An altered antibody is produced by replacing the complementarity determining regions (CDRs) of a variable region of an immunoglobulin (Ig) with the CDRs from an Ig of different specificity, using recombinant DNA techniques. The gene coding sequence for producing the altered antibody may be produced by site-directed mutagenesis using long oligonucleotides or using gene synthesis.
|
22. An antibody comprising a human kappa light chain variable domain having a set of four framework regions (FRs) of a human antibody and three complementarity determining regions (CDRs) comprising residues from a non-human antibody, wherein said antibody binds the same antigen as the non-human antibody.
1. An antibody comprising a human kappa light chain variable domain, wherein said light chain variable domain comprises a set of tour human kabat framework regions (FRs), wherein each of said FRs in said set of four FRs comprises residues identical to the most common residue in each position in a kabat alignment of a human kappa sub-group 1, and wherein said antibody binds an antigen.
3. An antibody comprising a human kappa light chain variable domain, said light chain variable domain comprising a set of four human kabat framework regions (FRs), wherein said antibody incorporates FRs comprising residues identical to the most common residue in each position in a kabat alignment of a human kappa sub-group 1, wherein said antibody has three kabat complementarity determining regions (CDRs) comprising amino acid residues from a non-human antibody, and wherein said antibody binds the same antigen as the non-human antibody.
2. An antibody comprising a human kappa light chain variable domain, said light chain variable domain comprising a set of four human kabat framework regions (FRs), wherein said antibody incorporates FRs comprising residues identical to the most common residue in each position in a kabat alignment of a human kappa sub-group 1, and wherein said antibody has three kabat complementarity determining regions (CDRs) comprising sequences of amino acid residues, wherein said sequences are not human, and wherein said antibody binds the same antigen as a non-human antibody having a kappa light chain comprising said sequences.
4. The antibody of
5. The antibody of
6. The antibody of
9. The antibody of
10. The antibody of
11. The antibody of
12. The antibody of
13. The antibody of
14. The antibody of
16. The antibody according to
17. The antibody according to
21. The antibody according to
|
|||||||||||||||||||||||||||||||||||
This is a continuation of application No. 08/452,462 filed on May 26, 1995, now U.S. Pat. No. 6,548,640, which is a continuation of application Ser. No. 07/942,340 filed Sep. 9, 1992, now abandoned, which is a continuation of application Ser. No. 07/624,515 filed Dec. 7, 1990, now abandoned, which is a continuation of application Ser. No. 07/189,814 filed May 3, 1988, now abandoned, which are incorporated by reference herein in their entireties.
1. Field of the Invention
The present invention relates to altered antibodies in which at least part of the complementarity determining regions (CDRs) in the light or heavy chain variable domains of the antibody have been replaced by analogous parts of CDRs from an antibody of different specificity. The present invention also relates to methods for the production of such altered antibodies. The term “altered antibody” is used herein to mean an antibody in which at least one residue of the amino acid sequence has been varied as compared with the sequence of a naturally occuring antibody.
2. Descripton of the Prior Art
Natural antibodies, or immunoglobulins, comprise two heavy chains linked together by disulphide bonds and two light chains, each light chain being linked to a respective heavy chain by disulphide bonds. The general structure of an antibody of class IgG (ie an immunoglobulin (Ig) of class gamma (G)) is shown schematically in
Each heavy chain has at one end a variable domain followed by a number of constant domains. Each light chain has a variable domain at one end and a constant domain at its other end, the light chain variable domain being aligned with the variable domain of the heavy chain and the light chain constant domain being aligned with the first constant domain of the heavy chain. The constant domains in the light and heavy chains are not involved directly in binding the antibody to the antigen.
Each pair of light and heavy chains variable domains forms an antigen binding site. The variable domains of the light and heavy chains have the same general structure and each domain comprises four framework regions, whose sequences are relatively conserved, connected by three hypervariable or complementarity determining regions (CDRs) (see Kabat, E. A., Wu, T. T., Bilofsky, H., Reid-Miller, M. and Perry, H., in “Sequences of Proteins of Immunological Interest”, U.S. Dept. Health and Human Services, 1983 and 1987). The four framework regions largely adopt a beta-sheet conformation and the CDRs form loops connecting, and in some cases forming part of, the beta-sheet structure. The CDRs are held in close proximity by the framework regions and, with the CDRs from the other variable domain, contribute to the formation of the antigen binding site.
For a more detailed account of the structure of variable domains, reference may be made to: Poljak, R. J., Amzel, L. M., Avey, H. P., Chen, B. L., Phizackerly, R. P. and Saul, F., PNAS USA, 70, 3305–3310, 1973; Segal, D. M., Padlan. E. A., Cohen, G. H., Rudikoff, S., Potter, M. and Davies, D. R., PNAS USA, 71, 4298–4302, 1974; and Marquart, M., Deisenhofer, J., Huber, R. and Palm, W., J. Mol. Biol., 141, 369–391, 1980.
In recent years advances in molecular biology based on recombinant DNA techniques have provided processes for the production of a wide range of heterologous polypeptides by transformation of host cells with heterologous DNA sequences which code for the production of the desired products.
EP-A-0 088 994 (Schering Corporation) proposes the construction of recombinant DNA vectors comprising a ds DNA sequence which codes for a variable domain of a light or a heavy chain of an Ig specific for a predetermined ligand. The ds DNA sequence is provided with initiation and termination codons at its 5′- and 3′-termini respectively, but lacks any nucleotides coding for amino acids superfluous to the variable domain. The ds DNA sequence is used to transform bacterial cells. The application does not contemplate variations in the sequence of the variable domain.
EP-A-1 102 634 (Takeda Chemical Industries Limited) describes the cloning and expression in bacterial host organisms of genes coding for the whole or a part of human IgE heavy chain polypeptide, but does not contemplate variations in the sequence of the polypeptide.
EP-A-0 125 023 (Genentech Inc.) proposes the use of recombinant DNA techniques in bacterial cells to produce Igs which are analogous to those normally found in vertebrate systems and to take advantage of the gene modification techniques proposed therein to construct chimeric Igs, having amino acid sequence portions homologous to sequences from different Ig sources, or other modified forms of Ig.
The proposals set out in the above Genentech application did not lead to secretion of chimeric Igs, but these were produced as inclusion bodies and were assembled in vitro with a low yield of recovery of antigen binding activity.
The production of monoclonal antibodies was first disclosed by Kohler and Milstein (Kohler, G. and Milstein, C., Nature, 256, 495–497, 1975). Such monoclonal antibodies have found widespread use not only as diagnostic reagents (see, for example, ‘Immunology for the 80s’, Eds. Voller, A., Bartlett, A., and Bidwell, D., MTP Press, Lancaster, 1981) but also in therapy (see, for example, Ritz, J. and Schlossman, S. F., Blood, 59, 1–11, 1982).
The recent emergence of techniques allowing the stable introduction of Ig gene DNA into myeloma cells (see, for example, Oi, V. T., Morrison, S. L., Herzenberg, L. A. and Berg, P., PNAS USA, 80, 825–829, 1983; Neuberger, M. S., EMBO J., 2, 1373–1378, 1983; and Ochi, T., Hawley, R. G., Hawley, T., Schulman, M. J., Traunecker, A., Kohler, G. and Hozumi, N., PNAS USA, 80, 6351–6355, 1983), has opened up the possibility of using in vitro mutagenesis and DNA transfection to construct recombinant Igs possessing novel properties.
However, it is known that the function of an Ig molecule is dependent on its three dimensional structure, which in turn is dependent on its primary amino acid sequence. Thus, changing the amino acid sequence of an Ig may adversely affect its activity. Moreover, a change in the DNA sequence coding for the Ig may affect the ability of the cell containing the DNA sequence to express, secrete or assemble the Ig.
It is therefore not at all clear that it will be possible to produce functional altered antibodies by recombinant DNA techniques.
However, colleagues of the present Inventor have devised a process whereby chimeric antibodies in which both parts of the protein are functional can be secreted. The process, which is disclosed in International Patent Application No. PCT/GB85/00392 (WO86/01533) (Neuberger et al. and Celltech Limited), comprises:
a) preparing a replicable expression vector including a suitable promoter operably linked to a DNA sequence comprising a first part which encodes at least the variable domain of the heavy or light chain of an Ig molecule and a second part which encodes at least part of a second protein;
b) if necessary, preparing a replicable expression vector including a suitable promoter operably linked to a DNA sequence which encodes at least the variable domain of a complementary light or heavy chain respectively of an Ig molecule;
c) transforming an immortalised mammalian cell line with the or both prepared vectors; and
d) culturing said transformed cell line to produce a chimeric antibody.
The second part of the DNA sequence may encode:
i) at least part, for instance the constant domain of a heavy chain, of an Ig molecule of different species, class or subclass;
ii) at least the active portion or all of an enzyme;
iii) a protein having a known binding specificity;
iv) a protein expressed by a known gene but whose sequence, function or antigenicity is not known; or
v) a protein toxin, such a ricin.
The above Neuberger application only shows the production of chimeric antibodies in which complete variable domains are coded for by the first part of the DNA sequence. It does not show any chimeric antibodies in which the sequence of the variable domain has been altered.
EP-A-0 173 494 (The Board of Trustees of the Leland Stanford Junior University) also concerns the production of chimeric antibodies having variable domains from one mammalian source and constant domains from another mammalian source. However, there is no disclosure or suggestion of production of a chimeric antibody in which the sequence of a variable domain has been altered: indeed, hitherto variable domains have been regarded as indivisible units.
The present invention, in a first aspect, provides an altered antibody in which at least part of a CDR in a light or heavy chain variable domain has been replaced by analogous part(s) of a CDR from an antibody of different specificity.
The determination as to what constitutes a CDR and what constitutes a framework region is made on the basis of the amino-acid sequences of a number of Igs. However, from the three dimensional structure of a number of Igs it is apparent that the antigen binding site of an Ig variable domain comprises three looped regions supported on sheet-like structures. The loop regions do not correspond exactly to the CDRs, although in general there is considerable overlap.
Moreover, not all of the amino-acid residues in the loop regions are solvent accessible and in at least one case it is known that an amino-acid residue in the framework region is involved in antigen binding. (Amit, A. G., Mariuzza, R. A., Phillips, S. E. V. and Poljak, R. J., Science, 233, 747–753, 1986).
It is also known that the variable regions of the two parts of an antigen binding site are held in the correct orientation by inter-chain non-covalent interactions. These may involve amino-acid residues within the CDRs.
Further, the three dimensional structure of CDRs, and therefore the ability to bid antigen, depends on the interaction with the framework regions: thus in some cases transplanting CDRs to a different framework might destroy antigen binding.
In order to transfer the antigen binding capacity of one variable domain to another, it may not be necessary in all cases to replace all of the CDRs with the complete CDRs from the donor variable region. It may, eg, be necessary to transfer only those residues which are accessible from the antigen binding site. In addition, in some cases it may also be necessary to alter one or more residues in the framework regions to retain antigen binding capacity: this is found to be the case with reshaped antibody to Campath 1, which is discussed below.
It may also be necessary to ensure that residues essential for inter-chain interactions are preserved in the acceptor variable domain.
Within a domain, the packing together and orientation of the two disulphide bonded beta-sheets (and therefore the ends of the CDR loops) are relatively conserved. However, small shifts in packing and orientation of these beta-sheets do occur (Lesk, A. M. and Chothia, C., J. Mol. Biol., 160, 325–342, 1982). However, the packing together and orientation of heavy and light chain variable domains is relatively conserved (Chothia, C., Novotny, J., Bruccoleri, R. and Karplus, M., J. Mol. Biol., 186, 651–653, 1985). These points will need to be borne in mind when constructing a new antigen binding site so as to ensure that packing and orientation are not altered to the deteriment of antigen binding capacity.
It is thus clear that merely by replacing at least part of one or more CDRs with complementary CDRs may not always result in a functional altered antibody. However, given the explanations set out above, it will be well within the competence of the man skilled in the art, either by carrying out routine experimentation or by trial and error testing to obtain a functional altered antibody.
Preferably, the variable domains in both the heavy and light chains have been altered by at least partial CDR replacement and, if necessary, by partial framework region replacement and sequence changing. Although the CDRs may be derived from an antibody of the same species class or even subclass as the antibody from which the framework regions are derived, it is envisaged that the CDRs will generally preferably be derived from an antibody of different species and/or from an antibody of different class or subclass.
Thus, it is envisaged, for instance, that the CDRs from a mouse antibody could be grafted onto the framework regions of a human antibody. This arrangement will be of particular use in the therapeutic use of monoclonal antibodies.
At present, if a mouse monoclonal antibody is injected into a human, the human body's immune system recognises the antibody as foreign and produces an immune response thereto. Thus, on subsequent injections of the mouse antibody into the human, its effectiveness is considerably reduced by the action of the body's immune system against the foreign antibody. In the altered antibody of the present invention, only the CDRs of the antibody will be foreign to the body, and this should minimise side effects if used for human therapy. Although, for example, human and mouse framework regions have characteristic sequences, to a first approximation there seem to be no characteristic features which distinguish human from mouse CDRs. Thus, an antibody comprised of mouse CDRs in a human framework may well be no more foreign to the body than a genuine human antibody.
Even with the altered antibodies of the present invention, there is likely to be an anti-idiotypic response by the recipient of the altered antibody. This response is directed to the antibody binding region of the altered antibody. It is believed that at least some anti-idiotype antibodies are directed at sites bridging the CDRs and the framework regions. It would therefore be possible to provide a panel of antibodies having the same partial or complete CDR replacements but on a series of different framework regions. Thus, once a first altered antibody became therapeutically ineffective, due to an anti-idiotype response, a second altered antibody from the series could be used, and so on, to overcome the effect of the anti-idiotype response. Thus, the useful life of the antigen-binding capacity of the altered antibodies could be extended.
Preferably, the altered antibody has the structure of a natural antibody or a fragment thereof. Thus, the altered antibody may comprise a complete antibody, an (Fab′)2 fragment, an Fab fragment, a light chain dimer or an Fv fragment. Alternatively, the altered antibody may be a chimeric antibody of the type described in the Neuberger application referred to above. The production of such an altered chimeric antibody can be carried out using the methods described below used in conjunction with the methods described in the Neuberger application.
The present invention, in a second aspect, comprises a method for producing an altered antibody comprising:
a) preparing a first replicable expression vector including a suitable promoter operably linked to a DNA sequence which encodes at least a variable domain of an Ig framework regions consisting at least parts of framework regions from a first antibody and CDRs comprising at least part of the CDRs from a second antibody of different specificity;
b) if necessary, preparing a second replicable expression vector including a suitable promoter operably linked to a DNA sequence which encodes at least the variable domain of a complementary Ig light or heavy chain respectively;
c) transforming a cell line with the first or both prepared vectors; and
d) culturing said transformed cell line to produce said altered antibody.
Preferably, the cell line which is transformed to produce the altered antibody is an immortalised mammalian cell line, which is advantageously of lymphoid origin, such as a myeloma, hybridoma, trioma or quadroma cell line. The cell line may also comrpise a normal lymphoid cell, such as a B-cell, which has been immortalised by transformation with a virus, such as the Epstein-Barr virus. Most preferably, the immortalised cell line is a myeloma cell line or a derivative thereof.
Although the cell line used to produce the altered antibody is preferably a mammalian cell line, any other suitable cell line, such as a bacterial cell line or a yeast cell line, may alternatively be used. In particular, it is envisaged that E. Coli derived bacterial strains could be used.
It is known that some immortalised lymphoid cell lines, such as myeloma cell lines, in their normal state secrete isolated Ig light or heavy chains. If such a cell line is transformed with the vector prepared in step a) of the process of the invention, it will not be necessary to carry out step b) of the process, provided that the normally secreted chain is complementary to the variable domain of the Ig chain encoded by the vector prepared in step a).
In general the immortalised cell line will not secrete a complementary chain, and it will be necessary to carry out step b). This step may be carried out by further manipulating the vector produced in step a) so that this vector encodes not only the variable domain of an altered antibody light or heavy chain, but also the complementary variable domain.
Alternatively, step b) is carried out by preparing a second vector which is used to transform the immortalised cell line.
The techniques by which such vectors can be produced and used to transform the immortalised cell lines are well known in the art, and do not form any part of the invention.
In the case where the immortalised cell line secretes a complementary light or heavy chain, the transformed cell line may be produced for example by transforming a suitable bacterial cell with the vector and then fusing the bacterial cell with the immortalised cell line by spheroplast fusion. Alternatively, the DNA may be directly introduced into the immortalised cell line by electroporation. The DNA sequence encoding the altered variable domain may be prepared by oligonucleotide synthesis. This requires that at least the framework region sequence of the acceptor antibody and at least the CDRs sequences of the donor antibody are known or can be readily determined. Although determining these sequences, the synthesis of the DNA from oligonucleotides and the preparation of suitable vectors is to some extent laborious, it involves the use of known techniques which can readily be carried out by a person skilled in the art in light of the teaching given here.
If it was desired to repeat this strategy to insert a different antigen binding site, it would only require the synthesis of oligonucleotides encoding the CDRs, as the framework oligonucleotides can be re-used.
A convenient variant of this technique would involve making a symthetic gene lacking the CDRs in which the four framework regions are fused together with suitable restriction sites at the junctions. Double stranded synthetic CDR cassettes with sticky ends could then be ligated at the junctions of the framework regions. A protocol for achieving this variant is shown diagrammatically in
Alternatively, the DNA sequence encoding the altered variable domain may be prepared by primer directed oligonucleotide site-directed mutagenesis. This technique in essence involves hybridising an oligonucleotide coding for a desired mutation with a single strand of DNA containing the region to be mutated and using the signle strand as a template for extension of the oligonucleotide to produce a strand containing the mutation. This technique, in various forms, is described by: Zoller, M. J. and Smith, M., Nuc. Acids Res., 10, 6487–6500, 1982; Norris, K., Norris, F., Christainsen, L. and Fiil, N., Nuc. Acids Res., 11, 5103–5112, 1983; Zoller, M. J. and Smith, M., DNA, 3, 479–488 (1984); Kramer, W., Schughart, K. and Fritz, W.-J., Nuc. Acids Res., 10, 6475–6485, 1982.
For various reasons, this technique in its simplest form does not always produce a high frequency of mutation. An improved technique for introducing both single and multiple mutations in an M13 based vector, has been described by Carter et al. (Carter, P., Bedouelle H. and Winter, G., Nuc. Acids Res., 13, 4431–4443, 1985).
Using a long oligonucleotide, it has proved possible to introduce many changes simultaneously (as in Carter et al., loc. cit.) and thus single oligonucleotides, each encoding a CDR, can be used to introduce the three CDRs from a second antibody into the framework regions of a first antibody. Not only is this technique less laborious than total gene synthesis, but is represents a particularly convenient way of expressing a variable domain of required specificity, as it can be simpler than tailoring an entire VH domain for insertion into an expression plasmid.
The oligonucleotides used for site-directed mutagenesis may be prepared by oligonucleotide synthesis or may be isolated from DNA coding for the variable domain of the second antibody by use of suitable restriction enzymes. Such long oligonucleotides will generally be at least 30 bases long and may be up to or over 80 bases in length.
The techniques set out above may also be used, where necessary, to produce the vector of part (b) of the process.
The method of the present invention is envisaged as being of particular use in reshaping human monoclonal antibodies by introducing CDRs of desired specificity. Thus, for instance, a mouse monoclonal antibody against a particular human cancer cell may be produced by techniques well known in the art. The CDRs from the mouse monoclonal antibody may then be partially or totally grated into the framework regions of a human monoclonal antibody, which is then produced in quantity by a suitable cell line. The product is thus a specifically targetted, essentially human antibody which will recognise the cancer cells, but will not itself be recognised to any significant degree, by a human's immune system, until the anti-idiotype response eventually becomes apparent. Thus, the method and product of the present invention will be of particular use in the clinical environment.
The present invention is now described, by way of example only, with reference to the accompanying drawings.
In the drawings:
This example shows the production of an altered antibody in which the variable domain of the heavy chains comprises the framework regions of a human heavy chain and the CDRs from a mouse heavy chain.
The framework regions were derived from the human myeloma heavy chain NEWM, the crystallographic structure of which is known (see Poljak et al., loc. cit. and Bruggemann, M., Radbruch, A., and Rajewsky, K., EMBO J., 1, 629–634, 1982.)
The CDRs were derived from the mouse monoclonal antibody B1-0.8 (see Reth et al., loc. cit.), which binds the hapten NP-cap (4-hydroxy-3-nitrophenyl acetyl-caproic acid: KNP-CAP =1.2 uM).
A gene encoding a variable domain HuVNP, comprising the B1-8 CDRs and the NEWM framework regions, was constructed by gene synthesis as follows.
The amino acid sequence of the VH domain of NEWM is shown in
The amino acid and nucleotide sequence of the HuVNP gene, in which the CDRs from the B1-8 antibody alternate with the framework regions of the NEWM antibody, is shown in
The oligonucleotides from which the HuVNP fragment was assembled are aligned below the corresponding portion of the HuVNP gene. For convenience in cloning, the ends of oligonucleotides 25 and 26b form a Hind II site followed by a Hind III site, and the sequences of the 25/26b oligonucleotides therefore differ from the HuVNP gene.
The HuVNP synthetic fragment was built as a PstI-Hind III fragment. The nucleotide sequence was derived from the protein sequence using the computer programme ANALYSEQ (Staden, R., Nuc. Acids. Res., 12, 521–538, 1984) with optimal codon usage taken from the sequences of mouse constant domain genes. The oligonucleotides (1 to 26b, 28 in total) vary in size from 14 to 59 residues and were made on a Biosearch SAM or an Applied Biosystems machine, and purified on 8M-urea polyacrylamide gels (see Sanger, F. and Coulson, A., FEBS Lett., 107–110, 1978).
The oligonucleotides were assembled in eight single stranded blocks (A–D) containing oligonucleotides
[1,3,5,7] (Block A), [2,4,6,8] (block A′), [9,11,13a,13b] (Block B), [10a, 10b,12/14] (block B′), [15,17] (block C), [16,18] (block C′), [19, 21, 23, 25] (block D) and [20, 22/24, 26a, 26b] (block D′).
In a typical assembly, for example of block A, 50 pmole of oligonucleotides 1,3,5 and 7 were phosphorylated at the 5′ end with T4 polynucleotide kinase and mixed together with 5 pmole of the terminal oligonucleotide [1] which had been phosphorylated with 5 uCi [gamma-32-P] ATP (Amersham 3000 Ci/mmole). These oligonucleotides were annealed by heating to 80° C. and cooling over 30 minutes to room temperature, with unkinased oligonucleotides 2, 4 and 6 as splints, in 150 ul of 50 mM Tris.Cl, ph 7.5, 10 mM MgCl2. For the ligation, ATP (1 mM) and DTT (10 mM) were added with 50 U T4 DNA ligase (Anglian Biotechnology Ltd.) and incubated for 30 minutes at room temperature. EDTA was added to 10 mM, the sample was extracted with phenol, precipitated from ethanol, dissolved in 20 ul water and boiled for 1 minute with an equal volume of formamide dyes. The sample was loaded onto and-run on a 0.3 mm 8M-urea 10% polyacrylamide gel. A band of the expected size was detected by autoradiography and eluted by soaking.
Two full length single strands were assembled from blocks A to D and A′ to D′ using splint oligonucleotides. Thus blocks A to D were annealed and ligated in 30 ul as set out in the previous paragraph using 100 pmole of olignucleotides 10a, 16 and 20 as splints. Blocks A′ to D′ were ligated using oligonucleotides 7, 13b and 17 as splints.
After phenol/ether extraction, block A-D was annealed with block A′-D′, small amounts were cloned in the vector M13mp18 (Yanish-Perron, C., Vieria, J. and Messing, J., Gene, 33, 103–119, 1985) cut with PstI and Hind III, and the gene sequenced by the dideoxy technique (Sanger, F., Nicklen, S. and Coulson, A. R., PNAS USA, 74, 5463–5467, 1977).
The MoVNP gene was transferred as a Hind III-BamHI fragment from the vector pSV-VNP (Neuberger et al., loc. cit.) to the vector M13mp8 (Messing, J. and Vieria, J., Gene, 19, 269–276, 1982). To facilitate the replacement of MoVNP coding sequences by the synthetic HuVNP fragment, three Hind II sites were removed from the 5′ non-coding sequence by site directed mutagenesis, and a new Hind II site was subsequently introduced near the end of the fourth framework region (FR4 in
The Hind III-Bam HI fragment, now carrying the HuVNP gene, was excised from M13 and cloned back into pSV-VNP to replace the MoVNP gene and produce a vector pSV-HuVNP. Finally, the genes for the heavy chain constant domains of human Ig E (Flanagan, J. G. and Rabbitts, T. H., EMBO J., 1, 655–660, 1982) were introduced as a Bam HI fragment to give the vector pSV-HuVNP.HE. This was transfected into the mouse myeloma line J558 L by spheroplast fusion.
The sequence of the HuVNP gene in pSV-HuVNP.HE was checked by recloning the Hind III-Bam HI fragment back into M13mp8 (Messing et al., loc. cit.). J558L myeloma cells secrete lambda 1 light chains which have been shown to associate with heavy chains containing the MoVNP variable domain to create a binding site for NP-cap or the related hapten NIP-Cap (3-iodo-4-hydroxy-5-nitrophenylacetyl-caproic acid) (Reth, M., Hammerling, G. J. and Rajewsky, K., Eur. J. Immunol., 8, 393–400, 1978).
As the plasmid pSV-HuVNP.HE contains the gpt marker, stably transfected myeloma cells could be selected in medium containing mycophenolic acid. Transfectants secreted an antibody (HuvNP-IgE) with heavy chains comprising a HuVNP variable domain (ie a “humanised” mouse variable region) and human epsilon constant domains, and lambda 1 light chains from the J558L myeloma cells.
The culture supernatants of several gpt+ clones were assayed by radioimmunoassay and found to contain NIP-cap binding antibody. The antibody secreted by one such clone was purified from culture supernatant by affinity chromatography on NIP-cap Sepharose (Sepharose is a registered trade mark). A polyacrylamide-SDS gel indicated that the protein was indistinguishable from the chimeric antibody MoVNP-IgE (Neuberger et al., loc. cit.).
The HuVNP-IgE antibody competes effectively with the MoVNP-IgE for binding to both anti-human-IgE and to NIP-cap coupled to bovine serum albumin.
Various concentrations of HuVNP-IgE and MoVNP-IgE were used to compete with the binding of radiolabelled MoVNP-IgE to polyvinyl microtitre plates coated with (a) Sheep anti-human-IgE antiserum (Seward Laboratories); (b) NIP-cap-bovine serum albumin; (c) Ac38 anti-idiotypic antibody; (d) Ac 146 anti-idiotypic antibody; and (e) rabbit anti-MoVNP antiserum. Binding was also carried out in the presence of MoVNP-IgM antibody (Neuberger, M. S., Williams, G. T. and Fox, R. O., Nature, 312, 604–608, 1984) or of JW5/1/2 which is an IgM antibody differing from the MoVNP-IgM antibody at 13 residues mainly located in the VH CDR2 region.
The results of the binding assays are shown in
The affinities of HuVNP-IgE for NP-cap and NIP-cap were then measured directly using the fluorescence quench technique and compared to those for MoVNP-IgE, using excitation at 295 nm and observing emission at 340 nm (Eisen, H. N., Methods Med. Res., 10, 115–121, 1964).
Antibody solutions were diluted to 100 nM in phosphate buffered saline, filtered (0.45 um pore cellulose acetate) and titrated with NP-cap in the range 0.2 to 20 uM. As a control, mouse DI-3 antibody (Mariuzza, R. A., Jankovic, D. L., Bulot, G., Amit, A. G., Saludjian, P., Le Guern, A., Mazie, J. C. and Poljak, R. J., J. Mol. Biol., 170, 1055–1058, 1983), which does not bind hapten, was titrated in parallel.
Decrease in the ratio of the fluorescence of HuVNP-IgE or HuvNP-IgE to the fluorescence of the D1-3 antibody was taken to be proportional to NP-cap occupancy of the antigen binding sites. The maximum quench was about 40% for both antibodies, and hapten dissociation constants were determined from least-squares fits of triplicate data sets to a hyperbola.
For NIP-cap, hapten concentration varied from 10 to 300 nM, and about 50% quenching of fluorescence was observed at saturation. Since the antibody concentrations were comparable to the value of the dissociation constants, data were fitted by least squares to an equation describing tight binding inhibition (Segal, I. H., in “Enzyme Kinetics”, 73–74, Wiley, New York, 1975).
The binding constants obtained from these data for these antibodies are shown in Table 1 below.
TABLE 1
KNP-cap
KNIP-cap
MoVNP-IgE
1.2 uM
0.02 uM
HuVNP-IgE
1.9 uM
0.07 uM
These results show that the affinities of these antibodies are similar and that the change in affinity is less than would be expected for the loss of a hydrogen bond or a van der Waals contact point at the active site of an enzyme.
Thus, it has been shown that it is possible to produce an antibody specific for an artificial small hapten, comprising a variable domain having human framework regions and mouse CDRs, without any significant loss of antigen binding capacity.
As shown in
It can thus be seen that, although the HuVNP-IgE antibody has acquired substantially all the antigen binding capacity of the mouse CDRs, it has not acquired any substantial proportion of the mouse antibody's antigenicity.
The results of
For instance, the oligonucleotides encoding the CDRs may be used again, but with a set of oligonucleotides encoding a different set of framework regions.
The above work has shown that antigen binding characteristics can be transferred from one framework to another without loss of activity, so long as the original antibody is specific for a small hapten.
It is known that small haptens generally fit into an antigen binding cleft. However, this may not be true for natural antigens, for instance antigens comprising an epitopic site on a protein or polysaccharide. For such antigens, the antibody may lack a cleft (it may only have a shallow concavity), and surface amino acid residues may play a significant role in antigen binding. It is therefore not readily apparent that the work on artificial antigens shows conclusively that CDR replacement could be used to transfer natural antigen binding properties.
Therefore work was carried out to see if CDR replacement could be used for this purpose. This work also involved using primer-directed, oligonucleotide site-directed mutagenesis using three synthetic oligonculeotides coding for each of the mouse CDRs and the flanking parts of framwork regions to produce a variable domain gene similar to the HuVNP gene.
The three dimensional structure of a complex of lysozyme and the antilysozyme antibody D1.3 (Amit et al., loc. cit.) was solved by X-ray crystallography. There is a large surface of interaction between the antibody and antigen. The antibody has two heavy chains of the mouse IgG1 class (H) and two Kappa light chains (K), and is denoted below as H2K2.
The DNA sequence of the heavy chain variable region was determined by making cDNA from the mRNA of the D1.3 hybridoma cells, and cloning into plasmid and M13 vectors. The sequence is shown in
Three synthetic oligonucleotides were then designed to introduce the D1.3 VHCDRs in place of the VHCDRs of the HUVNP gene. The HuNP gene has been cloned into M13mp8 as a BamHI-Hind III fragment, as described above. Each oligonucleotide has 12 nucleotides at the 5′ end and 12 nucleotides at the 3′ end which are complementary to the appropriate HuVNP framework regions. The central portion of each oligonucleotide encodes either CDR1, CDR3, or CDR3 of the D1.3 antibody, as shown in
10 pmole of D1.3 CDR1 primer phosphorylated at the 5′ end and annealed to lug of the M13-HuVNP template and extended with the Klenow fragment of DNA polymerase in the presence of T4 DNA ligase. After an oligonucleotide extension at 15° C., the sample was used to transfect E. Coli strain BHM71/18 mutL and plaques gridded and grown up as infected colonies.
After transfer to nitrocellulose filters, the colonies were probed at room temperature with 10 pmole of D1.3 CDR1 primer labelled at the 5′ end with 30 uCi 32P-ATP. After a 3″ wash at 60° C., autoradiography revealed about 20% of the colonies had hybrdidised well to the probe. All these techniques are fully described in “Oligonucleotide site-directed mutagenesis in M13” an experimental manual by P. Carter, H. Bedouelle, M. M. Y. Waye and G. Winter 1985 and published by Anglian Biotechnology Limited, Hawkins Road, Colchester, Essex CO2 8JX. Several clones were sequenced, and the replacement of HuVNP CDR1 by D 1.3 CDR1 was confirmed. This M13 template was used in a second round of mutagenesis with D1.3 CDR2 primer; finally template with both CDRs 1&2 replaced was used in a third round of mutagenesis with D1.3 CDR3 primer. In this case, three rounds of mutganesis were used.
The variable domain containing the D1.3 CDRs was then attached to sequences encoding the heavy chain constant regions of human IgG2 so as to produce a vector encoding a heavy chain Hu*. The vector was transfected into J558L cells as above. The antibody Hu*2L2 is secreted.
For comparative purposes, the variable region gene for the D1.3 antibody was inserted into a suitable vector and attached to a gene encoding the constant regions of mouse IgG1 to produce a gene encoding a heavy chain H* with the same sequence as H. The protocol for achieving this is shown in
As shown in
The vector (vector A) is then cut with NcoI, blunted with Klenow polymerase and cut with PstI. The PStI-NcoI fragment is purified and cloned into PstI-HindII cut MVNP to replace most of the MVNP coding sequences. The MVNP vector comprises the mouse variable domain gene with its promoter, 5′ leader, and 5′ and 3′ introns cloned into M13mp9. This product is shown as vector B in
Using site directed mutagenesis on the single stranded template of vector B with two primers, the sequence encoding the N-terminal portion of the CH1 domain and the PstI site near the N-terminus of the V domain are removed. Thus the V domain of D1.3 now replaces that of VNP to produce vector C of
Vector C is then cut with HindIII and BamHI and the fragment formed thereby is inserted into HindIII/BamHI cut M13mp9. The product is cut with Hind III and SacI and the fragment is inserted into PSV-VNP cut with Hind III/SacI so as to replace the VNP variable domain with the D1.3 variable domain. Mouse IgG1 constant domains are cloned into the vector as a SacI fragment to produce vector D of
Vector D of
Separated K or L light chains can be produced by treating an appropriate antibody (for instance D1.3 antibody to produce K light chains) with 2-mercaptoethanol in guanidine hydrochloride, blocking the free interchain sulphydryls with iodoacetamide and separating the dissociated heavy and light chains by HPLC in guanidine hydrochloride.
Different heavy and light chains can be reassociated to produce functional antibodies by mixing the separated heavy and light chains, and dialysing into a non-denaturing buffer to promote re-association and refolding. Properly reassociated and folded antibody molecules can be purified on protein A-sepharose columns. Using appropriate combinations of the above procedures, the following antibodies were prepared.
H2K2
(D1.3 antibody)
H*2L2
(D1.3 heavy chain, lambda light chain)
H*2K2
(recombinant equivalent of D1.3)
Hu*2L2
(“humanised” D1.3 heavy chain, lambda
light chain)
Hu*2K2
(“humanised” D1.3)
The antibodies containing the lambda light chains were not tested for antigen binding capacity. The other antibodies were, and the results are shown in Table 2.
TABLE 2
Dissociation constant
Antibody
for lysozyme (nM)
D1.3 (H2K2)
14.4
D1.3 (H2K2)
15.9, 11.4
(reassociated)
recombinant D1.3 (H*2K2)
9.2
(reassociated)
“humanised” D1.3 (Hu*2K2)
3.5, 3.7
(reassociated)
The affinity of the antibodies for lysozyme was determined by fluroresecent quenching, with excitation at 290 nm and emission observed at 340 nm. Antibody solutions were diluted to 15–30 ug/mg in phosphate buffered saline, filtered (0.45 um-cellulose acetate) and titrated with hen eggwhite lysozyme. There is quenching of fluoresence on adding the lysozyme to the antibody (greater than 100% quench) and data were fitted by least squares to an equation describing tight binding inhibition (I. H. Segal in Enzyme Kinetics, p 73–74, Wiley, New York 1975). This data suggests that the binding of the “humanised” antibody to lysozyme is tighter than in the original D1.3 antibody. Subsequent results suggest that the affinities of the “humanised” and mouse antibodies are both less than 5 nM with 2 mol of lysozyme molecules binding 1 mol of antibody: see Verhoeyen, M., Milstein, C. and Winter, G., Science, 239, 1534–1536 (1988). Although the work described in Verhoeyen et al. suggests that the reshaped antibody may have a weaker affinity for lysozyme than the original mouse antibody it is clear that the “humanised” antibody binds lysozyme effectively and with a comparable affinity to D1.3. (within a factor of 10).
Further work on fully “humanised” antibody to lysozyme is discussed below, in Example 4.
Further work has been carried out with an antibody to the antigen Campath-1, which is potentially of great therapeutic use, in which both light and heavy chain variable domains were reshaped. In this case, transfer of the CDRs only resulted in production of a reshaped antibody which bound poorly to the antigen as compared with the original antibody. A single mutation in the framework produced greatly enhanced binding affinity.
The Campath-1 antigen is strongly expressed on virtually all human lymphocytes and monocytes, but is absent from other blood cells including the hemopoietic stem cells (Hale, G., Bright, S., Chumbley, G., Hoang, T., Metcalf, D., Munro, A. J. & Waldmann, H. Blood 62, 873–882 (1983)). A series of antibodies to Campath-1 have been produced, including rat monoclonal antibodies of IgM, IgG2a, and IgG2c isotypes (Hale, G., Hoang, T., Prospero, T., Watts, S. M. '& Waldmann, H. Mol. Biol. Med. 1, 305–319 (1983)) and more recently IgG1 and IgG2b isotypes have been isolated as class switch variants from the IgG2a secreting cell line YTH 34.5HL (Hale, G., Cobbold, S. P., Waldmann, H., Easter, G., Matejtschuk, P. '& Coombs, R. R. A. J. Immunol. Meth. 103, 59–67 (1987)). All of these antibodies with the exception of the rat IgG2c isotype are able to lyse efficiently human lymphocytes with human complement.
In addition, the IgG2b antibody YTH 34.5HL-G2b, but not the other isotypes, is effective in antibody dependent cell mediated cytotoxicity (ADCC) with human effector cells (Hale et al, 1987, loc. cit.). These rat monoclonal antibodies have found important application in the context of immunosuppression, for control of graft-versus-host disease in bone marrow transplantation (Hale et al, 1983, loc. cit.); the management of organ rejection (Hale, G., Waldmann, H., Friend, P. '& Calne, R. Transportation 42, 308–311 (1986)); the prevention of marrow rejection and in the treatment of various lymphoid malignancies (Hale, G., Swirsky, D. M., Hayhoe, F. G. J. & Waldmann, H. Mol. Biol. Med. 1, 321–334 (1983)). For in-vivo use, the IgG2b antibody YTH 34.5HL-G2b seems to be the most effective at depleting lymphocytes, but the use of any of the antibodies in this group is limited by the antiglobulin response which can occur within two weeks of the initiation of treatment (Hale, Swirsky et al, 1983, loc. cit.).
The sequences of the heavy and light chain variable domains of rat IgG2a Campath-1 antibody YTH 34.5HL were determined by cloning the cDNA (
In the heavy chain variable domain there is an unusual feature in the framework region. In most known heavy chain sequences Pro(41) and Leu(45) are highly conserved: Pro(41) helps turn a loop distant from the antigen binding site and Leu(45) is in the beta bulge which forms part of the conserved packing between heavy and light chain variable domains (Chothia, C., Novotny, J., Bruccoleri, R. '& Karplus, M. J. Mol. Biol. 186, 651–663 (1985)). In YTH 34.5HL these residues are replaced by Ala(41) and Pro(45), and presumably this could have some effect on the packing of the heavy and light chain variable domains.
Working at the level of the gene and using three large mutagenic oligonucleotides for each variable domain, in a single step the hypervariable regions of YTH 34.5HL were mounted on human heavy or light chain framework regions taken from the crystallographically solved proteins NEW for the heavy chain (Saul, F. A., Amzel, M. '& Poljak, R. J. J. Biol. Chem. 253, 585–597 (1978)) and from a protein based closely on the human myeloma protein REI for the light chain (Epp, O., Colman, P., Fehlhammer, H., Bode, W., Schiffer, M. '& Huber, R. Eur. J. Biochem. 45, 513–524 (1974)). The NEW light chain was not used because there is a deletion at the beginning of the third framework region of the NEW light chain. The resulting reshaped heavy chain variable domain HuVHCAMP is based on the HuVHNP gene (Kabat et al, loc. cit. and Jones, P. T., Dear, P. H., Foote, J., Neuberger, M. S. '& Winter, G. Nature 321, 522–525 (1986)) with the framework regions of human NEW alternating with the hypervariable regions of rat YTH 34.5HL. The reshaped light chain variable domain HuVLCAMP is a similar construct, except with essentially the framework regions of the human myeloma protein REI, with the C-terminal and the 3′ non-coding sequence taken from a human Jk-region sequence (Hieter, P. A., Max, E. E., Seidmann, J. G., Maizel, J. V. Jr '& Leder, P. Cell 22, 197–207 (1980)). Sequence information for the variable domain of the reshaped antibody is given in the upper lines in
Considering the above in further detail, mRNA was purified (Kaartinen, M., Griffiths, G. M., Hamlyn, P. H., Markham, A. F., Karjalainen, K., Pelkonen J. L. T., Makela, O. '& Milstein, C. J. Immunol. 130, 320–324 (1983)) from the hybridoma clone YTH 34.5HL (gamma 2a, kb), and first strand cDNA made by priming with oligonucleotides complementary to the 5′ end of the CH1 (oligonucleotide I) and the Ck exons (oligonucleotide II). cDNA was cloned and sequenced as described in Gubler, U. '& Hoffman, B. J. Gene 25, 263–269 (1983) and Sanger, F., Nicklen, S. A. '& Coulson, A. R. Proc. natl. Acad. Sci USA 74, 5463–5467 (1977).
For expression of the rat heavy chain variable domain RaVHCAMP, two restriction sites (XbaI and SalI) were introduced at each end of the cDNA clone in M13 using mutagenic oligonucleotides III and V respectively, and the XbaI-SalI fragment excised. Simultaneously, the corresponding sites were introduced into the M13-HuVHNP gene using oligonucleotides IV and VI, and the region between the sites exchanged. The sequence at the junctions was corrected with oligonucleotides VII and VIII, and an internal BamHI site removed using the oligonucleotide IX, to create the M13-RaVHCAMP gene. The encoded sequence of the mature domain is thus identical to that of YTH 34.5HL.
The reshaped heavy chain variable domain (HuVHCAMP) was constructed in an M13 vector by priming with three long oligonucleotides simultaneously on the single strand containing the M13-HuVHNP gene (see Kabat et al, loc. cit and Jones et al, loc. cit).). The mutagenesis techniques used were similar to those described in Carter et al loc. cit, using the host 71-18 mutL and without imposing strand selection. Each oligonucleotide (X, XI and XII) was designed to replace each of the hypervariable regions with the corresponding region from the heavy chain of the YTH 34.5HL antibody.
Colony blots were probed initially with the oligonucleotide X and hybridisation positives were sequenced: the overall yield of the triple mutant was 5%. Ser27 to Phe and Ser27 to Phe, Ser30 to Thr mutants (to be described below) of M13mpB-HuVHCAMP were made with the mixed oligonucleotide XIII.
The reshaped light chain variable domain (HuVLCAMP) was constructed in an M13 vector from a gene with framework regions based on human REI. As above, three long oligonucleotides (XIV, XV, and XVI) were used to introduce the hypervariable regions of the YTH 34.5HL light chain.
Construction of the humanised light chain variable domain is described in greater detail in the following seven paragraphs.
(1) The “humanised” light chain variable domain (HuVLCAMP) was constructed in three stages, utilising a “humanised” light chain variable domain (HuVLLYS) which had been constructed for other purposes.
(a) The first stage involved the gene synthesis of a “humanised” light chain variable domain gene (HuVLLYS°). The HuVLLYS° gene incorporates human framework regions identical to the most common residue in each position in the Kabat alignment of the human kappa subgroup I, except for residues 97–108, which were identical to those in the human J1 fragment described in Heiter, P., Maizel, J '& Leder, P. J. Biol. Chem. 257, 1516–1522 (1982). The sequences of the framework regions are very similar to the crystallographically solved light chain structure REI. The CDRs in HuVLLYS° were identical to those in the mouse antilysozyme antibody (D1.3) light chain (unpublished). A 30 bp sequence, identical to the sequence following the genomic JI segment, was introduced to the 3′ side of residue 108. BamH1 and EcoRI restriction sites were introduced at the 3′ end of the synthetic gene, and a PstI site at th 5′ end. The gene synthesis of HuVLLYS° is described in paragraphs (2) to (5) below, and the sequence of the gene and the derived amino acid sequence is given in
(b) The second stage involved the introduction of the HuVLLYS° gene in place of the heavy chain variable domain in the vector M13-MOVHNP and this is described in paragraphs 6 and 7 below. Thus the light chain variable domain utilises the promoter and signal sequence of a heavy chain variable domain: at the 3′ end of the gene the sequence is derived from the human light chain J1 segment as described in paragraph (1a). The sequence of the HuVLLYS gene and the derived amino acid sequence is given in
(c) The third stage involved the conversion of HuVLLYS to a “humanised” light chain variable domain with the CDRs of Campath-1 specifity.
2. For the synthesis of the HuVLLYS° gene, three blocks of oligonucleotides (PK1-5, KK1-5 and KE1-8 in the table in paragraph 3 below were cloned separately into M13 vectors, and sequenced. Each cloned block was excised and ligated together into M13mp19 to create the HuVLLYS° gene.
3. Oligonucleotides listed below were produced on an Applied Biosystems 380B synthesizer. Each oligonucleotide was size-purified, 10 nmol being subjected to electrophoresis on a 20×40 cm 12% polyacrylamide, 7M urea gel, eluted from the gel by dialysis against water, and lyophilized. For gene synthesis or mutagenesis, a 50 pmol aliquot of each purified oligonucleotide was phosphorylated in a 20 ul reaction mixture with 50 mM Tris-Cl (pH 8.0), 10 mM MgCl2, 5 mM dithiothreitol, 1 mM ATP, and 5 units of polynucleotide kinase, incubated at 37° for 30 minutes. When used as hybridization probes, gel-purified oligonucleotides were phosphorylated in a similar fashion, except on a 15 pmol scale with an excess of 32P labeled ATP.
SEQ ID
name
sequence (5′-3′)
NO.
PK1
GACATCCAGATGACCCAGAGCCCAAGCAGCCTGAGCG
1
CCAGCGTGGGT
PK2
GACAGAGTGACCATCACCTGTAGAGCCAGCGGTAACA
2
TCCACAACTACCTGGCTTGGTAC
PK3
CAAGCCAGGTAGTTGTGGATGTTACCGCTGGCTCTACA
3
GGTGAT
PK4
GGTCACTCTGTCACCCACGCTGGCGCTCAGGCT
4
PK5
GCTTGGGCTCTGGGTCATCTGGATGTCTGCA
5
KK1
CAGCAGAAGCCAGGTAAGGCTCCAAAGCTGCTGATCT
6
ACTACACCACCA
KK2
CCCTGGCTGACGGTGTGCCAAGCAGATTCAGCGGTAGC
7
GGTAGCGGTAC
KK3
CGCTACCGCTACCGCTGAATCTGCT
8
KK4
TGGCACACCGTCAGCCAGGGTGGTGGTGTAGTAGATC
9
AGC
KK5
AGCTTTGGAGCCTTACCTGGCTTCTGCTGGTAC
10
KE1
CGACTTCACCTTCACCATCAGCAGCCTCCAGCCAGAGG
11
ACATCGCCACCTACTACTGCC
KE2
AGCACTTCTGGAGCACCCCAAGGACGTTCGGCCAAGG
12
GACCAAGGTGGA
KE3
AATCAAACGTGAGTAGAATTTAAACTTTGCTTCCTCAG
13
TTGGATCCTAG
KE4
AATTCTAGGATCCAACTGAGGAAGCAAAGTTTAAA
14
KE5
TTCTACTCACGTTTGATTTCCACCTTGGTCCCTT
15
KE6
GGCCGAACGTCCTTGGGGTGCTCCAGAAGTGCTGGCA
16
GTAGTAG
KE7
GTGGCGATGTCCTCTGGCTGGAGGCT
17
KE8
GCTGATGGTGAAGGTGAAGTCGGTAC
18
PK0
TCATCTGGATGTCGGAGTGGACACCT
19
4. The construction of individual blocks is described for the PK1-5 block, but KK1-5 and KE1-8 blocks were cloned as KpnI-KpnI and KpnI-EcoRI fragments respectively in a similar way. 4 ul portions of each oligonucleotide PK1, PK2, PK3, PK4 and PK5, kinased as in paragraph 3, were combined and annealed at 80° C. for 5 minutes, 67° C. for 30 minutes, and allowed to cool to room temperature over the span of 30 minutes, 0.1 ul of this annealing mix was ligated with 20 ng of PstI/KpnI digested M13-mp19, in 10 ul 50 mM Tris-Cl (pH7.5), 10 mM MgCl2, 10 mM dithiothreitol, 1 mM ATP, 120 units T4 DNA ligase (Biolabs), and incubated 12 hours at 15° C. The ligation mix was used to transfect competent E. coli strain BMH 71-18, plated with BCIG and IPTG, and a clone containing the complete PstI-KpnI insert was identified.
5. The three cloned blocks were excised from 10 ug double-stranded replicative form of the thee M13 vectors, by digestion with PstI/KpnI (block PK1-5), KpnI (block KKI-5) and KpnI/EcoRI (block KE1-8). The inserts were separated from the vector by electrophoresis on a 20×20 cm 12% polyacrylamide gel, eluted from the gel slices with 0.5 M NH4OAc, 10 mM Mg (OAc)2, 0.1 mM EDTA, 0.1% SDS, and purified by phenol extraction and ethanol precipitation. All three fragments were ligated to PstI/EcoRI cut M13-mp19. 200 white plaques were transferred by toothpick to a fresh 2xTY plate, and grown as a grid of infected colonies. The plate was blotted with nitrocellulose filters, which were then treated with 0.5 M NaOH, followed by 1M Tris-Cl (pH7.5), and baked 1 hr at 80° C. under vacuum. The filters were washed at 67° C. in 3× Denhardt's solution, 2×SSC, 0.07% SDS, followed by 6×SSC at room temperature. Filters were then probed with the radiolabeled oligonucleotides KK3 or KK4 in 3 ml of 6×SSC at 37°. Following hybridization with both olignucleotides, positive colonies were picked for DNA sequencing. A phage clone containing correctly assembled blocks was designated M13-HuVLLYS°.
6. To introduce the-HuVLLYS° gene in place of the heavy chain variable domain in the vector M13-MOVHNP (described in Jones et al, loc. cit) as MVNP with HindII site at the 3′ end of the reading frame), double-stranded replicative form DNA of phages M13-HuVLLYS° and M13-MOVHNP were prepared and digested with PstI and BamHI. The insert of M13-HuVLLYS was isolated on a polyacrylamide gel, and the vector portion of M13-MOVHNP was isolated on an agarose gel. The purified fragments were ligated and transfected into E. coli strain BMH71-18, and the resulting plaques probed with oligonucleotide KK3 to identify the insert. The clone was designated M13-HuVLLYS*.
7. In the M13-HuVLLYS* gene, to join the signal sequence of MOVHNP correctly to the 5′ end of the HuVLLYS° gene (at the PstI site), single stranded DNA was prepared and altered by oligonucleotide directed mutagenesis with the primer PKO—see paragraph (3) for sequence. The mutant clone was designated M13-HuVLLYS.
As previously mentioned the Campath-1 light chain variable domain was derived from the HuVLLYS domain, and the reshaped human heavy (HuVHCAMP) and light (HuVLCAMP) chain variable domains were then assembled with constant domains in three stages as illustrated in
The illustrated procedure permits a step-wise check on the reshaping of the heavy chain variable domain (stage 1), the selection of the human isotype (stage 2), and the reshaping of the light chain variable domain and assembly of human antibody (stage 3). The vector constructions were genomic, with the variable domains excised from the M13 vectors and cloned as HindIII-BamHI fragments and the constant domains as BamHI-BamHI fragments in either pSVgpt (heavy chain) (Mulligan, R. C. '& Berg, P. Proc. natl. Acad. Sci USA 78, 2072–2076 (1981)) or pSVneo (light chain) (Southern, P. J. '& Berg, P. J. Mol. Appl. Genetics 1, 327–341 (1981)) vectors. The heavy chain enhancer was included to the 5′ side of the variable domain, and expression of both light and heavy chains was driven from heavy chain promoter and the heavy chain signal sequence.
The human gamma 1 (Takahashi, N., Ueda, N. S., Obata, M., Nikaido, T. & Honjo, T. Cell 29, 671–679 (1982)), gamma 2 (Flanagan, J. G. & Rabbits, T. H. Nature 300, 709–713 (1982)), gamma 3 (Huck, S., Fort, P., Crawford, D. H., Lefranc, M.-P. & Lefranc, G. Nucl. Acid Res. 14, 1779–1789 (1986), gamma 4 (Clark, M. & Waldmann, H. J.N.C.I. (in press) and K (Heiter et al, loc. cit) constant domains, and the rat gamma 2b (Bruggemann, M., Free, J., Diamond, A., Howard, J., Cobbold, S. & Waldmann, H. Proc. natl. Acad. Sci. USA 83, 6075–6079 (1986)) constant domains were introduced as BamHI-BamHI fragments. The following plasmids were constructed and transfected into lymphoid cell lines by electroporation (Potter, H., Weir, L. & Leder, P. Proc. natl. Acad. Sci. USA 81, 7161–7163 (1984)). In stage 1, the pSVgpt vectors HuVHCAMP-RaIgG2B, and also two mutants for reasons to be explained below, HuVHCAMP(Ser27 to Phe)-RaIgG2B, HuVHCAMP(Ser27 to Phe, Ser30 to Thr)-RaIgG2B) were introduced into the heavy chain loss variant of YTH34.5HL. In stage 2, the pSVgpt vectors RaVHCAMP-RaIgG2B, RaVHCAMP-HuIgG1, RaVHCAMP-HuIgG2, RaVHCAMP-HuIgG3, RaVHCAMP-HuIgG4 were transfected as described above. In stage 3, the pSV-gpt vector Hu(Ser27-Phe, Ser30-Thr)VHCAMP-HuIgG1 was cotransfected with the pSV-neo vector HuVLCAMP-HuIgK into the rat myeloma cell line Y0 (Y B2/3.0 Ag 20) (Galfre, G. & Milstein, C. Meth. Enzymol. 73, 1–46 (1981)). In each of the three stages, clones resistant to mycophenolic acid were selected and screened for antibody production by ELISA assays. Clones secreting antibody were subcloned by limiting dilution (for Y0) or the soft agar method (for the loss variant) and assayed again before 1 liter growth in roller bottles.
Heavy Chain Variable Domain
In stage 1, the reshaped heavy chain variable domain (HuVHCAMP) was attached to constant domains of the rat isotype IgG2b and transfected into a heavy chain loss variant of the YTH34.5 hybridoma. The loss variant carries two light chains, one derived from the Y3 fusion partner (Galfre et al., loc. cit). The cloned rat heavy chain variable domain (RaVHCAMP) was also expressed as above.
Antibodies were harvested at stationary phase and concentrated by precipitation with ammonium sulphate, followed by ion exchange chromatography on a Pharmacia MonoQ column. The yields of antibody were measured by an ELISA assay directed against the rat IgG2b isotype, and each adjusted to the same concentration (Clark and Waldmann loc. cit).
The HuVHCAMP and RaVHCAMP antibodies—all of the rat IgG2b isotype—were compared in a direct binding assay to the Campath-1 antigen (obtained from a glycolipid extract from human spleen), and also in complement lysis of human lymphocytes. For measuring the binding to antigen, the partially purified Campath-1 antigen was coated onto microtitre wells. Bound antibody was detected via a biotin labelled anti-rat IgG2b monoclonal antibody (Clark & Waldmann loc. cit), developed with a streptavidin-peroxidase conjugate (Amersham plc). Complement lysis of human lymphocytes with human serum as the complement source was as described in Hale, Hoang et al (1983) loc. cit. For both binding and complement assays, the titres for the antibodies were determined by fitting the data to a sigmoid curve by a least squares iterative procedure (Hale, Hoang et al (1983) loc. cit), and the concentration of antibody giving 50% maximal binding or lysis was noted.
The results are given in Table 3.
TABLE 3
Reshaping the heavy chain variable domain
Concentration of antibody
in ug/ml at
50% binding or lysis
heavy chain variable
antigen
complement
domain
binding
lysis
RaVHCAMP
0.7
2.1
HuVHCAMP
27.3
(*)
HuVHCAMP (Ser27 to Phe)
1.8
16.3
HuVHCAMP (Ser27 to Phe, Ser30 to Thr)
2.0
17.6
(*) Complement lysis with the HuVHCAMP variable domain was too weak for the estimation of lysis titre.
Compared with the original rat antibody, or the engineered equivalent, the antibody with the reshaped heavy chain domain HuVHCAMP bound poorly to the Campath-1 antigen and was weakly lytic. This suggested an error in the design of the reshaped domain.
There are several assumptions underlying the transfer of hypervariable loops from one antibody to another, and in particular that the antigen binds mainly to the hypervariable regions. These are defined as regions of sequence (Kabat et al, loc. cit) or structural (Chothia, C. & Lesk, A. J. Mol. Biol. 196, 901–917 (1987)) hypervariability, and the locations of hypervariable regions are similar by either criterion, except for the first hypervariable loop of the heavy chain. By sequence the first hypervariable loop extends from residues 31 to 35 (Kabat et al, loc. cit) and by structure from residues 26 to 32 (Chothia et al, (1987) loc. cit). Residues 29 and 30 form part of the surface loop, and residue 27 which is phenylalanine or tyrosine in most sequences including YTH34.5HL, helps pack against residues 32 and 34.
By way of illustration, see
The two mutants showed a significant increase in binding to CAMPATH-1 antigen and lysed human lymphocytes with human complement. See the results given in Table 3. Thus the affinity of the reshaped antibody could be restored by altering the packing between the hypervariable regions and the framework by a single Ser(27) to Phe mutation. This suggests that alterations in the “Kabat” framework region can enhance the affinity of the affinity of the antibody, and extends previous work in which an engineered change in the hypervariable region yielded an antibody with increased affinity (Roberts, S., Cheetham, J. C. & Rees, A. R. Nature 328, 731–734 (1987)).
Heavy Chain Constant Domains
In stage 2 (
Antibody was harvested from cells in stationary phase, concentrated by precipitation with ammonium sulphate and desalted into phosphate buffered saline (PBS). Antibodies bound to the Campath-1 antigen coated on microtitre plates, were assayed in ELISA directed against the rat k light chain (Clark & Waldmann loc cit), and adjusted to the same concentration. The antibodies were assayed in complement lysis (as described above) and ADCC with activated human peripheral blood mononuclear cells (Clark & Waldmann loc. cit and Hale, G. Clark, M. & Waldmann, H. J. Immunol. 134, 3056–3061 (1985)). Briefly, 5×104 human peripheral blood cells were labelled with 51Cr and incubated for 30 minutes at room temperature with different concentrations of antibody. Excess antibody was removed and a 20 fold excess of activated cells added as effectors. After 4 hours at 37° C. death was estimated by 51Cr release.
The results are shown in
IgG1
empty squares
IgG2
empty circles
IgG3
solid squares
IgG4
empty triangles
Results of lysis with the antibody YTH34.5HL are represented by solid circles.
In complement lysis (
The human IgG1 isotype was therefore suitable for a reshaped antibody for therapeutic use. Other recent work also suggests the IgG1 isotype as favoured for therapeutic application. When the effector functions of human isotypes were compared using a set of chimaeric antibodies with an anti-hapten variable domain, the IgG1 isotype appeared superior to the IgG3 in both complement and cell mediated lysis (Bruggemann, M., Williams, G. T., Bindon, C., Clark, M. R., Walker, M. R., Jefferis, R., Waldmann, H. & Neuberger, M. S. J. Exp. Med. (in press). Furthermore, of two mouse chimaeric antibodies directed against cell surface antigens as tumour cell markers, with human IgG1 or IgG3 isotypes, only the IgG1 isotype mediated complement lysis (Liu, A. Y., Robinson, R. R., Hellstrom, K. E., Murray, E. D. Jr., Cheng, C. P. & Hellstrom, I. Proc. natl. Acad. Sci. USA 84, 3439–3443 (1987) and Shaw, D. R., Khasaeli, M. B, Sun, L. K., Ghraeyeb, J., Daddona, P. E., McKinney, S. & Lopuglio, A. F. J, Immunol. 138, 4534–4538 (1987)).
Light Chain
In stage 3 (
Antibody HuVHCAMP (Ser27 to Phe, Thr30 to Ser)-HuIGG1, HuVLCAMP-HuIGK was purified from supernatants of cells in stationary phase by affinity chromatography on protein A Sepharose. The antibody was at least 95% (by wt) pure. The yield (about 10 mg/l) was measured spectrophotometrically. Complement and ADCC assays were performed as described in connection with
The results are shown in
The purified antibody proved almost identical to the YTH34.5HL-G2b antibody in complement lysis (
The rat antibody and fully humanised antibody were compared in a direct binding assay to Campath-1 antigen. Antibody concentrations were determined as described in
TABLE 4
Reshaping the heavy and light chain variable domains
simultaneously
Concentration of
antibody in ug/ml
at 50% binding
antigen
antibody
binding
RaVHCAMP Ra1GG2B
RaVHCAMP RaKappa
1.01
HuVHCAMP (Ser 27 to Phe, Ser30 to Thr) Hu1GG1
HuVLCAMP HuKappa
1.11
Thus by transplanting the hypervariable regions from a rodent to a human antibody of the IgG1 subtype, the antibody can be reshaped for therapeutic application.
The strategy illustrated in
Following the work described in Example 2, a fully “humanised” anti-lysozyme antibody with reshaped heavy and light chain variable domains was constructed.
The heavy chain variable region was constructed as described in Example 2 above, and the light chain variable region was constructed as described in Example 3 above.
Heavy and light chain constructs were prepared from 1 L of bacterial culture by CsCl density gradient ultracentrifugation. 20 ug of each plasmid was digested with Pvu1 and co-transfected into 107 NSO cells by electroporation. Transformants were selected by growth in medium containing mycophenolic acid, in a 24-well tissue culture plate. After two weeks growth, aliquots of cells were removed from each well, incubated overnight with 35S-methionine, an the supernatant medium affinity adsorbed with Protein A-Sepharose beads (Pharmacia). Absorbed proteins were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), followed by autoflurography. Clones were isolated by limiting dilution from the wells which had yielded both heavy and light chain bands on the autofluorogram. The radioincorporation screening method was again employed to identify those clones secreting a complete antibody. Of these, one cell line was chosen and propagated for storage and further analysis.
A 2L culture of the cell line was grown to saturation in Dulbecco's modifed Eagle medium supplemented with 10% fetal calf serum. Antibody was concetrated from the culture medium by ammonium sulfate precipitation. The precipitate was redissolved in phosphate-buffered saline, pH 7.4(PBS), dialyzed, and chromatographed on a column of lysozyme-Sepharose (prepared by reaction of 20 mg lysozyme per ml of CNBr-activated Sepharose CL-4B). The column was washed with 0.5 M NaCl, 0.1 M Tris chloride, pH 8.5, and subsequently with 50 mM Et2NH. Immunoglobulin-containing fractions eluting with the latter wash were identified by SDS-PAGE followed by Coomassie Blue staining; these were pooled and dialyzed against PBS. The dialyzed material was applied to a column of protein A-Sepharose. The column was washed with PBS, followed by 0.1 M citrate buffers in the order pH 6, 5, 4, 3. A peak eluting at pH 4 (the pH expected for elution of a human immunoglobulin of the gamma 2 isotype) was identified as homogeneous immunoglobulin by SDS-PAGE. This was dialyzed vs PBS for storage. Its concentration was determined spectrophotometrically using an extinction coefficient at 280 nm of 1.4 cm−1 (mg/ml)−1.
The fluorescence emission spectra of mouse and “humanised” antilysozyme in the presence of two equivalents of lysozyme show a loss of intensity and a hypsochromic shift relative to the calculated sum of the spectra of free antibody and free lysozyme. This quenching effect is indicative of an interaction between lysozyme and each antibody. Sets of spectra are shown in
The spectral change at fixed wavelength was measured as a function of lysozyme concentration. Antibody samples were titrated in the spectroflurimeter with small aliquots of a concentrated lysozyme solution, in parallel with a control antibody, which did not interact with lysozyme, at an identical concentration. The fluorescence was determined after each addition. Titration data are shown in
Reshaped Fv fragments of the anti-lysozyme antibody D1.3 (Verhoeyen et al, loc. cit) were constructed. The heavy chain variable region was reshaped by combining human framework (FR) sequences from the myeloma protein NEW (Saul F. A., Amzel, M., Poljak R. J., J. Biol. Chem. 253.585 (1978)) with the mouse D1.3 CDRs which provide the antigen specifically (Verhoeyen et al, loc. cit). The reshaped light chain contains human FRs from human kappa consensus sequence (Kabat et al, loc. cit) similar to the sequence of the Bence Jones protein REI (Epp, O., et al, Eur. J. Biochem. 45, 513 (1974)) combined with the D1.3 light chain CDRs.
The genes (HuVHLYS and HuVLLYS) for the VH and VL domains were produced as HindIII-BamHI fragments in M13 for the expression of the whole antibody (see M. Verhoeyen et al. Science loc. cit. for sequence of VH, see Riechmann, I., Clark, M., Waldmann, H., Winter, G., Nature in press for VL-framework sequences and see Verhoeyen, M., Berek, C., Winter, G., Nucleic Acid. Res. submitted for the VL CDRs). At the 3′end of their coding sequence two stops codons followed by a SacI-site were introduced by priming with oligonucleotides I and II on the corresponding single strands. Between the RNA start site and the translation start of the leader sequence in both genes a HindIII site was introduced using oligonucleotide III. The resulting HindIII-BamHI fragments were cloned into a pSVgpt vector (Riechmann et al, Nature loc cit). The vector contains a EcoR-HindIII fragment of an Ig-heavy chain enhancer (IgH enh) as a linker. The 3′ SacI-BamHI fragment of both genes was then exchanged with a SacI-BamHI fragment of the human kappa constant region (3′end Ck) (Hieter, P. A. et al. Cell 22, 197 (1980)) to provide a polyadenylation signal. Into the HindIII site of both vectors a HindIII-HindIII fragment of the HCMV immediate-early gene (Stenberg, R. M. et al. J. Virol 49, 190(1984), Boshart, M. et al., Cell 41, 521 (1985)) containing its enhancer, promotor and the first non-translated exon (HCMV enh-pro) were cloned. The complete VL-gene (containing Ig-enhancer, HCMV-promoter, VL-coding region and polyadenylation signal) was then subcloned as an EcoRI-fragment into pBGS18 (Spratt, B., et al., Gene 41, 337 (1986)) and the resulting vector pBGS-HuVLLYS was cloned into the pSVgpt-HuVHLYS vector as a BamHI fragment as shown in
The final plasmid pLRI further contained the resistance genes for the drugs ampicillin (ampR), kanamycin (kanR) and mycophenolic acid (Eco gpt) two col EI origins of replication (col EI on) and the SV40 enhancer (SV40 enh pro). The BamHI (B), HindIII (H), EcoRI (E) and SacI (S) restriction sites used for cloning steps are indicated. The diagram is not to scale. Oligonucleotides I=5′-GAG AGG TTG GAG CTC TTA TTA TGA GGA GAC-3′ (SEQ ID NO. 20), II=5′-AAG TTT AAA GAG CTC TAG TAT TTG ATT TC-3′ (SEQ ID NO. 21), III=5′-CTC AGT AAG CTT AGA GAG A-3′ (SEQ ID NO. 22).
Both heavy and light chain variable domains were combined in a single plasmid to facilitate the selection of transfectants using the gpt selection system (Mulligan, R. C., Berg. P., Proc. Natl. Acad. Sci. USA 78, 2072, 2076). Pools of transfected cell clones were analysed on SDS-acrylamide gels after 35S methionine incorporation and affinity purification of culture supernatants with lysozyme Sepharose. The cloned cell line used for the preparation of Fv-fragments secreted about 8 mg/L when grown in roller bottles. Thus it is possible to produce Fv fragments in myeloma cells with yields similar to recombinant versions of intact antibodies (Neuberger, M. S., Wiliams, G. T., Fox, R. O., Nature 312, 604 (1984), Riechmann, I. et al, Nature, loc. cit).
The Fv fragment contains two chains of about 12 KD (calculated values 12, 749 for VH and 11, 875 for VL) when analysed on SDS gels. See results in
When the purified Fv-fragment was investigated on an HPLC sizing column (Biozorbax GF250) in phosphate buffered saline, only a single peak was observed and its retention time did not change between concentrations of 70 and 0.3 mg/L.
The Fv-fragment was also analysed on native acrylamide (8%) gels. See results in
(The VL and VH-domains were separated on a Mono-S column (Pharmacia) in 50 mM acetic acid, 6 M urea (adjusted to pH 4.8 with NaOH) using 0 to 0.3 M NaCl gradient over 6 minutes. The VH was sufficiently pure according to SDS gel analysis. The VL was further purified after desalting into phosphate buffered saline on a Biozorbax GF250 (DuPont) sizing column to get rid of residual VH-VL heterodimer) These results strongly suggest that the predominant form of the Fv-fragment at pH 7.5 is an associated VH-VL heterodimer. Also its apparent molecular weight in ultracentrifuge sedimentation analysis was about 23.5 kD. The same was observed with Fv-fragments obtained by proteolytic digestion (Inbar, D., Hochmann, J., Givol, D., Proc. Natl. Acad. Sci USA 69, 2659 (1972), Kakimoto, K., Onoue, K., J.Immunol 112, 1373 (1974), Sharon, J., Givol, D., Biochemistry 15, 1591 (1976)).
The formation of VH-VL heterodimers was further established, when Fv fragments were incubated at a concentration of 0.5 mg/ml in phosphate buffered saline with 3.7% formaldehyde overnight. Crosslinked VH-VL heterodimers of about 25 kD were formed (Purified, biosynthetically 35S-methionine labelled VH domain was incubated in 3.7% formaldehyde/PBS overnight in the absence or presence of excessive unlabelled VH-VL heterodimer. When analysed on SDS gels crosslinked, labelled VH VL heterodimers (molecular weight of about 25 kD) are formed from isolated labelled VH only in the prescence of unlabelled Fv-fragment. No formation of dimers could be detected in the absence of unlabelled Fv-fragment). Lysozyme-Sepharose purification of the crosslinked material showed that the crosslinked VH-VL heterodimer is still active. Overloading of SDS gels with crosslinked material also made visible a small fraction (less than 5%) of slightly lower molecular weight material suggesting the formation of crosslinked VL homodimers. No higher molecular weight band for possible VH homodimers was observed.
Nevertheless dissociation was observed when the Fv-fragment was analysed on native acrylamide gels at pH4.5. Under these conditions the VH and the VL formed each a single band see results in
Although the Fv-fragment is predominantly associated at neutral pH, it is in a dynamic equilibrimun; the purified biosynthetically labelled VH domain exchanges with the unlabelled VH domain when incubated with an excess of unlabelled VH-VL heterodimer, because labelled VH-VL heterodimers can be trapped by crosslinking with formaldehyde.
However, the dissociation of Fv-fragments should not cause problems in diagnostic or therapeutic applications. For structural studies, for which high protein concentrations are used Fv-fragments will certainly be of considerable advantage without further treatment. They should especially simplify the assignment of signals in NMR-spectra, if the same beta-sheet frameworks are used for Fv-fragments with different specificities.
It will of course be understood that the present invention has been described above purely by way of example, and modifications of detail can be made within the scope of the invention as defined in the appended claims.
| Patent | Priority | Assignee | Title |
| 10010611, | Mar 13 2013 | Genentech, Inc. | Antibody formulations |
| 10035853, | Aug 28 2013 | AbbVie Stemcentrx LLC | Site-specific antibody conjugation methods and compositions |
| 10053511, | Nov 06 2013 | AbbVie Stemcentrx LLC | Anti-claudin antibodies and methods of use |
| 10059768, | Sep 12 2014 | Genentech, Inc. | Anti-B7-H4 antibodies and immunoconjugates |
| 10066002, | Nov 05 2014 | Genentech, Inc. | Methods of producing two chain proteins in bacteria |
| 10087255, | Apr 07 2015 | Alector LLC | Anti-sortilin antibodies and methods of use thereof |
| 10087259, | Apr 28 2014 | Memorial Sloan Kettering Cancer Center | Depleting tumor-specific tregs |
| 10100111, | Jun 25 2008 | Novartis AG | Stable and soluble antibodies inhibiting TNF alpha |
| 10100116, | Jun 26 2006 | MacroGenics, Inc. | FcγRIIB-specific antibodies and methods of use thereof |
| 10106600, | Mar 26 2010 | ROCHE GLYCART AG | Bispecific antibodies |
| 10106612, | Jun 27 2012 | Hoffmann-La Roche Inc. | Method for selection and production of tailor-made highly selective and multi-specific targeting entities containing at least two different binding entities and uses thereof |
| 10112994, | Nov 05 2014 | Genentech, Inc. | Methods of producing two chain proteins in bacteria |
| 10113001, | Mar 03 2003 | Xencor, Inc. | Fc variants with increased affinity for FcyRIIc |
| 10114023, | Apr 18 2012 | Albert Einstein College of Medicine | Method of enhancing the efficacy of anti-hepatocyte growth factor receptor breast cancer therapy by administering an inhibitor of menaINV |
| 10131713, | Apr 02 2008 | MacroGenics, Inc. | HER2/neu-specific antibodies and methods of using same |
| 10137204, | Feb 24 2012 | AbbVie Stemcentrx LLC | Anti-DLL3 antibody drug conjugates for treating cancer |
| 10138293, | Dec 21 2007 | Hoffmann-La Roche, Inc. | Bivalent, bispecific antibodies |
| 10150813, | Mar 14 2013 | Genentech, Inc. | Anti-B7-H4 antibodies and immunoconjugates |
| 10183996, | Feb 28 2014 | ALLAKOS INC | Methods and compositions for treating Siglec-8 associated diseases |
| 10183999, | Sep 27 2002 | Xencor, Inc. | Optimized Fc variants and methods for their generation |
| 10184000, | Sep 27 2002 | Xencor, Inc. | Optimized Fc variants and methods for their generation |
| 10196454, | May 01 2012 | Genentech, Inc. | Anti-PMEL17 antibodies and immunoconjugates |
| 10206911, | Oct 26 2012 | Memorial Sloan-Kettering Cancer Center | Androgen receptor variants and methods for making and using |
| 10227370, | Aug 02 2013 | California Institute of Technology | Heparan sulfate/heparin mimetics with anti-chemokine and anti-inflammatory activity |
| 10240207, | Mar 24 2014 | Genentech, Inc. | Cancer treatment with c-met antagonists and correlation of the latter with HGF expression |
| 10246515, | Sep 17 2013 | Genentech, Inc. | Methods of treating hedgehog-related diseases with an anti-LGR5 antibody |
| 10246519, | Oct 11 2013 | Genentech, Inc. | NSP4 inhibitors and methods of use |
| 10251952, | Jun 26 2014 | Hoffmann-La Roche Inc. | Humanized anti-tau(pS422) antibody brain shuttles and use thereof |
| 10308710, | Dec 20 2013 | Hoffmann-La Roche Inc. | Humanized anti-Tau(pS422) antibodies and methods of use |
| 10308718, | Apr 07 2016 | Alector LLC | Anti-sortilin antibodies and methods of use thereof |
| 10308721, | Feb 21 2014 | AbbVie Stemcentrx LLC | Anti-DLL3 antibodies and drug conjugates for use in melanoma |
| 10323099, | Oct 11 2013 | Hoffmann-La Roche Inc. | Multispecific domain exchanged common variable light chain antibodies |
| 10336818, | Oct 31 2007 | Xencor, Inc. | Fc variants with altered binding to FcRn |
| 10407511, | Jan 03 2014 | Hoffmann-La Roche Inc. | Covalently linked helicar-anti-helicar antibody conjugates and uses thereof |
| 10428150, | Apr 07 2015 | Alector LLC | Anti-sortilin antibodies and methods of use thereof |
| 10428156, | Sep 05 2014 | AbbVie Stemcentrx LLC | Anti-MFI2 antibodies and methods of use |
| 10443054, | Mar 06 2016 | Massachusetts Institute of Technology | Methods for identifying and treating invasive/metastatic breast cancers |
| 10465000, | Dec 20 2013 | Hoffmann-La Roche Inc. | Humanized anti-Tau(pS422) antibodies and methods of use |
| 10478509, | Feb 22 2013 | AbbVie Stemcentrx LLC; MEDIMMUNE LIMITED | Anti-DLL3 antibody drug conjugates for treating cancer |
| 10479831, | Apr 02 2008 | MacroGenics, Inc | BCR-complex-specific antibodies and methods of using same |
| 10501532, | Oct 07 2015 | OBI PHARMA, INC | Carbohydrate antibodies, pharmaceutical compositions and uses thereof |
| 10517945, | Jul 04 2012 | Hoffman-La Roche Inc. | Covalently linked antigen-antibody conjugates |
| 10519249, | Jan 03 2014 | Hoffmann-La Roche Inc. | Covalently linked polypeptide toxin-antibody conjugates |
| 10525137, | Dec 30 2015 | Genentech, Inc. | Formulations with reduced degradation of polysorbate |
| 10561737, | Jan 03 2014 | Hoffmann-La Roche Inc. | Bispecific anti-hapten/anti-blood brain barrier receptor antibodies, complexes thereof and their use as blood brain barrier shuttles |
| 10570198, | Oct 22 2010 | Novartis AG | Stable and soluble antibodies |
| 10584176, | Mar 03 2003 | Xencor, Inc. | Fc variants with increased affinity for FcγRIIc |
| 10590193, | Jun 25 2008 | Novartis AG | Stable and soluble antibodies inhibiting VEGF |
| 10590198, | Aug 28 2015 | Alector LLC | Anti-siglec-7 antibodies and methods of use thereof |
| 10604561, | Sep 16 2016 | Agency for Science, Technology and Research | Anti-dengue virus antibodies, polypeptides containing variant Fc regions, and methods of use |
| 10604577, | Oct 22 2015 | ALLAKOS INC | Methods and compositions for treating systemic mastocytosis |
| 10611825, | Feb 28 2011 | Hoffmann La-Roche Inc. | Monovalent antigen binding proteins |
| 10626176, | Oct 31 2014 | JOUNCE THERAPEUTICS, INC | Methods of treating conditions with antibodies that bind B7-H4 |
| 10626182, | Aug 14 2006 | Xencor, Inc. | Optimized antibodies that target CD19 |
| 10633457, | Dec 03 2014 | Hoffmann-La Roche Inc. | Multispecific antibodies |
| 10640555, | Jun 16 2009 | Hoffmann-La Roche Inc. | Bispecific antigen binding proteins |
| 10646567, | Aug 01 2011 | Genentech, Inc. | Methods of treating cancer using PD-1 axis binding antagonists and MEK inhibitors |
| 10653779, | Mar 13 2013 | Genentech, Inc | Formulations with reduced oxidation |
| 10660316, | Nov 04 2016 | AKEAGEN, INC. | Genetically modified non-human animals and methods for producing heavy chain-only antibodies |
| 10676525, | Aug 03 2017 | Alector LLC | Anti-TREM2 antibodies and methods of use thereof |
| 10683345, | Jul 13 2012 | Hoffmann-La Roche Inc | Bispecific anti-VEGF/anti-ANG-2 antibodies and their use in the treatment of ocular vascular diseases |
| 10683364, | Mar 04 2010 | MacroGenics, Inc. | Antibodies reactive with B7-H3, immunologically active fragments thereof and uses thereof |
| 10711062, | Aug 03 2017 | Alector LLC | Anti-CD33 antibodies and methods of use thereof |
| 10711069, | Dec 08 2006 | MacroGenics, Inc. | Methods for the treatment of disease using immunoglobulins having Fc regions with altered affinities for FcγRactivating and FcγRinhibiting |
| 10730945, | Mar 04 2010 | MacroGenics, Inc. | Antibodies reactive with B7-H3 and users thereof |
| 10730951, | Mar 31 2014 | Genentech, Inc. | Anti-OX40 antibodies and methods of use |
| 10767232, | Nov 03 2014 | Genentech, Inc. | Methods and biomarkers for predicting efficacy and evaluation of an OX40 agonist treatment |
| 10774145, | Jun 17 2015 | ALLAKOS INC | Methods and compositions for treating fibrotic diseases |
| 10793621, | Feb 28 2011 | Hoffmann-La Roche Inc. | Nucleic acid encoding dual Fc antigen binding proteins |
| 10800844, | Oct 29 2015 | Alector LLC | Anti-Siglec-9 antibodies and methods of use thereof |
| 10800846, | Feb 26 2015 | Pfizer Inc; Merck Patent GmbH | PD-1/PD-L1 inhibitors for the treatment of cancer |
| 10822402, | Jun 24 2015 | Hoffmann-La Roche Inc. | Humanized anti-tau(pS422) antibodies and methods of use |
| 10844113, | Sep 16 2016 | Chugai Seiyaku Kabushiki Kaisha; Agency for Science, Technology and Research | Anti-dengue virus antibodies, polypeptides containing variant Fc regions, and methods of use |
| 10845364, | Nov 03 2014 | Genentech, Inc. | Assays for detecting T cell immune subsets and methods of use thereof |
| 10865248, | Apr 07 2015 | Genentech, Inc. | Antigen binding complex having agonistic activity and methods of use |
| 10869924, | Jun 16 2015 | Merck Patent GmbH; Pfizer Inc. | PD-L1 antagonist combination treatments |
| 10870701, | Mar 15 2016 | ITABMED HK LIMITED | Multispecific fab fusion proteins and use thereof |
| 10875922, | Sep 27 2013 | Genentech, Inc. | Anti-PDL1 antibody formulations |
| 10925966, | Mar 13 2013 | Genentech, Inc. | Antibody formulations |
| 10927163, | Dec 21 2007 | Hoffmann-La Roche, Inc. | Bivalent, bispecific antibodies |
| 10928397, | Apr 18 2012 | Albert Einstein College of Medicine | Methods involving MenaINV in screening for inhibitors of cancer invasion and metastasis |
| 10933141, | Dec 30 2015 | Genentech, Inc. | Formulations with reduced degradation of polysorbate |
| 10941205, | Oct 02 2015 | Hoffmann-La Roche Inc. | Bispecific anti-human A-beta/human transferrin receptor antibodies and methods of use |
| 10946093, | Jul 15 2014 | Genentech, Inc. | Methods of treating cancer using PD-1 axis binding antagonists and MEK inhibitors |
| 10961311, | Apr 15 2016 | MacroGenics, Inc | B7-H3 binding molecules, antibody drug conjugates thereof and methods of use thereof |
| 10982003, | Aug 11 2009 | Genentech, Inc. | Production of proteins in glutamine-free cell culture media |
| 11013800, | May 16 2011 | ITABMED HK LIMITED | Multi-specific Fab fusion proteins comprising a CD3-binding Fab fragment with N-terminal fusion to binding domains and methods of use |
| 11028183, | Apr 02 2008 | MacroGenics, Inc. | HER2/neu-specific antibodies and methods of using same |
| 11033634, | Feb 24 2012 | AbbVie Stemcentrx LLC | Light chain variable regions |
| 11046776, | Aug 05 2016 | F HOFFMANN-LA ROCHE AG | Multivalent and multiepitopic antibodies having agonistic activity and methods of use |
| 11053308, | Aug 05 2016 | Jichi Medical University | Method for treating IL-8-related diseases |
| 11078298, | Oct 28 2016 | BANYAN BIOMARKERS, INC. | Antibodies to ubiquitin C-terminal hydrolase L1 (UCH-L1) and glial fibrillary acidic protein (GFAP) and related methods |
| 11084875, | Aug 08 2014 | Alector LLC | Anti-TREM2 antibodies and methods of use thereof |
| 11091530, | Nov 05 2014 | Genentech, Inc. | Methods of producing two chain proteins in bacteria |
| 11098125, | Jun 26 2006 | MacroGenics, Inc. | FcγRIIB-specific antibodies and methods of use thereof |
| 11099180, | Feb 02 2017 | Roche Diagnostics Operations, Inc. | Immunoassay using at least two pegylated analyte-specific binding agents |
| 11103589, | Jan 08 2016 | APG THERAPEUTICS, INC | Polyethylenimine (PEI)-polypeptide conjugates and methods of use thereof |
| 11136390, | Jun 12 2015 | Alector LLC | Anti-CD33 antibodies and methods of use thereof |
| 11174313, | Jun 12 2015 | Alector LLC | Anti-CD33 antibodies and methods of use thereof |
| 11180548, | Feb 05 2015 | Chugai Seiyaku Kabushiki Kaisha | Methods of neutralizing IL-8 biological activity |
| 11180571, | Apr 03 2017 | Hoffmann-La Roche Inc. | Antibodies binding to STEAP-1 |
| 11186645, | Apr 07 2015 | Alector LLC | Isolated nucleic acids encoding anti-sortilin antibodies |
| 11192957, | Dec 21 2017 | Hoffmann-La Roche Inc. | Antibodies binding to HLA-A2/WT1 |
| 11198739, | Nov 12 2004 | Xencor, Inc. | Fc variants with altered binding to FcRn |
| 11203638, | May 05 2017 | ALLAKOS INC | Methods and compositions for treating perennial allergic conjunctivitis and keratoconjunctivitis |
| 11208485, | Oct 11 2018 | Inhibrx, Inc.; INHIBRX, INC | PD-1 single domain antibodies and therapeutic compositions thereof |
| 11208488, | Apr 07 2015 | Alector LLC | Methods of increasing progranulin levels using anti-Sortilin antibodies |
| 11208495, | Aug 28 2017 | ANGIEX, INC | Anti-TM4SF1 antibodies and methods of using same |
| 11226341, | Dec 16 2010 | Genentech, Inc. | Method of treating asthma using an IL-13 antibody |
| 11230600, | Mar 14 2013 | Genentech, Inc. | Anti-B7-H4 antibodies and immunoconjugates |
| 11236154, | Oct 07 2015 | OBI PHARMA, INC | Carbohydrate antibodies, pharmaceutical compositions and uses thereof |
| 11254743, | Aug 03 2017 | Alector LLC | Anti-CD33 antibodies and methods of use thereof |
| 11274154, | Oct 06 2016 | Merck Patent GmbH | Dosing regimen of avelumab for the treatment of cancer |
| 11286300, | Oct 01 2015 | Hoffmann-La Roche Inc. | Humanized anti-human CD19 antibodies and methods of use |
| 11286302, | Sep 12 2014 | Genentech, Inc. | Anti-B7-H4 antibodies and immunoconjugates |
| 11299539, | Nov 05 2014 | Genentech, Inc. | Methods of producing two chain proteins in bacteria |
| 11339223, | Apr 07 2015 | Alector LLC | Methods of use of anti-Sortilin antibodies for treating a disease, disorder, or injury |
| 11359014, | May 16 2017 | Alector LLC | Anti-siglec-5 antibodies and methods of use thereof |
| 11370833, | Sep 15 2014 | Genentech, Inc. | Antibody formulations |
| 11377496, | Mar 14 2013 | The Scripps Research Institute | Targeting agent antibody conjugates and uses thereof |
| 11390680, | Aug 28 2015 | Alector LLC | Anti-Siglec-7 antibodies and methods of use thereof |
| 11391733, | Aug 20 2015 | Roche Diagnostics Operations, Inc. | Particle-based immunoassay using a pegylated analyte-specific binding agent |
| 11396546, | Jul 13 2018 | Alector LLC | Anti-Sortilin antibodies and methods of use thereof |
| 11401348, | Sep 02 2009 | Xencor, Inc. | Heterodimeric Fc variants |
| 11407836, | Jun 27 2012 | Hoffmann-La Roche Inc. | Method for selection and production of tailor-made highly selective and multi-specific targeting entities containing at least two different binding entities and uses thereof |
| 11421022, | Jun 27 2012 | Hoffmann-La Roche Inc. | Method for making antibody Fc-region conjugates comprising at least one binding entity that specifically binds to a target and uses thereof |
| 11421030, | Dec 17 2018 | MiroBio Limited | BTLA antibodies |
| 11440942, | Sep 19 2016 | Hoffmann-La Roche Inc. | Complement factor based affinity chromatography |
| 11447573, | Jul 20 2016 | NANJING LEGEND BIOTECH CO , LTD | Multispecific antigen binding proteins and methods of use thereof |
| 11472881, | Oct 11 2016 | NANJING LEGEND BIOTECH CO , LTD | Single-domain antibodies and variants thereof against CTLA-4 |
| 11535670, | May 11 2016 | HUYABIO International, LLC | Combination therapies of HDAC inhibitors and PD-L1 inhibitors |
| 11578123, | Jun 25 2008 | Novartis AG | Stable and soluble antibodies inhibiting TNFα |
| 11578372, | Nov 05 2012 | FOUNDATION MEDICINE, INC | NTRK1 fusion molecules and uses thereof |
| 11584793, | Jun 24 2015 | Hoffmann-La Roche Inc. | Anti-transferrin receptor antibodies with tailored affinity |
| 11591400, | Apr 15 2016 | MacroGenics, Inc. | B7-H3 directed antibody drug conjugates |
| 11596620, | Mar 13 2013 | F. Hoffmann-La Roche AG | Formulations with reduced oxidation |
| 11603411, | Oct 02 2015 | Hoffmann-La Roche Inc. | Bispecific anti-human CD20/human transferrin receptor antibodies and methods of use |
| 11618788, | Aug 14 2006 | Xencor, Inc. | Optimized antibodies that target CD19 |
| 11618790, | Dec 23 2010 | Hoffmann-La Roche Inc. | Polypeptide-polynucleotide-complex and its use in targeted effector moiety delivery |
| 11634489, | Aug 03 2017 | Alector LLC | Anti-TREM2 antibodies and methods of use thereof |
| 11642415, | Mar 22 2017 | ASCENDIS PHARMA A S | Hydrogel cross-linked hyaluronic acid prodrug compositions and methods |
| 11667710, | Oct 29 2015 | Alector LLC | Anti-Siglec-9 antibodies and methods of use thereof |
| 11673945, | Jun 16 2009 | Hoffmann-La Roche Inc. | Bispecific antigen binding proteins |
| 11673953, | Mar 01 2019 | ALLOGENE THERAPEUTICS, INC.; Pfizer Inc. | DLL3 targeting chimeric antigen receptors and binding agents |
| 11673968, | Jun 26 2014 | Hoffmann-La Roche Inc. | Anti-BRDU antibodies and methods of use |
| 11685790, | Apr 03 2017 | Hoffmann-La Roche Inc. | Antibodies binding to STEAP-1 |
| 11692038, | Feb 14 2020 | GILEAD SCIENCES, INC | Antibodies that bind chemokine (C-C motif) receptor 8 (CCR8) |
| 11713353, | Jan 15 2018 | NANJING LEGEND BIOTECH CO , LTD | Single-domain antibodies and variants thereof against PD-1 |
| 11760801, | Sep 27 2019 | JANSSEN BIOTECH, INC | Anti-CEACAM antibodies and uses thereof |
| 11767342, | Dec 21 2016 | Hoffmann-La Roche Inc. | Method for in vitro glycoengineering of antibodies |
| 11771698, | Jan 18 2013 | Foundation Medicine, Inc. | Methods of treating cholangiocarcinoma |
| 11780908, | Sep 16 2016 | Chugai Seiyaku Kabushiki Kaisha; Agency for Science, Technology and Research | Anti-dengue virus antibodies, polypeptides containing variant FC regions, and methods of use |
| 11780912, | Aug 05 2016 | Jichi Medical University | Composition for prophylaxis or treatment of IL-8 related diseases |
| 11787871, | Dec 08 2006 | MacroGenics, Inc. | Methods for the treatment of disease using immunoglobulins having fc regions with altered affinities for FcgammaRactivating and FegammaRinhibiting |
| 11814409, | Feb 15 2012 | Fc-receptor based affinity chromatography | |
| 11820830, | Jul 20 2004 | Xencor, Inc. | Optimized Fc variants |
| 11827713, | Jun 27 2017 | NANJING LEGEND BIOTECH CO , LTD | Chimeric antibody immune effector cell engagers and methods of use thereof |
| 11832598, | Nov 04 2016 | AKEAGEN, INC. | Genetically modified non-human animals and methods for producing heavy chain-only antibodies |
| 11865177, | Jun 28 2019 | Genentech, Inc. | Composition and methods for stabilizing liquid protein formulations |
| 11891432, | Mar 15 2018 | Chugai Seiyaku Kabushiki Kaisha | Anti-dengue virus antibodies having cross-reactivity to Zika virus and methods of use |
| 11905327, | Dec 28 2017 | NANJING LEGEND BIOTECH CO , LTD | Single-domain antibodies and variants thereof against TIGIT |
| 11912754, | Oct 12 2017 | IMMUNOWAKE INC | VEGFR-antibody light chain fusion protein |
| 7264806, | Nov 01 2003 | Merck Patent GmbH | Modified anti-CD52 antibody |
| 7276585, | Mar 24 2004 | XENCOR, INC | Immunoglobulin variants outside the Fc region |
| 7317091, | Mar 01 2002 | XENCOR, INC | Optimized Fc variants |
| 7521542, | May 10 2004 | MacroGenics, Inc | Humanized FcγRIIB-specific antibodies and methods of use thereof |
| 7662925, | Mar 01 2002 | Xencor, Inc. | Optimized Fc variants and methods for their generation |
| 7786270, | May 26 2006 | MacroGenics, Inc | Humanized FcγRIIB-specific antibodies and methods of use thereof |
| 7897359, | Jul 26 2006 | The Board of Trustees of the Leland Stanford Junior University | Cell cycle regulation and differentiation |
| 7910104, | Nov 01 2003 | Merck Patent GmbH | Modified anti-CD52 antibody |
| 7960512, | Jan 09 2003 | MacroGenics, Inc | Identification and engineering of antibodies with variant Fc regions and methods of using same |
| 7973136, | Oct 06 2005 | XENCOR, INC | Optimized anti-CD30 antibodies |
| 7981418, | Mar 02 2007 | Hoffmann-La Roche Inc | Predicting response to a HER inhibitor |
| 7993921, | Jul 26 2007 | National Institutes of Health (NIH); The United States of America as represented by the Department of Health and Human Services | Cell cycle regulation and differentiation |
| 8003774, | Jan 09 2003 | MacroGenics, Inc. | Identification and engineering of antibodies with variant Fc regions and methods of using same |
| 8039592, | Sep 27 2002 | Xencor, Inc. | Optimized Fc variants and methods for their generation |
| 8044180, | Aug 14 2002 | MacroGenics, Inc. | FcγRIIB specific antibodies and methods of use thereof |
| 8053562, | Jul 19 2005 | UCB BIOPHARMA SPRL | Modified antibody fragments |
| 8067547, | Jun 07 2005 | CELL MEDICA, INC | Stable and soluble antibodies inhibiting TNFα |
| 8084582, | Mar 03 2003 | XENCOR, INC | Optimized anti-CD20 monoclonal antibodies having Fc variants |
| 8093357, | Mar 01 2002 | Xencor, Inc. | Optimized Fc variants and methods for their generation |
| 8093359, | Sep 27 2002 | Xencor, Inc. | Optimized Fc variants and methods for their generation |
| 8101720, | Oct 21 2004 | XENCOR, INC | Immunoglobulin insertions, deletions and substitutions |
| 8124731, | Mar 01 2002 | Xencor, Inc. | Optimized Fc variants and methods for their generation |
| 8133982, | May 10 2004 | MacroGenics, Inc. | FcγRIIB specific antibodies and methods of use thereof |
| 8187593, | Aug 14 2002 | MacroGenics, Inc. | FcγRIIB specific antibodies and methods of use thereof |
| 8188231, | Sep 27 2002 | XENCOR, INC | Optimized FC variants |
| 8192737, | Jan 09 2003 | MacroGenics, Inc. | Identification and engineering of antibodies with variant Fc regions and methods of using same |
| 8193318, | Aug 14 2002 | MacroGenics, Inc. | FcγRIIB specific antibodies and methods of use thereof |
| 8216574, | Nov 10 2004 | MacroGenics, Inc. | Engineering Fc antibody regions to confer effector function |
| 8216579, | May 26 2006 | MacroGenics, Inc. | Humanized FcγRIIB-specific antibodies and methods of use thereof |
| 8217147, | Aug 10 2005 | MacroGenics, Inc | Identification and engineering of antibodies with variant Fc regions and methods of using same |
| 8217149, | Dec 09 2008 | F HOFFMANN-LA ROCHE AG | Anti-PD-L1 antibodies, compositions and articles of manufacture |
| 8269082, | Oct 20 2005 | Commonwealth Scientific and Industrial Research Organisation | Cereals with altered dormancy |
| 8293235, | Jun 25 2008 | Novartis AG | Humanization of rabbit antibodies using a universal antibody framework |
| 8318907, | Nov 12 2004 | Xencor, Inc. | Fc variants with altered binding to FcRn |
| 8324351, | Nov 12 2004 | Xencor, Inc. | Fc variants with altered binding to FcRn |
| 8338574, | Jul 24 2007 | Xencor, Inc. | FC variants with altered binding to FCRN |
| 8349322, | Jun 25 2008 | Novartis AG | Stable and soluble antibodies inhibiting VEGF |
| 8367805, | Oct 31 2007 | Xencor, Inc. | Fc variants with altered binding to FcRn |
| 8383109, | Sep 27 2002 | Xencor, Inc. | Optimized Fc variants and methods for their generation |
| 8388955, | Mar 03 2003 | XENCOR, INC | Fc variants |
| 8389693, | Jun 07 2005 | CELL MEDICA, INC | Stable and soluble antibodies inhibiting TNFα |
| 8394374, | Sep 18 2006 | XENCOR, INC | Optimized antibodies that target HM1.24 |
| 8444983, | Mar 23 2009 | ONCOMATRYX BIOPHARMA, S L | Composition of anti-ENDO180 antibodies and methods of use for the treatment of cancer and fibrotic diseases |
| 8512983, | Aug 11 2009 | F HOFFMANN-LA ROCHE AG | Production of proteins in glutamine-free cell culture media |
| 8524867, | Aug 14 2006 | XENCOR, INC | Optimized antibodies that target CD19 |
| 8530627, | Aug 14 2002 | MacroGenics, Inc. | FcγRIIB specific antibodies and methods of use thereof |
| 8546543, | Nov 12 2004 | XENCOR, INC | Fc variants that extend antibody half-life |
| 8652466, | Dec 08 2006 | MacroGenics, Inc | Methods for the treatment of disease using immunoglobulins having Fc regions with altered affinities for FcγRactivating and FcγRinhibiting |
| 8669349, | Apr 02 2008 | MacroGenics, Inc | BCR-complex-specific antibodies and methods of using same |
| 8673310, | Jun 25 2008 | Novartis AG | Stable and soluble antibodies inhibiting TNFα |
| 8674083, | Jan 15 1999 | Genentech, Inc. | Polypeptide variants with altered effector function |
| 8691228, | Jun 07 2005 | CELL MEDICA, INC | Stable and soluble antibodies inhibiting TNFα |
| 8734791, | Mar 01 2002 | Xencor, Inc. | Optimized fc variants and methods for their generation |
| 8735545, | May 05 2005 | XENCOR, INC | Fc variants having increased affinity for fcyrllc |
| 8735547, | Sep 27 2002 | Xencor, Inc. | Optimized Fc Variants |
| 8753628, | Sep 27 2002 | Xencor, Inc. | Optimized Fc variants |
| 8753629, | Sep 27 2002 | Xencor, Inc. | Optimized Fc variants |
| 8771685, | Dec 23 2009 | Genentech, Inc; F HOFFMANN-LA ROCHE AG | Anti-BV8 antibodies and uses thereof |
| 8778339, | Jun 26 2006 | MacroGenics, Inc. | Combination of FcγRIIB-specific antibodies and CD20-specific antibodies and methods of use thereof |
| 8784808, | May 10 2004 | MacroGenics, Inc. | FcγRIIB specific antibodies and methods of use thereof |
| 8785599, | Jun 26 2006 | MacroGenics, Inc | FcγRIIB—specific antibodies and methods of use thereof |
| 8796424, | May 27 2009 | Hoffmann-La Roche Inc | Tri- or tetraspecific antibodies |
| 8802091, | Mar 04 2010 | MacroGenics, Inc | Antibodies reactive with B7-H3 and uses thereof |
| 8802093, | Apr 02 2008 | MacroGenics, Inc | HER2/neu-specific antibodies and methods of using same |
| 8802820, | Jul 24 2007 | XENCOR, INC | Fc variants with altered binding to FcRn |
| 8802823, | Sep 26 2003 | Xencor, Inc. | Optimized Fc variants |
| 8809503, | Sep 27 2002 | Xencor, Inc. | Optimized Fc variants and methods for their generation |
| 8852586, | Nov 12 2004 | Xencor, Inc. | Fc variants with altered binding to FcRn |
| 8853369, | Jun 18 2010 | Genentech, Inc | Anti-Axl antibodies and methods of use |
| 8858937, | Sep 27 2002 | Xencor, Inc. | Optimized Fc variants and methods for their generation |
| 8883973, | Nov 12 2004 | Xencor, Inc. | Fc variants with altered binding to FcRn |
| 8921281, | May 20 2009 | NOVIMMUNE S A | Synthetic polypeptide libraries and methods for generating naturally diversified polypeptide variants |
| 8937162, | Jun 25 2008 | Novartis AG | Humanization of rabbit antibodies using a universal antibody framework |
| 8940302, | Mar 02 2007 | Genentech, Inc.; Hoffmann-La Roche Inc. | Predicting response to a HER inhibitor |
| 8946387, | Aug 14 2002 | MacroGenics, Inc. | FcγRIIB specific antibodies and methods of use thereof |
| 8951517, | Jan 09 2003 | MacroGenics, Inc. | Identification and engineering of antibodies with variant Fc regions and methods of using same |
| 8968730, | Aug 14 2002 | Macrogenics Inc. | FcγRIIB specific antibodies and methods of use thereof |
| 8969526, | Mar 29 2011 | ROCHE GLYCART AG | Antibody Fc variants |
| 8986972, | Feb 24 2012 | AbbVie Stemcentrx LLC | Nucleic acid encoding DLL3 antibodies |
| 8993730, | Apr 02 2008 | MacroGenics, Inc. | BCR-complex-specific antibodies and methods of using same |
| 9011854, | Feb 24 2012 | Stemcentrx, Inc. | Anti-DLL3 antibody drug conjugates and methods of use |
| 9028815, | Jan 09 2003 | MacroGenics, Inc. | Identification and engineering of antibodies with variant FC regions and methods of using same |
| 9040041, | Oct 03 2005 | Xencor, Inc. | Modified FC molecules |
| 9040042, | Sep 18 2006 | Xencor, Inc. | Optimized antibodies that target HM1.24 |
| 9051373, | May 02 2003 | Xencor, Inc. | Optimized Fc variants |
| 9056910, | May 01 2012 | Genentech, Inc | Anti-PMEL17 antibodies and immunoconjugates |
| 9089615, | Feb 24 2012 | AbbVie Stemcentrx LLC | Anti-DLL3 antibodies |
| 9089616, | Feb 24 2012 | AbbVie Stemcentrx LLC | Anti-DLL3 antibody drug conjugates and methods of use |
| 9089617, | Feb 24 2012 | AbbVie Stemcentrx LLC | Anti-DLL3 antibody drug conjugates |
| 9090683, | Feb 24 2012 | AbbVie Stemcentrx LLC | Methods of detection, diagnosis, and monitoring using anti-DLL3 antibodies |
| 9090684, | Jun 25 2008 | Novartis AG | Stable and soluble antibodies inhibiting VEGF |
| 9096877, | Oct 07 2009 | MacroGenics, Inc | Fc region-containing polypeptides that exhibit improved effector function due to alterations of the extent of fucosylation, and methods for their use |
| 9107961, | Feb 24 2012 | AbbVie Stemcentrx LLC | Anti-DLL3 antibody drug conjugates for treating cancer |
| 9133271, | Feb 24 2012 | AbbVie Stemcentrx LLC | Anti-DLL3 antibody drug conjugates and methods of use |
| 9150656, | Mar 04 2010 | MacroGenics, Inc | Antibodies reactive with B7-H3, immunologically active fragments thereof and uses thereof |
| 9155803, | Feb 24 2012 | AbbVie Stemcentrx LLC | Anti-DLL3 antibody drug conjugates and methods of use |
| 9173959, | Feb 24 2012 | AbbVie Stemcentrx LLC | Anti-DLL3 antibody drug conjugates |
| 9175089, | Mar 30 2012 | Genentech, Inc | Anti-LGR5 antibodies and immunoconjugates |
| 9193798, | Sep 27 2002 | Xencor, Inc. | Optimized Fc variants and methods for their generation |
| 9200079, | Nov 12 2004 | XENCOR, INC | Fc variants with altered binding to FcRn |
| 9243069, | Apr 02 2008 | MacroGenics, Inc. | HER2/neu-specific antibodies and methods of using the same |
| 9266948, | Dec 23 2009 | Genentech, Inc. | Anti-Bv8 antibodies and uses thereof |
| 9266961, | Jun 15 2012 | F HOFFMANN-LA ROCHE AG | Anti-PCSK9 antibodies, formulations, dosing, and methods of use |
| 9266967, | Dec 21 2007 | HOFFMANN-LA ROCHE, INC | Bivalent, bispecific antibodies |
| 9315572, | Jun 07 2005 | CELL MEDICA, INC | Stable and soluble antibodies inhibiting TNF alpha |
| 9334318, | Feb 24 2012 | AbbVie Stemcentrx LLC | Multivalent DLL3 antibodies |
| 9345784, | Feb 24 2012 | AbbVie Stemcentrx LLC | Methods of delivering DLL3 antibody drug conjugates |
| 9352051, | Feb 24 2012 | AbbVie Stemcentrx LLC | Kits containing DLL3 antibody drug conjugates |
| 9353182, | Feb 24 2012 | AbbVie Stemcentrx LLC | Anti-DLL3 antibodies |
| 9353187, | Sep 27 2002 | Xencor, Inc. | Optimized FC variants and methods for their generation |
| 9358304, | Feb 24 2012 | AbbVie Stemcentrx LLC | Methods of making DLL3 antibody drug conjugates |
| 9382323, | Apr 02 2009 | Hoffmann-La Roche Inc | Multispecific antibodies comprising full length antibodies and single chain fab fragments |
| 9422366, | Jun 25 2008 | Novartis AG | Stable and soluble antibodies inhibiting TNF alpha |
| 9441035, | Mar 15 2013 | Genentech, Inc | Cell culture media and methods of antibody production |
| 9441049, | Mar 04 2010 | MacroGenics, Inc. | Antibodies reactive with B7-H3 and uses thereof |
| 9469692, | Apr 02 2008 | MacroGenics, Inc. | HER2/neu-specific antibodies and methods of using same |
| 9475881, | Jan 19 2010 | Xencor, Inc. | Antibody variants with enhanced complement activity |
| 9480757, | Feb 24 2012 | AbbVie Stemcentrx LLC | Anti-DLL3 antibody drug conjugates |
| 9481727, | Feb 24 2012 | AbbVie Stemcentrx LLC | Anti-DLL3 antibody drug conjugates |
| 9486537, | Feb 24 2012 | AbbVie Stemcentrx LLC | Anti-DLL3 antibody drug conjugates |
| 9487587, | Mar 05 2013 | MacroGenics, Inc. | Bispecific molecules that are immunoreactive with immune effector cells of a companion animal that express an activating receptor and cells that express B7-H3 and uses thereof |
| 9546215, | Dec 09 2013 | ALLAKOS INC | Anti-Siglec-8 antibodies and methods of use thereof |
| 9562097, | Jul 01 2011 | F HOFFMANN-LA ROCHE AG | Use of anti-CD83 agonist antibodies for treating autoimmune diseases |
| 9562099, | Mar 14 2013 | Genentech, Inc. | Anti-B7-H4 antibodies and immunoconjugates |
| 9574006, | Oct 06 2005 | Xencor, Inc. | Optimized anti-CD30 antibodies |
| 9593161, | Jun 25 2008 | Novartis AG | Humanization of rabbit antibodies using a universal antibody framework |
| 9597411, | May 01 2012 | Genentech, Inc. | Anti-PMEL17 antibodies and immunoconjugates |
| 9645151, | Aug 17 2012 | California Institute of Technology | Targeting phosphofructokinase and its glycosylation form for cancer |
| 9657106, | May 02 2003 | Xencor, Inc. | Optimized Fc variants |
| 9663582, | May 02 2003 | Xencor, Inc. | Optimized Fc variants |
| 9676845, | Jun 16 2009 | HOFFMANN-LA ROCHE, INC | Bispecific antigen binding proteins |
| 9683034, | Jun 07 2005 | CELL MEDICA, INC | Stable and soluble antibodies inhibiting TNFα |
| 9684000, | Dec 16 2010 | Genentech, Inc. | Diagnosis and treatments relating to TH2 inhibition |
| 9688758, | Feb 10 2012 | Genentech, Inc. | Single-chain antibodies and other heteromultimers |
| 9695233, | Jul 13 2012 | Hoffmann-La Roche Inc | Bispecific anti-VEGF/anti-ANG-2 antibodies and their use in the treatment of ocular vascular diseases |
| 9695236, | Apr 02 2008 | MacroGenics, Inc. | BCR-complex-specific antibodies and methods of using same |
| 9708408, | Dec 08 2006 | MacroGenics, Inc. | Methods for the treatment of disease using immunoglobulins having Fc Regions with altered affinities for FcγRactivating and FcγRinhibiting |
| 9714282, | Sep 26 2003 | Xencor, Inc. | Optimized Fc variants and methods for their generation |
| 9714293, | Aug 11 2009 | Genentech, Inc. | Production of proteins in glutamine-free cell culture media |
| 9714295, | Mar 04 2010 | MacroGenics, Inc. | Antibodies reactive with B7-H3, immunologically active fragments thereof and uses thereof |
| 9714296, | Mar 04 2010 | MacroGenics, Inc. | Antibodies reactive with B7-H3, immunologically active fragments thereof and uses thereof |
| 9724413, | Aug 01 2011 | Genentech, Inc. | Methods of treating cancer using PD-1 axis binding antagonists and MEK inhibitors |
| 9737599, | Jun 26 2006 | MacroGenics, Inc. | Combination of FcγRIIB-specific antibodies and CD20-specific antibodies and methods of use thereof |
| 9764042, | Feb 24 2012 | AbbVie Stemcentrx LLC | Methods of making DLL3 antibody drug conjugates |
| 9765153, | Jul 04 2012 | Hoffmann-La Roche Inc. | Anti-biotin antibodies and methods of use |
| 9770461, | Aug 02 2013 | California Institute of Technology | Tailored glycopolymers as anticoagulant heparin mimetics |
| 9770518, | Feb 24 2012 | AbbVie Stemcentrx LLC | Anti-DLL3 antibody drug conjugates |
| 9775916, | Feb 24 2012 | AbbVie Stemcentrx LLC | Anti-DLL3 antibody drug conjugates for treating cancer |
| 9803020, | Aug 14 2006 | Xencor, Inc. | Optimized antibodies that target CD19 |
| 9803023, | Nov 12 2004 | Xencor, Inc. | Fc variants with altered binding to FcRn |
| 9821065, | Mar 13 2013 | Genentech, Inc. | Antibody formulations |
| 9855343, | Feb 24 2012 | AbbVie Stemcentrx LLC | Anti-DLL3 antibody drug conjugates |
| 9861708, | Feb 24 2012 | AbbVie Stemcentrx LLC | Kits containing DLL3 antibody drug conjugates |
| 9867887, | Feb 24 2012 | AbbVie Stemcentrx LLC | Anti-DLL3 antibody drug conjugates |
| 9873737, | Jun 25 2008 | Novartis AG | Stable and soluble antibodies inhibiting VEGF |
| 9878053, | Feb 24 2012 | AbbVie Stemcentrx LLC | Methods of delivering DLL3 antibody drug conjugates |
| 9879095, | Aug 24 2010 | Hoffmann-La Roche Inc | Bispecific antibodies comprising a disulfide stabilized-Fv fragment |
| 9890204, | Apr 07 2009 | Hoffmann-La Roche Inc | Trivalent, bispecific antibodies |
| 9896508, | Mar 04 2010 | MacroGenics, Inc. | Antibodies reactive with B7-H3 and uses thereof |
| 9920123, | Dec 09 2008 | Genentech, Inc. | Anti-PD-L1 antibodies, compositions and articles of manufacture |
| 9925272, | Jul 04 2012 | Hoffmann-La Roche Inc. | Anti-theophylline antibodies and methods of use |
| 9931420, | Feb 24 2012 | AbbVie Stemcentrx LLC | Methods of making DLL3 antibody drug conjugates |
| 9931421, | Feb 24 2012 | AbbVie Stemcentrx LLC | Methods of delivering DLL3 antibody drug conjugates |
| 9937268, | Feb 24 2012 | AbbVie Stemcentrx LLC | Anti-DLL3 antibody drug conjugates and methods of use |
| 9968687, | Feb 22 2013 | AbbVie Stemcentrx LLC | Anti-DLL3 antibody drug conjugates |
| 9975957, | Mar 31 2014 | F HOFFMANN-LA ROCHE AG | Anti-OX40 antibodies and methods of use |
| 9975963, | Oct 11 2013 | Genentech, Inc. | NSP4 inhibitors and methods of use |
| 9982036, | Feb 28 2011 | Hoffmann-La Roche Inc | Dual FC antigen binding proteins |
| 9993567, | Mar 23 2009 | ONCOMATRYX BIOPHARMA, S L | Composition of anti-ENDO180 antibodies and methods of use for the treatment of cancer and fibrotic diseases |
| 9994646, | Sep 16 2009 | Genentech, Inc. | Coiled coil and/or tether containing protein complexes and uses thereof |
| 9995755, | Dec 16 2010 | Genentech, Inc. | Diagnosis and treatments relating to TH2 inhibition |
| RE47761, | Jun 18 2010 | Genentech, Inc. | Anti-axl antibodies and methods of use |
| Patent | Priority | Assignee | Title |
| 4816567, | Apr 08 1983 | CITY OF HOPE, A CORP OF CA | Recombinant immunoglobin preparations |
| 5078998, | Aug 02 1985 | STAERZ, UWE D ; BEVAN, MICHAEL J | Hybrid ligand directed to activation of cytotoxic effector T lymphocytes and target associated antigen |
| 5091513, | Jun 30 1988 | Creative BioMolecules, Inc. | Biosynthetic antibody binding sites |
| 5225539, | Mar 27 1986 | Medical Research Council | Recombinant altered antibodies and methods of making altered antibodies |
| 5585089, | Dec 28 1988 | PDL Biopharma, Inc | Humanized immunoglobulins |
| 5693761, | Dec 28 1988 | PDL Biopharma, Inc | Polynucleotides encoding improved humanized immunoglobulins |
| 5693762, | Dec 28 1988 | PDL Biopharma, Inc | Humanized immunoglobulins |
| 5846534, | Feb 12 1988 | United Kingdom Research and Innovation | Antibodies to the antigen campath-1 |
| 6180370, | Dec 28 1988 | PDL Biopharma, Inc | Humanized immunoglobulins and methods of making the same |
| 6548640, | Mar 27 1986 | BTG International Limited | Altered antibodies |
| 6569430, | Feb 12 1988 | United Kingdom Research and Innovation | Antibodies to the antigen Campath-1 |
| EP125023, | |||
| EP173494, | |||
| EP183964, | |||
| EP184187, | |||
| EP239400, | |||
| WO8601533, | |||
| WO9109966, | |||
| WO9109967, |
| Executed on | Assignor | Assignee | Conveyance | Frame | Reel | Doc |
| Jan 24 2003 | Medical Research Council | (assignment on the face of the patent) | / | |||
| Jan 24 2003 | BTG International Limited | (assignment on the face of the patent) | / | |||
| Apr 28 2005 | Medical Research Council | BTG International Limited | ASSIGNMENT OF ASSIGNORS INTEREST SEE DOCUMENT FOR DETAILS | 016508 | /0742 |
| Date | Maintenance Fee Events |
| Jul 13 2009 | REM: Maintenance Fee Reminder Mailed. |
| Jan 03 2010 | EXP: Patent Expired for Failure to Pay Maintenance Fees. |
| Date | Maintenance Schedule |
| Jan 03 2009 | 4 years fee payment window open |
| Jul 03 2009 | 6 months grace period start (w surcharge) |
| Jan 03 2010 | patent expiry (for year 4) |
| Jan 03 2012 | 2 years to revive unintentionally abandoned end. (for year 4) |
| Jan 03 2013 | 8 years fee payment window open |
| Jul 03 2013 | 6 months grace period start (w surcharge) |
| Jan 03 2014 | patent expiry (for year 8) |
| Jan 03 2016 | 2 years to revive unintentionally abandoned end. (for year 8) |
| Jan 03 2017 | 12 years fee payment window open |
| Jul 03 2017 | 6 months grace period start (w surcharge) |
| Jan 03 2018 | patent expiry (for year 12) |
| Jan 03 2020 | 2 years to revive unintentionally abandoned end. (for year 12) |