMA CORPORATION, A DE CORP Method of treating conditions associated with burn injuries
5523288, Sep 22 1993 XOMA CORPORATION, A DE CORP Method of treating gram-negative bacterial infection by administration of bactericidal/permeability-increasing (BPI) protein product and antibiotic
5532216, Jun 24 1994 INCYTE PHARMACEUTICALS, INC Neutralization of non-lipopolysaccharide compounds by bactericidal/permeability-increasing protein
5576292, Aug 11 1987 New York University Biologically active bactericidal/permeability-increasing protein fragments
5578568, Apr 22 1994 XOMA CORPORATION, A CORP OF DE Method of treating conditions associated with intestinal ischemia/reperfusion
5578572, Jan 14 1994 XOMA CORPORATION, A DELAWARE CORPORATION Anti-gram-positive bacterial methods and materials
WO8901486,
WO9009183,
WO9101639,
WO9203535,
WO9209621,
WO9305797,
WO9306228,
WO9323434,
WO9323540,
WO9417819,
WO9418323,
WO9420128,
WO9420129,
WO9420532,
WO9421280,
WO9425476,
WO9500641,
WO9501428,
WO9502414,
WO9508344,
WO9508773,
WO9510297,
WO9519179,
WO9519180,
WO9519372,
WO9519784,
WO9520163,
WO9524209,
WO9601647,
WO9608509,
WO9621436,
/
Executed onAssignorAssigneeConveyanceFrameReelDoc
Sep 10 1997XOMA Corporation(assignment on the face of the patent)
Date Maintenance Fee Events
Sep 28 2001M183: Payment of Maintenance Fee, 4th Year, Large Entity.
Nov 08 2001LSM1: Pat Hldr no Longer Claims Small Ent Stat as Indiv Inventor.
Nov 08 2001R283: Refund - Payment of Maintenance Fee, 4th Yr, Small Entity.
Aug 05 2003LTOS: Pat Holder Claims Small Entity Status.
Nov 14 2005M2552: Payment of Maintenance Fee, 8th Yr, Small Entity.
Dec 28 2009REM: Maintenance Fee Reminder Mailed.
May 26 2010EXP: Patent Expired for Failure to Pay Maintenance Fees.


Date Maintenance Schedule
May 26 20014 years fee payment window open
Nov 26 20016 months grace period start (w surcharge)
May 26 2002patent expiry (for year 4)
May 26 20042 years to revive unintentionally abandoned end. (for year 4)
May 26 20058 years fee payment window open
Nov 26 20056 months grace period start (w surcharge)
May 26 2006patent expiry (for year 8)
May 26 20082 years to revive unintentionally abandoned end. (for year 8)
May 26 200912 years fee payment window open
Nov 26 20096 months grace period start (w surcharge)
May 26 2010patent expiry (for year 12)
May 26 20122 years to revive unintentionally abandoned end. (for year 12)