The present invention provides methods of producing l-lysine at a high yield using an escherichia bacterium, especially E. coli, comprising a wild type or variant dapA gene of b. subtilis. The invention also provides related recombinant escherichia bacteria, especially E. coli, for use to produce l-lysine.
|
1. A recombinant dna autonomously replicable in an escherichia coli bacterium, wherein the recombinant dna comprises a variant b. subtilis dapA gene comprising a nucleic acid sequence at least 90% identical to bases 5665-6537 of SEQ ID NO: 1 which comprises at least one mutation within bases 5665-6537 of SEQ ID NO: 1.
5. An escherichia coli bacterium comprising a variant b. subtilis dapA gene comprising a nucleic acid sequence at least 90% identical to bases 5665-6537 of SEQ ID NO: 1 which comprises at least one mutation within bases 5665-6537 of SEQ ID NO: 1, wherein the bacterium produces an increased amount of l-lysine as compared to a wild-type escherichia coli bacterium.
11. A method for producing an increased amount of l-lysine as compared to a wild-type escherichia coli bacterium comprising growing an escherichia coli bacterium comprising a variant b. subtilis dapA gene comprising a nucleic acid sequence at least 90% identical to bases 5665-6537 of SEQ ID NO: 1 which comprises at least one mutation within bases 5665-6537 of SEQ ID NO: 1, in a cultivation medium, and collecting l-lysine from the cultivation medium.
2. The recombinant dna of
3. The recombinant dna of
4. The recombinant dna of
6. The bacterium of
7. The bacterium of
8. The bacterium of
9. The bacterium of
10. The bacterium of
12. The method of
13. The method of
|
|||||||||||||||||||||||||||||||||||||||||||||||||
The present application claims priority to U.S. Provisional Application Ser. No. 61/033,099, filed Mar. 3, 2008, the entirety of the disclosure of which is explicitly incorporated by reference herein.
The specification further incorporates by reference the Sequence Listing submitted herewith. Pursuant to 37 C.F.R. §1.52(e)(5), the Sequence Listing text file, identified as 0786680106seqlist.txt, is 15,349 bytes and was created on Feb. 26, 2009.
The present invention pertains to the field of biotechnology. In particular, the invention provides methods for producing L-lysine by growing a transformed Escherichia bacterium, especially E. coli, which comprises a wild type or variant Bacillus subtilis dapA gene.
L-lysine is an essential amino acid that is not synthesized in animals. Many wild type and mutant bacterial strains have been found to produce L-lysine. Being widely used as a feed additive, medicament, chemical agent and food ingredient, L-lysine has been produced by large-scale fermentation using mainly a Coryneform bacterium or an Escherichia bacterium.
In most bacteria, L-lysine is naturally synthesized from aspartate in a nine-step enzymatic pathway, including two steps shared by the biosynthesis pathways of methionine and threonine (Anastassiadis, S., Recent patents on Biotechnology 2007, 1(1):11-24; Chen, N. et al., J. Biol. Chem. 1993, 268(13):9448-66). The regulatory mechanism of lysine biosynthesis is complex and varies widely in different bacterial species (Chen, N. et al., J. Biol. Chem. 1993, 268(13):9448-66). For example, dihydrodipicolinate synthase (“DDPS”), an enzyme that catalyzes the first step into the lysine biosynthesis branch, suffers feedback inhibition by L-lysine in Gram-negative bacteria (e.g., E. coli, Bacillus sphaericus and Methanobacterium thermoautotrophicum), but not in Gram-positive bacteria (e.g., Bacillus licheniformis, Bacillus megaterium, Bacillus subtilis, Corynebacterium glutamicum, Bacillus cereus, and Bacillus lactofermentum) (Dobson, R. et al., Acta Cryst. 2005, D61:1116-24). Further, the regulation of the lysine biosynthesis pathway in Bacillus subtilis (“B. subtilis”) is unique because it involves a dual control by lysine and one of its precursors, diaminopimelate (Chen, N. et al., J. Biol. Chem. 1993, 268(13):9448-66).
Consistent with the diverse sensitivity to feedback inhibition of DDPS by L-lysine, limited homology in the DDPS protein sequence and in its corresponding gene, dapA, is observed among bacterial strains from different genera. DDPS in B. subtilis has an amino acid sequence about 43% and 40% identical to those in E. coli and Corynebacterium Glutamicum (“C. Glutamicum”), respectively (Chen, N. et al., J. Biol. Chem. 1993, 268(13):9448-66). Even in the same bacterial genus, different bacterial strains exhibit only modest homology. For example, the dapA gene in Bacillus methanolicus (“B. methanolicus”) is about 65% identical in nucleotide or amino acid sequence to a previously known dapA gene in B. subtilis (U.S. Pat. No. 6,878,533).
One way to improve L-lysine production by an Escherichia bacterium is to overcome the feedback inhibition of DDPS by L-lysine. Mutations have been made in the wild type dapA gene of an Escherichia bacterium to desensitize DDPS to L-lysine (U.S. Pat. No. 6,040,160). Attempts have also been made to introduce a wild type dapA gene of a non-Escherichia bacterium, in which the corresponding DDPS does not suffer feedback inhibition by L-lysine, into an Escherichia bacterium, but have failed to produce consistent and satisfactory results.
A Korean group reported that an introduction of a wild type dapA gene from a lysine overproducing C. glutamicum strain into a lysine producing mutant E. coli strain (TF1) led to a parallel increase of a lysine-sensitive DDPS activity and lysine production (Oh, J. et al., Biotech. Ltrs. 1991, 13(10):727-32; Korean Pat. Pub. No. 10-1992-0008382). However, expression of the same wild type dapA gene in two other E. coli strains (TF13 and TF23) failed to result in a high yield of lysine production. The fact that the regulatory mechanism involved in lysine biosynthesis is more complex in E. coli than in Coryneform bacteria was cited for the inconsistent results.
Expression of a foreign dapA gene is challenging because the corresponding foreign DDPS protein is likely subject to decomposition by protease and formation of an insoluble inclusion body in an Escherichia bacterium (U.S. Pat. No. 6,040,160). In addition, a DDPS of C. glutamicum (Oh, J. et al., Biotech. Ltrs., 1991, 13(10):727-32; Korean Pat. Pub. No. 10-1992-0008382) or B. methanolicus (U.S. Pat. No. 6,878,533) is not expected to exhibit its advantageous activity, i.e., a lysine-insensitive DDPS activity that leads to a high yield of lysine production, in E. coli partly because the optimal cultivation temperature for C. Glutamicum or B. methanolicus deviates from that for E. coli by about ten or more degrees.
An extremely complicated regulation of lysine synthesis was observed in E. coli cells, in which genes involved in lysine biosynthesis in B. subtilis were expressed (Shevchenko, T. N. et al., Tsitol Genet. 1984, 18(1):58-60). In particular, the expression of these foreign genes, including a foreign dapA gene, in E. coli cells failed to increase lysine production to a high and satisfactory level. It was suggested that a considerable increase in lysine biosynthesis be achieved by using an E. coli or B. subtilis strain having mutations in its natural genes involved in lysine biosynthesis to desensitize feedback inhibition by lysine and diaminopimelate.
At present, there has not been any effective method for producing L-lysine using an Escherichia bacterium comprising a wild type or variant B. subtilis dapA gene. As the demand of L-lysine, especially for animal feed, continuously increases along with the global population expansion, there is a need to develop novel and effective methods for improving L-lysine production using an Escherichia bacterial strain.
In accordance of the present invention, an introduction of a wild type or variant dapA gene of B. subtilis into an Escherichia bacterium improves L-lysine production by the Escherichia bacterium to industrial levels. Further, the transformed Escherichia bacterium may be used to produce L-lysine in a cultivation medium at a high yield (e.g., at least 25, 50, 75, 100, 125 or 150 grams per liter).
The present invention provides a recombinant DNA autonomously replicable in an Escherichia bacterium and comprising a wild type or variant dapA gene of B. subtilis. A variant B. subtilis dapA gene has a non-identical but substantially (e.g., 90%, 95%, or 99%) identical sequence to that of a wild type B. subtilis dapA gene. The recombinant DNA may be used to introduce a B. subtilis dapA gene into an Escherichia bacterium to increase L-lysine production.
The B. subtilis dapA gene may have a nucleic acid sequence identical or substantially (e.g., 90%, 95%, or 99%) identical to that of a B. subtilis dapA gene as set forth in GenBank Accession No. L08471 (bases 5665-6537 of SEQ ID NO: 1) and Chen, N. et al., J. Biol. Chem. 1993, 268(13):9448-66). A variant B. subtilis dapA gene may comprise one or more nucleotide modifications in SEQ ID NO: 1. In one specific non-limiting embodiment, a variant B. subtilis dapA gene comprises two mutations from C to T at nucleotide residue 6019 and from T to C at nucleotide residue 6024 of SEQ ID NO: 1.
Further, the B. subtilis dapA gene may encode a protein having an amino acid sequence identical or substantially (e.g., 90%, 95%, or 99%) identical to the deduced amino acid sequence of the B. subtilis dapA gene as set forth in GenBank Accession No. L08471 (SEQ ID NO: 2) and Chen, N. et al., J. Biol. Chem. 1993, 268(13):9448-66). The protein may have an amino acid sequence comprising one or more amino acid modifications in SEQ ID NO: 2. In one specific non-limiting embodiment, a variant B. subtilis dapA gene encodes a protein having an amino acid sequence comprising a mutation from histidine to tyrosine at amino acid residue 119 of SEQ ID NO: 2 (“H119Y variant”). The B. subtilis dapA gene may encode a protein having a DDPS activity.
The present invention also provides an Escherichia bacterium comprising a wild type or variant B. subtilis dapA gene for producing L-lysine in a cultivation medium. The Escherichia bacterium may produce L-lysine at least 50 grams per liter in the cultivation medium. In one specific non-limiting embodiment, an Escherichia bacterium comprising a wild type B. subtilis dapA gene is provided for producing L-lysine. In another specific non-limiting embodiment, an Escherichia bacterium comprising a H119Y variant B. subtilis dapA gene is provided for producing L-lysine.
The present invention further provides methods for producing L-lysine by growing an Escherichia bacterium in a cultivation medium and collecting L-lysine from the cultivation medium, wherein the bacterium comprises a wild type or variant B. subtilis dapA gene. L-lysine is allowed to accumulate before being harvested or collected from the cultivation medium. L-lysine may be collected from the cultivation medium when L-lysine reaches at least 25, 50, 75, 100, 125 or 150 grams per liter, preferably at least 50 grams per liter. In one specific non-limiting embodiment, an Escherichia bacterium comprising a wild type B. subtilis dapA gene is grown in a cultivation medium, and L-lysine is collected from the cultivation medium. In another specific non-limiting embodiment, an Escherichia bacterium comprising a H119Y variant B. subtilis dapA gene is grown in a cultivation medium, and L-lysine is collected from the cultivation medium.
The present invention advantageously provides methods, transformed bacteria belonging to the genus of Escherichia and recombinant DNAs for producing L-lysine by fermentation. It has now been discovered that L-lysine can be produced at a high yield by an Escherichia bacterium comprising a wild type or variant dapA gene of B. subtilis.
For clarity of description, and not by way of limitation, the invention is explained in details in the following subsections:
(1) a recombinant DNA;
(2) a transformed Escherichia bacterium; and
(3) a method for producing L-lysine.
(1) A Recombinant DNA
The recombinant DNA of the present invention carries a wild type or variant dapA gene of a B. subtilis strain, and replicates autonomously in an Escherichia bacterial strain. It may be obtained by inserting a DNA fragment comprising the B. subtilis dapA gene into an expression vector replicable in an Escherichia bacterial strain.
In the B. subtilis strain, the dapA gene is expressed and the corresponding DDPS does not suffer substantial (e.g., 10%, 20%, 30%, 40%, 50%, 60%, or more) feedback inhibition by L-lysine. The B. subtilis strain may or may not be a L-lysine producer. A preferred B. subtilis strain is W168, which is not a lysine producer. This strain is available from Bacillus Genetic Stock Center, Ohio State University, U.S.A.
A DNA fragment comprising a wild type B. subtilis dapA gene (“BsdapA gene”) can be obtained from the chromosomal DNA of a wild type B. subtilis strain. The chromosomal DNA can be prepared from a B. subtilis strain using standard techniques known in the art. The DNA fragment can be obtained by amplifying the wild type B. subtilis dapA gene from the chromosomal DNA using a polymerase chain reaction method (PCR). Suitable PCR primers can be prepared based on the previously published dapA gene sequence in B. subtilis or other bacterial strains (e.g., E. coli and C. glutamicum) (Chen, N. et al., J. Biol. Chem. 1993, 268(13):9448-66). For example, a pair of single-stranded 21-mer primers, DapA-F (SEQ ID NO: 3) and DapA-R (SEQ ID NO: 4), may be used.
The nucleic acid sequences of SEQ ID NOS: 3 and 4 are shown below:
SEQ ID NO: 3
(DapA-F)
CGGCGATCGTTTCTGTTGGCA
SEQ ID NO: 4
(DapA-R)
ATCTGGGCCATATCACGCGCT
A DNA fragment comprising a variant B. subtilis dapA gene can be similarly obtained from the chromosomal DNA of a B. subtilis strain mutated in vivo. A variant B. subtilis dapA gene can also be obtained by introducing modifications into the wild type B. subtilis dapA gene in vitro by standard techniques known in the art, such as site-directed mutagenesis and PCR-mediated mutagenesis.
The sequence of the resulting DNA fragment can be determined by a commonly known method using suitable primers (e.g., DapA-F and DapA-R).
The B. subtilis dapA gene may have a nucleic acid sequence identical or substantially (e.g., 90%, 95%, or 99%) identical to that of the B. subtilis dapA gene as set forth in GenBank Accession No. L08471 (bases 5665-6537 of SEQ ID NO: 1) and Chen, N. et al., J. Biol. Chem. 1993, 268(13):9448-66). A wild type B. subtilis dapA gene may have a nucleic acid sequence identical to SEQ ID NO: 1. A variant B. subtilis dapA gene may comprise one or more nucleotide modifications in SEQ ID NO: 1. For example, a variant B. subtilis dapA gene may comprise two mutations from C to T at nucleotide residue 6019 and from T to C at nucleotide residue 6024 of SEQ ID NO: 1. The sequence percentage identity may be determined by standard software such as BLAST or FASTA.
Further, the B. subtilis dapA gene may encode a protein having an amino acid sequence identical or substantially (e.g., 90%, 95%, or 99%) identical to the deduced amino acid sequence of the B. subtilis dapA gene as set forth in GenBank Accession No. L08471 (SEQ ID NO: 2) and Chen, N. et al., J. Biol. Chem. 1993, 268(13):9448-66). A wild type B. subtilis dapA gene may encode a protein having an amino acid sequence identical to SEQ ID NO: 2. A B. subtilis dapA gene may also encode a protein having an amino acid sequence comprising one or more amino acid modifications in SEQ ID NO: 2. For example, a variant B. subtilis dapA gene may encode a protein having an amino acid sequence comprising a mutation from histidine to tyrosine at amino acid residue 119 of SEQ ID NO: 2 (“H119Y variant”).
The amino acid modifications include amino acid substitutions, additions and deletions. Modifications can be introduced by standard techniques known in the art, such as site-directed mutagenesis and PCR-mediated mutagenesis. Amino acid substitutions may include those in which the amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, tryptophan), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine).
The amino acid substitutions may also include those that correlate with the amino acid substitutions in the wild type dapA gene of an Escherichia bacterium known to desensitize the corresponding DDPS to L-lysine.
The DNA fragment comprising a wild type or variant dapA gene of B. subtilis can be subsequently ligated with a suitable expression vector to produce a recombinant DNA comprising the dapA gene. A suitable DNA expression vector replicates autonomously in an Escherichia bacterial strain, and comprises a selectable genetic marker. A selectable genetic marker can detect resistance to an antibiotic (e.g., ampicillin, tetracycline, kanamycin and neomycin), a color change or any other characteristics that can distinguish transformed hosts from untransformed hosts. Examples of suitable vectors include an E. coli expression vector such as pTrc99A, pUC19, pUC18, pBR322, pHSG299, pHSG399, pHSG398, RSF1010, pMW119, pMW118, pMW219, pMW218 and pSTV28. It is preferable that the DNA fragment is inserted into a DNA expression vector in a way such that the dapA gene is under the control of a strong promoter of E. coli. Examples of suitable promoters include trc, tac, lac and T7, preferably trc.
The B. subtilis dapA gene may encode a protein having a DDPS activity. The presence of a recombinant DNA comprising a B. subtilis dapA gene may be confirmed by an elevated level of DDPS activity in a bacterial strain transformed with the recombinant DNA or recovery of auxotrophy in a DDPS deficient bacterial strain (e.g., E. coli JE7627 strain) transformed with the recombinant DNA.
(2) A Transformed Escherichia Bacterium
An Escherichia bacterium may be transformed with a recombinant DNA comprising a wild type or variant dapA gene of B. subtilis using standard techniques known in the art. The parent (untransformed) Escherichia bacterium may carry a wild type or mutant natural dapA gene, and express a corresponding wild type or mutant natural DDPS. The enzymatic activity of the natural DDPS may suffer feedback inhibition by L-lysine. The parent Escherichia bacterium may be a L-lysine producer. The activity of another natural enzyme involved in lysine biosynthesis may be enhanced. For example, an E. coli strain comprising a DNA coding for a natural aspartokinase III having a mutation to desensitize feedback inhibition by L-lysine (U.S. Pat. No. 6,040,160) can be used. It is preferred that the Escherichia bacterial strain is E. coli. It is further preferred that the Escherichia bacterium is an E. coli strain that is commonly used for industrial production of L-lysine.
After transformation, the Escherichia bacterium harbors a wild type or variant dapA gene of B. subtilis. The presence of a B. subtilis dapA gene in the transformed bacterium can be determined by standard techniques known in the art. The B. subtilis dapA gene can be carried on a plasmid. It may also be integrated into a chromosome of the transformed Escherichia bacterium. The transformed Escherichia bacterium produces L-lysine at a high yield (e.g., at least 25, 50, 75, 100, 125 or 150 grams per liter).
In one embodiment, an E. coli strain B-3996 (available at Research Institute for Genetics and Industrial Microorganism Breeding under Reg. No. RIA 1867) is transformed with a recombinant DNA comprising a wild type dapA gene (e.g., pTrc99A-BsdapA) after kicking out the sole plasmid pVIC40 (U.S. Pat. No. 6,040,160) to make a transformed bacterial strain B-399/pTrc99A-BsdapA. A control strain B-399/pTrc99A is similarly prepared by transformation with a corresponding recombinant DNA without BsdapA (e.g., pTrc99A). The cultivation medium is prepared by mixing a sterilized solution (containing 16 g/L (NH4)2SO4, 1 g/L KH2PO4, 1 g/L MgSO4.7H2O, 0.01 g/L FeSO4.7H2O, 0.01 g/L MnSO4.5H2O, 2 g/L yeast extract (Difco), 0.5 g/L L-methionine, 0.1 g/L L-threonine, and 0.05 g/L L-isoleucine at pH 7.0) with sterilized 20% glucose at a ratio of 4 to 1. Glucose can be feeded to improve L-lysine production. Sterilized pharmacopoeial CaCO3 is subsequently added to the mixture and dissolved to a final concentration of 30 g/L. Appropriate antibiotics (e.g., 15 μg/ml tetracycline, and 5 kanamycin) can also be added. Both strains are cultivated at an agitation of 114-116 rpm and at 37° C. for 48 hours. L-lysine is harvested and analyzed from the culture medium. It is expected that bacterial strain B-399/pTrc99A-BsdapA will produce L-lysine of at least 10 grams per liter, which will be significantly more than the control strain B-399/pTrc99A.
In another embodiment, an E. coli bacterial strain DC037 from Global Bio-Chem Technology Group Company Limited was used to prepare a recombinant E. coli comprising a wild type dapA gene of B. subtilis (DC051), a recombinant E. coli comprising a H119Y variant dapA gene of B. subtilis (DC231), and a recombinant E. coli control (DC073), which produced L-lysine at 150, 180 and 20 grams per liter, respectively. The preparation and testing of these recombinant E. coli strains are described in Examples 3 and 4.
Bacteria of strains DC051 and DC231 were deposited on Feb. 26, 2009 with the China General Microbiological Culture Collection Center (CGMCC), Institute of Microbiology, Chinese Academy of Sciences, Beijing 100080, PR China, under the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure, and were given accession numbers of CGMCC No. 2923 and CGMCC No. 2924, respectively.
The DDPS activity in the transformed Escherichia bacterium may not suffer substantial (e.g., 10%, 20%, 30%, 40%, 50%, 60%, or more) feedback inhibition by L-lysine. The DDPS activity of the transformed Escherichia bacterium may be reduced no more than 50% in the presence of 10 mM L-lysine.
The DDPS activity in a bacterium can be measured in accordance with the method described by Yugari, Y. and Gilvarg C. in J. Biol. Chem., 1965, 240(12):4710-16, or any other suitable method. For example, a bacterial extract is added to a reaction solution containing 50 mM imidazole-HCl (pH 7.4), 20 mM L-aspartic semialdehyde and 20 mM sodium pyruvate, and incubated at 37° C. for 10 minutes. A reaction solution without sodium pyruvate can be used as a blank. The DDPS activity is measured by the amount of dihydrodipicolinate generated by the reaction, which is detected by a spectrophotometer at a wavelength of 270 nm. Various amounts of L-lysine are added to the reaction mixture to evaluate lysine sensitivity of the DDPS activity.
(3) A Method for Producing L-lysine
L-lysine can be produced by growing an Escherichia bacterium comprising a wild type or variant B. subtilis dapA gene in a cultivation medium. A medium suitable for optimal growth of an Escherichia bacterium is desirable (Anastassiadis, S., Recent Patents On Biotechnology 2007, 1(1):11-24). An antibiotic (e.g., ampicillin) is desirable in the medium to keep selectivity and stability of the transformed Escherichia bacterium.
For example, the cultivation medium is prepared by mixing a sterilized solution (containing 16 g/L (NH4)2SO4, 1 g/L KH2PO4, 1 g/L MgSO4.7H2O, 0.01 g/L FeSO4.7H2O, 0.01 g/L MnSO4.5H2O, 2 g/L yeast extract (Difco), 0.5 g/L L-methionine, 0.1 g/L L-threonine, and 0.05 g/L L-isoleucine at pH 7.0) with sterilized 20% glucose at a ratio of 4 to 1. Glucose can be feeded to improve L-lysine production. Sterilized pharmacopoeial CaCO3 is subsequently added to the mixture and dissolved to a final concentration of 30 g/L. Appropriate antibiotics (e.g., 15 μg/ml tetracycline, and 5 μg/ml kanamycin) can also be added.
The cultivation conditions optimal for an Escherichia bacterium are desirable (Anastassiadis, S., Recent Patents On Biotechnology 2007, 1(1):11-24). Cultivation is preferably carried out under an aerobic condition at a temperature between 25° C. and 45° C. and a pH between 5 and 8. The concentration of L-lysine reaches a maximum after cultivation for about 2 to 10 days. The bacterial growth can be monitored based on cell density of the culture medium measured by a spectrophotometer.
L-lysine is allowed to accumulate in the cultivation medium of a transformed Escherichia bacterium cultivated according to the present invention. L-lysine can be harvested by various methods (e.g., ion-exchange chromatographic methods) to produce L-lysine-HCl before or after cell separation by centrifugation and filtration of the cultivation medium; or L-lysine broth can be harvested to produce L-lysine sulphate by a pelletizing process (Anastassiadis, S., Recent Patents On Biotechnology 2007, 1(1):11-24; Chinese Pat. No. 200410050017.4). L-lysine may be harvested or collected from the cultivation medium when L-lysine reaches at least 5 to 10 grams per liter, or at least 25, 50, 75, 100, 125 or 150 grams per liter in a large-scale fermentation process, preferably at least 50 grams per liter. The amount of L-lysine can be determined by various analytical methods known in the art (e.g., HPLC).
The invention now being generally described, it will be more readily understood by reference to the following examples, which are included merely for purposes of illustration of certain aspects and embodiments of the present invention, and are not intended to limit the invention.
Plasmid pTrc99A-BsdapA was constructed to comprise a wild type B. subtilis dapA gene. The chromosomal DNA was prepared from a wild type B. subtilis strain W168 (Bacillus Genetic Stock Center, Ohio State University, U.S.A.) using a commonly known method. A DNA fragment of 0.88 kb was obtained by amplifying the wild type dapA gene in the chromosomal DNA using a pair of primers, DapA-F (SEQ ID NO: 3) and DapA-R (SEQ ID NO: 4), having nucleic acid sequences shown in SEQ ID NOS: 3 and 4, respectively. The DNA fragment was recovered, digested with restriction enzymes EcoRI and HindIII, and ligated with a pTrc99A plasmid previously digested with the same restriction enzymes to produce a pTrc99A-BsdapA plasmid. Plasmid pTrc99A-BsdapA comprised a nucleic acid sequence of SEQ ID NO: 1. The nucleic acid sequence encodes a protein having an amino acid sequence of SEQ ID NO: 2.
Plasmid pTrc99A-BsdapAH119Y was constructed to comprise a H119Y variant B. subtilis dapA gene. The mutation was introduced by using the pTrc99A-BsdapA plasmid as a PCR template and amplifying with a pair of primers bsdapa119muts (SEQ ID NO: 5) and bsdapa119mutas (SEQ ID NO: 6). The nucleic acid sequence of SEQ ID NOS: 5 and 6 are shown below:
SEQ ID NO: 5
(bsdapa119muts)
TCAAGAAGGAATGTACCAG
ATTT
AAA
GCAATTGCGGCAGAGAC
SEQ ID NO: 6
(bsdapa119mutas)
GTCTCTGCCGCAATTGCTTT
AAAT
CTG
GTACATTCCTTCTTGA
The mutation sites on the primers are indicated by bold and italic characters.
E. coli DH5α competent cell was transformed with a aliquot of PCR product digested by DpnI. The plasmid was extracted from transformants and digested with restriction enzyme DraI to identify the desirable mutant plasmid pTrc99A-BsdapAH119Y, which comprised a nucleic acid sequence comprising two mutations from C to T at nucleotide residue 6019 and from T to C at nucleotide residue 6024 of SEQ ID NO: 1. The nucleic acid sequence encodes a protein having an amino acid sequence comprising a mutation from histidine to tyrosine at amino acid residue 119 of SEQ ID NO: 2.
A recombinant E. coli comprising a wild type B. subtilis dapA gene (DC051) was prepared from an E. coli bacterial strain DC037, which was received from Global Bio-Chem Technology Group Company Limited. DC037 carried two different plasmids, each containing a mutant dapA gene of E. coli and a tetracycline or kanamycin resistance gene. These two plasmids were knocked out and replaced with plasmids pDCtetBSdapA and pDCkanBSdapA, each containing a BsdapA gene and an tetracycline or kanamycin resistance gene as set forth blow.
Plasmid pDCtetBSdapA containing a BsdapA gene and a tetracycline resistance gene was constructed. BsdapA was obtained from pTrc99A-BsdapA by using a pair of primers, ptrcBSdapA1-F and ptrcBSdapA1-R having nucleic acid sequences as shown below in SEQ ID NOS: 7 and 8, respectively. A DNA fragment of 1.6 kb was recovered, and digested with restriction enzymes TthlllI and SpeI, and ligated with plasmid pDCtetdapA, which was previously digested with the same restriction enzymes, to prepare plasmid pDCtetBSdapA.
Plasmid pDCkanBSdapA containing a BsdapA gene and a kanamycin resistance gene was constructed. BsdapA was obtained from pTrc99A-BsdapA by using a pair of primers, ptrcBSdapA2-F and ptrcBSdapA2-R, having nucleic acid sequences as shown below in SEQ ID NOS: 9 and 10, respectively. A DNA fragment of 1.6 kb was recovered, and digested with restriction enzymes NotI and PshAI, and ligated with plasmid pDCkandapA, which was previously digested with the same restriction enzymes, to prepare plasmid pDCkanBSdapA.
DC045 was prepared from DC037. DC037 was treated with 800 μg/ml EB for 24 hours, subsequently screened by 5 μg/ml tetracycline and 50 μg/ml kanamycin, respectively, to prepare DC039, in which pDCkandapA was eliminated and pDCtetdapA remained.
A 2.8 kb fragment was obtained by amplifying E. coli W3110 with a pair of primers, LDCup and f1DN, having nucleic acid sequences as shown below in SEQ ID NOS: 11 and 12, respectively. This fragment was subcloned into the pMD18simple T vector to obtain pMD18swtLDC.
A 1.5 kb apramycin resistance gene was obtained by amplifying pIJ773 with a pair of primers, FRT5 and HPA1FRT3, having nucleic acid sequences as shown below in SEQ ID NOS: 13 and 14, respectively. pMD18swtLDC was digested by HpaI as a vector and ligated with 1.5 kb apramycin resistance gene fragment to obtain pMD18swtLDC-apra. A 4.5 kb fragment was isolated by digesting pMD18swtLDC-apra with PvuII and used as the recombinant fragment to transform DC039(pIJ790) to obtain DC043, in which wild type LDC was replaced with the truncated LDC in the genome of DC039. DC045 containing wild type LDC and plasmid pDCtetdapA was obtained after elimination of the apramycin resistance gene from the genome of DC043 with the help of plasmid pCP20.
Then, pDCamBSdapA was constructed to repulse the plasmid pDCtetdapA in DC045.
Plasmid pIJ773 was extracted and digested with restriction enzymes EcoRI and ClaI. A 1.3 kb fragment was isolated. A 3.4 kb fragment was obtained by digesting pDCtetBSdapA with restriction enzyme PvuII and was subsequently ligated with plasmid pMD18simple, which was previously digested with the same restriction enzyme to construct pMD18s(BStet) pMD18s(BStet) was digested with restriction enzymes EcoRI and ClaI to obtain a 4.5 kb fragment to be used as a vector. The 1.3 kb fragment obtained from pIJ773 was ligated with the 4.5 kb vector fragment. Competent DH5α cells were transformed with the ligation mixture and grown on ampicillin/apramycin containing plates. Plasmid DNA was extracted from the transformed bacteria and digested with restriction enzyme PvuII, and a fragment of 3.5 kb was obtained as a long-arm recombinant fragment.
BW25113(pIJ790) transformed with pDCtetBSdapA was further transformed with the long-arm recombinant fragment. The recombinant plasmid pDCamBSdapA was extracted from the transformed bacteria, and used to transform DC045. Transformed DC045 contained two plasmids, pDCtetdapA and pDCamBSdapA. Due to repulsion of two replication origins, DC049-1 was obtained in which pDCtetdapA was removed and pDCamBSdapA remained. DC051 was obtained after transforming DC049-1 with pDCtetBSdapA and pDCkanBSdapA.
Bacteria of strain DC051 was deposited with the China General Microbiological Culture Collection Center (CGMCC) under the Budapest Treaty on Feb. 26, 2009, and given an accession number of CGMCC No. 2923.
DC073 having the expression vector pTrc99A was prepared similarly as a control. Unlike DC051, DC073 does not comprise pBsdapA.
The nucleic acid sequences of SEQ ID NOS: 7-14 are shown below:
SEQ ID NO: 7
(ptrcBSdapA1-F)
GGACACTGTCTAATGTGAGTTAGCGCG
SEQ ID NO: 8
(ptrcBSdapA1-R)
CACTAGTATTGAAGCATTTATCAGGGT
SEQ ID NO: 9
GCGGCCGCTGTGCAGGTC
SEQ ID NO: 10
GACCACTGTCAGGGTTATTGTCTCAT
SEQ ID NO: 11
(LDCup)
ATGAACATCATTGCCATTATGGG
SEQ ID NO: 12
(f1DN)
TTACTGCTCATACAGTTCCAACG
SEQ ID NO: 13
(FRT5)
ATTCCGGGGATCCGTCGACC
SEQ ID NO: 14
(HPA1FRT3)
AACAGCACGTTACTCGCCCGGAAGCCGC
TCTGGCAAGTTATGTAGGCTGGAGCTGC
TTC
DC051 and DC073 were grown in a cultivation medium with ampicillin at 37° C. for 3 days, and produced L-lysine in the medium at 150 and 20 grams per liter, respectively.
A recombinant E. coli comprising a H119Y variant dapA gene of B. subtilis (DC231) was prepared using the method described in Example 3 except that plasmid pTrc99A-BsdapAH119Y was used to replace plasmid pTrc99A-BsdapA. DC231 was obtained after transforming DC049-1 with pDCkanBSdapAH119Y and pDCtetBSdapAH119Y.
Bacteria of strain DC231 was deposited with the China General Microbiological Culture Collection Center (CGMCC) under the Budapest Treaty on Feb. 26, 2009, and given an accession number of CGMCC No. 2924.
DC231 was grown in a cultivation medium using the method described in Example 3. L-lysine was produced in the medium at 180 grams per liter.
All publications and patents mentioned herein are hereby incorporated by reference in their entirety as if each individual publication or patent were specifically and individually indicated to be incorporated by reference. In case of conflict, the present application, including any definitions herein, controls.
While specific embodiments of the subject invention have been discussed, the above specification is illustrative and not restrictive. Many variations of the invention will become apparent to those skilled in the art upon review of this specification and the claims below. The full scope of the invention should be determined by reference to the claims, along with their full scope of equivalents, and the specification, along with such variations.
Yang, Sheng, Huang, He, Wang, Dehui
| Patent | Priority | Assignee | Title |
| Patent | Priority | Assignee | Title |
| 4327118, | Aug 29 1979 | Rhone-Poulenc Industries | Process for the preparation of new lysine-containing solid compositions for addition to animal feed |
| 4346170, | Jul 23 1979 | Ajinomoto Company Incorporated | Method for producing L-lysine by fermentation |
| 5650304, | Aug 03 1990 | Ajinomoto Co., Inc. | Process for producing L-lysine by fermentation |
| 5827698, | Dec 09 1994 | Ajinomoto Co., Inc. | Lysine decarboxylase gene and method of producing l-lysine |
| 5932453, | Oct 15 1996 | AJINOMOTO CO , LTD | Process for producing L-amino acid through fermentation |
| 5989875, | Jun 13 1995 | Ajinomoto Co., Inc. | Method of process for producing L-lysine by fermentation |
| 6017555, | Dec 16 1997 | ARCHER DANIELS MIDLAND COMPANY | Process for making L-lysine feed supplement |
| 6040160, | Dec 08 1993 | Ajinomoto Co., Inc. | Method of producing L-lysine by fermentation |
| 6090597, | Jun 05 1996 | Ajinomoto Co., Inc. | Method of producing L-lysine |
| 6461852, | Aug 04 1999 | Ajinomoto Co., Inc. | Dihydrodipicolinate synthase from Bacillus methanolicus |
| 6841366, | Jun 25 1993 | DSM IP ASSETS B V | Biotin biosynthesis in bacillus subtilis |
| 6878533, | Aug 04 1999 | Ajinomoto Co., Inc. | Gene encoding dihydrodipicolinate synthase from Bacillus methanolicus and methods of making lysine wing said gene |
| 6984512, | Aug 02 1999 | Archer-Daniels-Midland Company | Bacterial strains, methods of preparing the same and use thereof in fermentation processes for L-lysine production |
| 7026463, | Dec 02 1999 | Genesis Research and Development Corporation Limited; VIALACTIA BIOSCIENCE NZ LIMITED | Polynucleotides and polypeptides, materials incorporating them and methods for using them |
| 7083942, | Mar 09 2002 | Evonik Degussa GmbH | Alleles of the aceA gene from coryneform bacteria |
| 7094584, | Jul 07 1999 | EVONIC OPERATIONS GMBH | L-Lysine-producing corynebacteria and process for the preparation of L-lysine |
| 7122369, | Aug 02 1999 | Archer-Daniels-Midland Company | Bacterial strains, methods of preparing the same and use thereof in fermentation processes for L-lysine production |
| 7135313, | Oct 16 2001 | Evonik Operations GmbH | Method for producing L-lysine or L-lysine containing feed additives with a cornebacteria containing a mutated lysC |
| 7211421, | Aug 04 1999 | Ajinomoto Co., Inc. | Gene encoding dihydrodipicolinate reductase from Bacillus methanolicus |
| 7256021, | Jul 18 2001 | Evonik Degussa GmbH | Enterobacteriaceae strains with an attenuated aspA gene for the fermentative production of amino acids |
| 20030049805, | |||
| 20030054506, | |||
| 20050214911, | |||
| 20050250937, | |||
| 20050260720, | |||
| 20060154344, | |||
| 20060154345, | |||
| CNL200410500174, | |||
| EP1621624, | |||
| KR1019920008382, |
| Executed on | Assignor | Assignee | Conveyance | Frame | Reel | Doc |
| Mar 02 2009 | Global Bio-Chem Technology Group Company Limited | (assignment on the face of the patent) | / | |||
| May 04 2009 | YANG, SHENG | Global Bio-Chem Technology Group Company Limited | ASSIGNMENT OF ASSIGNORS INTEREST SEE DOCUMENT FOR DETAILS | 022660 | /0797 | |
| May 04 2009 | HUANG, HE | Global Bio-Chem Technology Group Company Limited | ASSIGNMENT OF ASSIGNORS INTEREST SEE DOCUMENT FOR DETAILS | 022660 | /0797 | |
| May 08 2009 | WANG, DEHUI | Global Bio-Chem Technology Group Company Limited | ASSIGNMENT OF ASSIGNORS INTEREST SEE DOCUMENT FOR DETAILS | 022660 | /0797 | |
| Jul 06 2009 | YANG, SHENG | Global Bio-Chem Technology Group Company Limited | CORRECTIVE ASSIGNMENT TO CORRECT THE ASSIGNEE INFORMATION PREVIOUSLY RECORDED ON REEL 022660 FRAME 0797 ASSIGNOR S HEREBY CONFIRMS THE ASSIGNEE INFORMATION | 022955 | /0001 | |
| Jul 06 2009 | HUANG, HE | Global Bio-Chem Technology Group Company Limited | CORRECTIVE ASSIGNMENT TO CORRECT THE ASSIGNEE INFORMATION PREVIOUSLY RECORDED ON REEL 022660 FRAME 0797 ASSIGNOR S HEREBY CONFIRMS THE ASSIGNEE INFORMATION | 022955 | /0001 | |
| Jul 06 2009 | WANG, DEHUI | Global Bio-Chem Technology Group Company Limited | CORRECTIVE ASSIGNMENT TO CORRECT THE ASSIGNEE INFORMATION PREVIOUSLY RECORDED ON REEL 022660 FRAME 0797 ASSIGNOR S HEREBY CONFIRMS THE ASSIGNEE INFORMATION | 022955 | /0001 |
| Date | Maintenance Fee Events |
| Apr 29 2016 | REM: Maintenance Fee Reminder Mailed. |
| Sep 12 2016 | M1551: Payment of Maintenance Fee, 4th Year, Large Entity. |
| Sep 12 2016 | M1554: Surcharge for Late Payment, Large Entity. |
| Feb 14 2020 | M1552: Payment of Maintenance Fee, 8th Year, Large Entity. |
| Jan 12 2024 | M1553: Payment of Maintenance Fee, 12th Year, Large Entity. |
| Date | Maintenance Schedule |
| Sep 18 2015 | 4 years fee payment window open |
| Mar 18 2016 | 6 months grace period start (w surcharge) |
| Sep 18 2016 | patent expiry (for year 4) |
| Sep 18 2018 | 2 years to revive unintentionally abandoned end. (for year 4) |
| Sep 18 2019 | 8 years fee payment window open |
| Mar 18 2020 | 6 months grace period start (w surcharge) |
| Sep 18 2020 | patent expiry (for year 8) |
| Sep 18 2022 | 2 years to revive unintentionally abandoned end. (for year 8) |
| Sep 18 2023 | 12 years fee payment window open |
| Mar 18 2024 | 6 months grace period start (w surcharge) |
| Sep 18 2024 | patent expiry (for year 12) |
| Sep 18 2026 | 2 years to revive unintentionally abandoned end. (for year 12) |