The use of dna sequences comprising a glucanase coding region operably linked to a promoter, or other regulatory sequence, which provides for expression of the dna sequence with appropriate tissue and/or temporal specificity, in the preparation of a male sterile transgenic tomato plant is disclosed. In preferred embodiments the promoter is a tapetum specific promoter, eg an A3 or an A9 promoter. dna sequences comprising the PR-Glucanase coding region and an A3 or an A9 promoter, preferably an A9 promoter are also described, as are transgenic tomato plants, plant cells, propagating material, seeds, antisense dna sequences and ribozyme encoding dna sequences for restoration of male-fertility.
|
1. A transgenic tomato plant cell comprising a heterologous dna molecule encoding a beta (1,3) PR-Glucanase enzyme operably linked to a promoter, or other regulatory sequence, which provides for expression of the dna molecule in the tapetum and/or microsporogenous cells prior to expression of callase.
2. The transgenic tomato plant cell of
3. The transgenic tomato plant cell of
4. The transgenic tomato plant cell of
5. The transgenic tomato plant cell of
6. The transgenic tomato plant cell of
7. The transgenic tomato plant cell of
8. The transgenic tomato plant cell of
9. The transgenic tomato plant cell of
11. A transgenic male sterile tomato plant comprising the tomato plant cell of any one of
12. Propagating material derived from the transgenic male sterile tomato plant of
13. A seed from the transgenic male sterile tomato plant of
14. A process for producing the transgenic male sterile tomato plant of
|
|||||||||||||||||||||||||||||||||||||||||||||
This application is a continuation of PCT International Application No. PCT/GB97/00992, filed Apr. 10, 1997, claiming priority of Great Britain Patent Application No. 9607517.1, filed Apr. 11, 1996, the contents of which are hereby incorporated by reference.
The present invention relates to the use of DNA sequences comprising the coding sequence for a Glucanase enzyme, particularly PR-Glucanase, operably linked to a promoter having an appropriate temporal and/or tissue expression pattern, for instance a tapetum specific promoter, eg an A3 or A9 promoter to transform tomato plants or plant cells to generate male-sterile tomato plants. Tomato plants, and seeds thereof, also form part of the invention.
Hybrid plants have the advantages of higher yield and better disease resistance than their parents, because of heterosis or hybrid vigour. Crop uniformity is another advantage of hybrid plants when the parents are extensively homozygous; this leads to improved crop management. Hybrid seed is therefore commercially important and sells at a premium price.
To date there have been various proposals relating to the production of male-sterile plants. EP-A-0329308 describes various methods for producing male-sterile plants including the use of DNA sequences which code for “antisense” RNA which can block expression of one or more genes essential for pollen production as well as the use of a pollen specific promoter to drive expression of a DNA sequence coding for a cytotoxic molecule.
EP-A-0344029 similarly describes methods for producing male-sterile plants which are based on the use of “antisense” DNA sequences as well as the use of tissue specific promoters to control expression of a cytotoxic molecule. Examples of such cytotoxic molecules provided in EP-A-0344029 are RNase T1, Barnase, DNases, proteases, phytohormones, enzymes involved in the synthesis of auxin, glucanases, lipases, lipid peroxidases, plant cell wall inhibitors and bacterial toxins.
Methods which rely on the expression of a cytotoxic substance in particular tissues are, of course, dependent upon the availability of tissue specific promoters. WO-A-92/11379 provides certain Tapetum-specific promoters, designated A3 and A9 which are useful in methods for the production of male-sterile plants by means of tissue and temporal specific expression of a cytotoxic substance.
Barnase in particular has been put forward as a particularly useful cytotoxic molecule for use in producing male-sterile plants. However, Barnase does not appear to be useful in all plant species. In particular it has now been found to have certain side effects in Tomato plants which have been transformed with a DNA molecule comprising a Barnase coding sequence under the control of a tissue specific promoter. Thus, at present there is no useful method for the production of male-sterile Tomato plants.
Surprisingly, we have now found that in the case of tomato plants the use of, for example, a tapetum specific promoter to drive expression of a DNA sequence encoding a glucanase enzyme does represent a particularly effective method of producing male-sterile tomato plants which avoids the side effect problems experienced with Barnase. Examples of useful tapetum specific promoters include the A3 or A9 promoters described in WO-A-92/11379.
Thus, in a first aspect, the present invention provides the use of:
In the context of the present invention, “appropriate tissue and/or temporal specificity” means that the promoter provides for expression of the glucanase in such a way that male sterility results in the transgenic tomato plant. For example, the sequence will be expressed in tissues where its activity will lead to male sterility. Time of expression may also be important and hence the need for a degree of temporal specificity.
Suitably, the DNA sequence will be operably linked to a promoter, or other regulatory sequence, which provides for expression of the DNA sequence in the tapetum and/or microsporogenous cells prior to expression of callase. Thus, tapetum specific promoters with appropriate temporal expression patterns are particularly useful, eg an A3 or an A9 promoter as disclosed in WO-A-92/11379, as well as sequences which consist only of those regulatory elements from such promoters which are required to initiate tissue specific expression.
Additionally, promoters which have desired temporal specificity but which are more generally expressed throughout plant tissue may also be useful in the practice of the present invention, provided that they are active in the appropriate tissues, and hence the use of such promoter sequences are also within the scope of the invention.
In the case of (i) as defined above the coding sequence for the glucanase enzyme will be the natural coding sequence. For sequences as defined in (ii) above, it is a sequence substantially homologous to the natural coding sequence. The skilled man will appreciate that due to the degeneracy of the genetic code it is possible to make conservative changes to the DNA sequence which will not result in changes to the amino acid sequence of the glucanase enzyme. In addition, sequences defined in (iii) above are also within the scope of the invention. It is well known in the protein art that “conservative” or indeed “semi-conservative” changes can be made to the amino acid sequence of a protein which will not alter its fundamental activity. For example, amino acids such as glycine, valine, leucine and isoleucine, which all have aliphatic side chains, may often be substituted for each other without substantially altering the biological activity of the protein. Similarly, amino acids such as phenylalanine, tyrosine and tryptophan, which all have aromatic side chains, may be substituted for each other. Thus, the use of DNA sequences coding for such modified forms of the glucanase enzyme are also within the scope of the present invention.
In the context of (iii) as defined above, the proteins coded for by the DNA sequence which are substantially homologous to the glucanase protein as defined in (i) or (ii) above, may be 40%, 50%, 60%, 70%, 80%, 90%, 95% or even 99% homologous. Preferably, the protein will be 60% homologous, more preferably 80% homologous, even more preferably 90% homologous and most preferably 95% homologous.
In the context of the present invention, the term “promoter, or other regulatory sequence” includes the complete promoter sequence eg the A3 or A9 promoter, or may refer to those elements or parts of the promoter sequence which provide the necessary tissue and/or temporal specificity. Thus, the skilled man would understand that a complete promoter sequence could be so modified to remove non-essential, non-regulatory elements if required. In addition, it would be possible to modify constitutive promoters by inclusion of tissue and/or temporal control sequences from promoters such as the A3 or A9 promoters to produce composite or chimeric promoter sequences useful in the practice of the invention.
As mentioned above, examples of suitable tapetum specific promoters include the A3 and A9 promoters. In addition, it will also be understood by the skilled man that such A3 or A9 promoters can be derived not only from Brassicaceae spp as disclosed in WO-A-92/11379, but also from other sources, for instance from Maize. Thus, the use of A3 or A9 “like” promoters derived from such other sources, eg the A9 “like” promoter from Maize also form part of the present invention.
In a preferred embodiment, the promoter will be either the complete A9 promoter or at least those regulatory elements essential for initiation of transcription. In particular the A9 promoter from Brassicaceae spp. is preferred. One example of a preferred glucanase enzyme whose DNA coding sequence is useful in the present invention is β(1,3)PR-Glucanase. A DNA sequence encoding this enzyme is shown in
DNA for use in accordance with the invention may be in the form of a vector. Examples of suitable vectors include plasmids, cosmids, artificial chromosomes, viruses or phages. In addition, DNA sequences used in the invention may include one or more selectable markers to enable selection of cells transfected (or transformed: the terms are used interchangeably in this specification) with them and, preferably, to enable selection of cells harbouring vectors incorporating heterologous DNA. One example of such a selectable marker is a gene which when expressed will confer herbicide resistance, eg a gene conferring resistance against the herbicide BASTA.
Although EP-A-0344029 included glucanases as an example of cytotoxic molecules for use in conferring male sterility, this was disclosed only as part of a general list of possibilities of apparently equal merit, and this disclosure did not include any discussion of the particular problems associated with producing a useable male sterile tomato plant.
WO-A-92/11379 disclosed DNA constructs comprising the A3 or A9 promoter from Brassicaceae and the coding sequence for β-1,3 glucanase from N. tabacum. However, this disclosure also included examples using the A3 or A9 promoter to drive expression of Barnase, and again no discussion of the particular advantages of using an A3/A9-glucanase system in a tomato plant was disclosed.
DNA for use in accordance with the invention can be prepared by any convenient method involving coupling together successive nucleotides, and/or ligating oligo- and/or poly-nucleotides, including in vitro processes, but recombinant DNA technology forms the method of choice. Ultimately, the DNA will be introduced into plant cells, by any suitable means.
Preferably, plant cells are transformed with DNA using a disarmed Ti-plasmid vector and carried by Agrobacterium by procedures known in the art, for example as described in EP-A-0116718 and EP-A-0270822. Alternatively, the foreign DNA could be introduced directly into plant cells using an electrical discharge apparatus. Any other method that provides for the stable incorporation of the DNA within the nuclear DNA of any plant cell of any species would also be suitable.
Although the provision of male-sterile plants is advantageous, there is also a need to provide a means for the restoration of fertility. One may wish to ensure, for instance, that 100% of F1 hybrid plants are fertile. A convenient way to achieve this is by the use of a restorer gene or sequence. In the context of the present invention this restorer gene can comprise DNA encoding RNA which is in the antisense orientation relative to the RNA transcribed from the glucanase DNA sequence. This restorer DNA can be operably linked to a promoter which displays an appropriate temporal and tissue expression pattern, eg that used to drive expression of the glucanase DNA sequence as described above. Thus, promoters, or other regulatory sequences as described herein are equally useful in providing for restoration of male fertility. Thus, it can be operably linked to a tapetum specific promoter such as an A3 or A9 promoter as described herein.
In a second aspect, therefore, the present invention provides the a DNA sequence which is complementary to at least part of a DNA sequence coding for a glucanase as defined in (i), (ii) or (iii) above. Suitably, the DNA sequence of this aspect of the invention is operably linked to a promoter, or other regulatory sequence, which provides for expression of the DNA sequence with appropriate tissue and/or temporal specificity. In preferred embodiments, the promoter, or other regulatory sequence, will be as described above for use with the glucanase encoding DNA sequence.
Suitably, the antisense DNA sequence is complementary to at least a part of the DNA sequence encoding PR-Glucanase, eg is complementary to at least part of the sequence shown in
A still further example of fertility restorer DNA encodes an RNA enzyme (known as a ribozyme) capable of highly specific cleavage against a given target sequence (Haseloff and Gerlach Nature 334 585-591 (1988)). Like antisense DNA, for ribozyme DNA (coding in this instance for a ribozyme which is targeted against the RNA encoded by a glucanase coding sequence) it may be possible to use any appropriate promoter, or other regulatory sequence as described herein to drive ribozyme-encoding DNA.
Thus, according to a third aspect of the invention, there is provided a DNA sequence encoding a ribozyme capable of specific cleavage of RNA encoded by a DNA molecule as defined in (i), (ii) or (iii) as described herein. Suitably, the ribozyme encoding DNA sequence can be under the control of a promoter, or other regulatory sequence, which provides for expression of the ribozyme encoding DNA sequence with appropriate tissue and/or temporal specificity, eg a tapetum specific promoter such as an A3 or an A9 promoter, preferably an A9 promoter. In a preferred embodiment the ribozyme is capable of specifically cleaving RNA derived from a DNA sequence coding for PR-Glucanase. A suitable ribozyme coding DNA sequence is shown in
The present invention contemplates the use of all forms of ribozyme. These include ribozymes as described by Haseloff and Gerlach (Nature, 334:585-591 (1988)), ribozymes which form part of an expressed message, ribozymes which are embedded within snRNA or tRNA and multimeric ribozymes, which in turn can be comprised of the same or different individual ribozymes.
Both the complementary DNA sequences of the invention as well as the ribozyme-encoding DNA of the invention would be useful in restoring male fertility in tomato plants. Thus, in a fourth aspect, the present invention provides the use of such DNA sequences of the invention in the restoration of male-fertility in a tomato plant.
Thus, the use of the glucanase encoding DNA sequences as defined herein enables the production of transgenic tomato plants which are male-sterile. Thus, in a fifth aspect, the present invention provides a transgenic tomato plant which has incorporated in at least some of its cells a glucanase encoding DNA sequence as defined herein and as described above.
In a sixth aspect, the present invention provides a transgenic tomato plant which has incorporated in at least some of its cells a complementary or ribozyme encoding DNA sequence of the invention.
In further aspects the present invention provides:
Preferred features of each aspect of the invention are as for each other aspect mutatis mutandis.
The invention will now be described with reference to the following examples, which should not be construed as in any way limiting the invention. The examples refer to the figures in which:
When transformed into the model plant species tobacco, both the A9 promoter—Barnase and A9 promoter-PR glucanase chimaeric genes will cause male sterility (Paul et al, Plant Molecular Biology, 19:611-622 (1992); Worrall et al, Plant Cell, 4:759-771 (1992)). In the case of A9-Barnase, the majority of the male sterile plants were phenotypically normal. To determine which AMS gene is superior in the closely related species tomato, both AMS genes were transferred into a binary vector that is preferred for tomato transformation. This binary vector, pGA492 (An, Plant Physiology, 81:86-91 (1986)), gives a higher number of tomato transformants than the vector pBin19 (Bevan et al, Nucl. Acids Res., 12:8711-8721 (1984)) which was used in previous experiments in tobacco.
First the KpnI, EcoRV A9-PR Glucanase chimaeric gene fragment of pDW80PR (Worrall et al (1992) supra) was cloned between the KpnI and SmaI sites of pBluescript KS+ (Stratagene) forming pWP173. Secondly the A9-PR Glucanase gene of pWP173 was transferred as a KpnI, SstI fragment into KpnI, SstI-cut pGA492 forming pWP173GA (
Similarly the KpnI, EcoRV A9-Barnase chimaeric gene fragment of pWP127 (Paul et al (1992) supra) was cloned between the KpnI and SmaI sites of pBluescript KS+ forming pWP174. The A9-Barnase gene was then transferred from pWP174 as a KpnI-SstI fragment into KpnI, SstI-cut pGA492 forming pWP174GA (
Of 31 tomato plants transformed with the PR-Glucanase gene, 26 plants exhibited complete male sterility with no observable pleiotropic effects (
Of 29 tomato plants transformed with the A9-Barnase gene only 11 exhibited male sterility. However 50 k of the male sterile plants also exhibited additional pleiotropic effects including stunted growth with small and malformed flowers (
Thus the A9-PR-Glucanase gene is preferred for the creation of male sterile tomato plants.
In dominant male sterility systems the AMS plants are maintained by pollination with wild type plants. Seed produced on the AMS plant will therefore be a 1:1 mixture of AMS and wild-type plants. To select for tomato seedlings that contain the AMS gene, the A9-PR glucanase gene is linked to the herbicide resistance gene phosphinothricin acetyl transferase, PAT (Wohlleben et al, Gene, 70:25-37 ('988)) which confers resistance to the herbicide BASTA. A 1.6 kb KpnI fragment encoding the CaMV 35S promoter-PAT chimaeric gene from PBASTA (a derivative of pIB16.1 (Broer et al, In proceedings of the Braunschweig Symposium on Applied Plant Molecular Biology, Braunschweig, November 21-23 (1989) pp 240-246) was cloned into the KpnI site of pWP173GA forming pBIOS171 (
In order for 100 k of F1 hybrid plants to be male fertile, the male parent used in the hybrid cross must be homozygous for a gene, a restorer gene, that will neutralize the effect of the A9-PR-Glucanase gene. An example of such a restorer gene is an A9-promoter antisense PR-Glucanase gene. The use of the A9 promoter to drive the expression of the restorer gene is preferred, though any promoter having a suitable temporal and/or tissue expression pattern may be equally effective.
Since transformation of tobacco is more efficient than tomato, potential PR-Glucanase restorer genes were evaluated by retransformation of male sterile A9-PR Glucanase tobacco lines described in Worrall et al ((1992) supra). A full-length antisense PR-Glucanase gene was constructed as follows:—The PR-glucanase gene from pDW80PR was recloned as a XbaI, SstII fragment into XbaI, SstII-cut pBluescript SK-forming pWP158. The PR glucanase gene was then recovered from pWP158 as a EcoRI, SstII fragment and cloned between the SstII and EcoRI sites of pWP80 (see WO-A-92/11379) forming pWP162. The A9 driven PR-Glucanase antisense gene was recovered from pWP162 as a SstI, EcoRV fragment and cloned between the SstI and SmaI sites of the binary vector pGPTV-Hpt (Becker et al, Plant Molecular Biology, 20: 1195-1197 (199:2)), forming pWP162-Hpt. Of 51 tobacco PR-Glucanase plants transformed with pWP162-hpt 1 appeared to have increased callose levels and almost wild-type pollen production. This plant had 8 copies of the restorer gene.
Further antisense and partial sense PR-Glucanase constructs were constructed in an attempt to improve the frequency of restoration and to obtain plants that were restored to fertility by the presence of a single copy of the restorer gene. Thus the following primers were designed in order to obtain by PCR different fragments of the PR-Glucanase gene:—
(SEQ ID NO. 4)
N-term
5′ TCTAGACCATGGCTGCTATCACACTCCTAGG 3′
(1-31 bp in FIG. 5)
(SEQ ID NO. 5)
5′ GGAACATGCAAGATGGTGGG 3′
PR1 (275-294 bp)
(SEQ ID NO. 6)
5′ CCCTGTGATGGTGGATAAGAGC 3′
PRT2 (520-499 bp)
(SEQ ID NO. 7)
5′ GGCAGCATACACAGAATCCAGC 3′
PR3 (749-728 bp)
(SEQ ID NO. 8)
5′ CCGCGGTCACCCAAAGTTGATATTATATTTGA 3′
(1028-997 bp)
Five PCR products were generated and cloned into the vector PGEM-T (Promega), forming plasmids pJSH1 to pJSH5. The PR-glucanase fragments were then cloned in the sense or antisense orientation behind the A9 promoter as outlined in
The antisense and partial sense constructs were then used to transform a male-sterile tobacco PR-Glucanase line, and the level of PR-Glucanase expression in anthers assessed using an antibody raised against a tomato acidic β-1,3-Glucanase gene. Results shown in
The most effective A9-antisense restorer gene identified, that from pJSH1A, was transferred into a modified version of the binary vector pGA492 for use in tomato transformation. This binary vector, pBIOS222, is designed so that the selectable marker gene (pnos-nptII) can be removed after transformation. The pnos-nptII gene is cloned as a Ds element into pGA492 so that when crossed into a plant expressing Ac transposase, a proportion of the progeny lack the Ds::pnos nptII element but retain the restorer gene. The Ac transposase tomato line is constructed by transformation of tomatoes with pBIOS144 (
Tomato plants were transformed with pBIOS244 and then crossed to tomato plants expressing Ac transposase. These plants were crossed to wild-type. Progeny of this cross, containing the A9-antisense PR Glucanase gene but lacking the Ds::nptII element and transposase, were bred to homozygosity and crossed to male sterile A9-PR Glucanase tomato plants. The hybrid progeny of this cross is 100% male fertile.
An effective A9 partial sense restorer gene from pJSH5S was transferred into the binary vector pBIOS222 for use in tomato transformation. The A9-partial sense PR Glucanase gene was excised from pJSH5S as an XhoI, BglII fragment and cloned between the XhoI and BglII sites of pBIOS222 forming pBIOS222/5S (
Tomato plants were transformed with pBIOS222/5S and then crossed to BIOS144 tomato plants expressing Ac transposase. These plants were crossed to wild-type. Progeny of this cross, containing the A9-partial sense PR Glucanase gene but lacking the Ds::nptII element and transposase, were bred to homozygosity and crossed to male sterile A9-PR Glucanase tomato plants. The hybrid progeny of this cross is 100% male fertile.
A multimeric ribozyme (
Sequence analysis revealed a deletion of an adenosine residue at position 15 of the catalytic sequence of ribozyme 4, preventing the in vitro activity of this ribozyme unit (
The 198 bp multimeric ribozyme was cloned as a EcoRI (rendered blunt), BamHI fragment between the XbaI (rendered blunt), BamHI sites of p1415 (this is a derivative of pWP91 described in WO-A-92/11379), in which an 8 bp HindIII linker has been inserted into the EcoRV site). The resulting A9 promoter driven multimeric ribozyme gene was then cloned as a HindIII fragment into the HindIII site of the binary vector pGA-3-HyB forming p3039) (
p3039 was then transformed into a male sterile A9 PR-Glucanase tobacco line. The presence of PR-Glucanase protein in anthers was determined by Western blot analysis and the male fertility of transformants assessed. 5 plants of 38 transformants exhibited improved male fertility and lacked PR-Glucanase protein. Analysis of the progeny showed that plants containing both the A9-PR Glucanase gene and the A9-multimeric ribozyme gene lacked PR-Glucanase protein (
The A9-multimeric ribozyme gene of p3039 was excised as a HindIII fragment and cloned into the HindIII site of pBIOS222 forming pBIOS246 (
Paul, Wyatt, Perez, Pascual, Scott, Roderick John
| Patent | Priority | Assignee | Title |
| Patent | Priority | Assignee | Title |
| 5847258, | Mar 08 1988 | Syngenta Investment Corporation | DNA encoding β-1,3-glucanases |
| 5955653, | Jul 23 1991 | Biogemma UK Limited | Callase-related DNAs and their use in artificial male sterility |
| 6077991, | Mar 28 1996 | Washington State University Research Foundation | Compositions and methods for production of male-sterile plants |
| EP116718, | |||
| EP198288, | |||
| EP270822, | |||
| EP329308, | |||
| EP344029, | |||
| EP392225, | |||
| EP412911, | |||
| WO9211379, | |||
| WO9302197, | |||
| WO9738116, |
| Executed on | Assignor | Assignee | Conveyance | Frame | Reel | Doc |
| Oct 09 1998 | Gene Shears Pty. Limited | (assignment on the face of the patent) | / | |||
| Nov 12 1998 | SCOTT, RODERICK JOHN | Gene Shears Pty Limited | ASSIGNMENT OF ASSIGNORS INTEREST SEE DOCUMENT FOR DETAILS | 014785 | /0580 | |
| Dec 22 1998 | PAUL, WYATT | Gene Shears Pty Limited | ASSIGNMENT OF ASSIGNORS INTEREST SEE DOCUMENT FOR DETAILS | 014785 | /0580 | |
| Jan 04 1999 | PEREZ, PASCUAL | Gene Shears Pty Limited | ASSIGNMENT OF ASSIGNORS INTEREST SEE DOCUMENT FOR DETAILS | 014785 | /0580 |
| Date | Maintenance Fee Events |
| Oct 31 2011 | REM: Maintenance Fee Reminder Mailed. |
| Mar 18 2012 | EXP: Patent Expired for Failure to Pay Maintenance Fees. |
| Date | Maintenance Schedule |
| Mar 18 2011 | 4 years fee payment window open |
| Sep 18 2011 | 6 months grace period start (w surcharge) |
| Mar 18 2012 | patent expiry (for year 4) |
| Mar 18 2014 | 2 years to revive unintentionally abandoned end. (for year 4) |
| Mar 18 2015 | 8 years fee payment window open |
| Sep 18 2015 | 6 months grace period start (w surcharge) |
| Mar 18 2016 | patent expiry (for year 8) |
| Mar 18 2018 | 2 years to revive unintentionally abandoned end. (for year 8) |
| Mar 18 2019 | 12 years fee payment window open |
| Sep 18 2019 | 6 months grace period start (w surcharge) |
| Mar 18 2020 | patent expiry (for year 12) |
| Mar 18 2022 | 2 years to revive unintentionally abandoned end. (for year 12) |