Methods and compositions for treating a subject having age-related macular degeneration (amd), methods of assaying human macular degeneration (MD), and methods and kits for assaying potential therapeutic agents for treatment of human MD are provided herein.
|
1. A method for treating age-related macular degeneration (amd) in a subject, the method comprising administering a composition into an amd-affected eye in a subject by ocular injection, wherein said composition comprises a nucleic acid encoding a soluble CD59 protein operably linked to a promoter, wherein said administering results in expression and secretion of said soluble CD59 protein by cells of said amd-affected eye and said expression results in treatment of amd-affected tissues or cells in said amd-affected eye.
2. The method according to
3. The method according to
4. The method according to
7. The method according to
8. The method according to
9. The method according to
10. The method according to
11. The method according to
12. The method according to
13. The method according to
14. The method according to
15. The method according to
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
This application claims the benefit of International application PCT/US2009/000947 entitled, “A humanized model of membrane attack complex (MAC) formation on murine retina and compositions, kits and methods far treatment of macular degeneration” filed Feb. 13, 2009, which claims the benefit of U.S. provisional application Ser. Nos. 61/066,062 filed Feb. 15, 2008, 61/066,288 filed Feb. 19, 2008, and 61/070,650 filed Mar. 25, 2008 in the U.S. Patent and Trademark Office, all of which are hereby incorporated by reference herein in their entireties.
This invention was made with government support under EY014991 and EY013837 awarded by the National Institutes of Health. The government has certain rights in the invention.
Methods and compositions for treating a subject having age-related macular degeneration (AMD), methods of assaying human macular degeneration (MD), and methods and kits for assaying potential therapeutic agents for treatment of human MD are provided herein.
Age-related macular degeneration (AMD) is a disease associated with aging that gradually destroys sharp, central vision, and is the leading cause of blindness in the elderly (Klein et al. Opthalmology 114:253-262, 2007). The macula is a specific tissue located in the center of the retina, the light-sensitive tissue at the back of the eye that converts light or an image into electrical impulses.
AMD is classified as either wet or dry (Inana et al. U.S. Pat. No. 7,309,487). Wet AMD is characterized by growth of abnormal blood vessels behind the retina under the macula. These new blood vessels are fragile and often leak blood and fluid. The blood and fluid raise the macula from its normal place at the back of the eye, causing loss of central vision. Wet AMD is treated with laser surgery, photodynamic therapy, and injections into the eye. None of these treatments, however, cures wet AMD, rather the treatments slow progression of the disease. Dry AMD is characterized by slow breakdown of light-sensitive cells in the macula, gradually blurring central vision in the affected eye. Over time, less of the macula functions and central vision is gradually lost. There is no known form of treatment for advanced stage dry AMD, and vision loss is inevitable. A specific high-dose formulation of antioxidants and zinc has been shown to prevent intermediate stage AMD from progressing to advanced AMD.
There is a need for methods of assaying (i.e., prognosticating or diagnosing) human macular degeneration (MD), methods of assaying among chemical entities to identify potential therapeutic agents to treat AMD, and methods of treating a human subject having AMD.
An aspect of the invention herein provides a method for treating AMD in a subject, the method involving contacting retinal pigment epithelium (RPE) of the subject with a CD59 protein composition, in which the retina is treated for AMD.
In related embodiments of the method, contacting the RPE is delivering at least one composition selected from the group consisting of: a nucleic acid vector with a gene encoding CD59 protein; CD59 protein; or CD59 expressed directly from naked nucleic acid.
In related embodiments of any of the above methods, the vector is a viral vector or a plasmid; for example, the viral vector is derived from a genetically engineered genome of at least one virus selected from the group consisting of adenovirus, adeno-associated virus, a herpesvirus, and a lentivirus. For example, the lentivirus is a retrovirus.
In various embodiments of the method, delivery of protein or nucleic acid is by at least one injection route selected from the group consisting of intravenous, intra-ocular, intra-muscular, subcutaneous, and intraperitoneal. In an embodiment of the method, the macular degeneration is dry.
An aspect of the invention provides a method of assaying extent of human MD in a model cell system or a method in a model cell system of assaying a serum complement component for prognosis or diagnosis of macular degeneration (MD), the method including: exposing a first sample of cells to serum and measuring resulting lysis, and comparing extent of lysis to that in a second sample of control cells not so exposed to serum, such that the extent of lysis in the first sample compared to that in the second sample is a measure of complement-induced MD.
An aspect of the invention provides a method of assaying in a model cell system potential therapeutic agents for human MD, the method including: contacting a first sample of cells to serum and measuring resulting lysis, and contacting a second sample of otherwise identical control cells with serum and a source of human CD59 and measuring resulting lysis; and contacting at least a third sample of cells to a candidate therapeutic composition and otherwise identically to serum, such that the extent of lysis of the third sample compared to that in the first and second sample is a measure of protection by the candidate composition, thereby providing the method of assaying for potential therapeutic agents.
A related embodiment of the above methods further includes contacting cells or tissues with a recombinant vector having a gene capable of expressing CD59. Lysis is measured for example by propidium iodide uptake and cell sorting. In a related embodiment of the above methods, the cells are hepatocytes. In related embodiments the cells are of murine origin. In a related embodiment of the above methods, the source of CD59 is human. In a related embodiment of the above methods the serum is normal human serum. Alternatively, the serum is from a diseased subject, for example, the diseased subject has MD.
An aspect of the invention provides a method of diagnosing or prognosing presence or progression of macular degeneration, the method including determining extent of membrane attack complex (MAC) deposition on retina. In a related embodiment of the method, determining extent of MAC deposition is analyzing by immunohistochemistry with antibodies that are specific for human MAC.
An aspect of the invention provides a pharmaceutical composition for treating macular degeneration including CD59 protein or a source of expression of CD59 protein in vivo, in which the composition is formulated for ocular delivery, in a dose effective to treat macular degeneration. In various related embodiments of the composition, the CD59 protein or source of expression of CD59 protein is at least one selected from the group consisting of: a nucleic acid vector with a gene encoding CD59 protein; a viral vector with a gene encoding CD59 protein; and a CD59 protein.
In related embodiments of the composition, the composition formulated for ocular delivery is at least one selected from the group consisting of: injection, eye drop, and ointment. In a related embodiment of the composition, injection is at least one selected from the group consisting of: intra-ocular injection, subconjunctival injection, and subtenon injection. In a related embodiment, the composition further includes at least one drug selected from the group consisting of: anti-tumor, antiviral, antibacterial, anti-mycobacterial, anti-fungal, anti-proliferative and anti-apoptotic. In a related embodiment, the CD59 protein is expressed as a soluble protein. In a related embodiment, the CD59 protein has a deletion encoding a glycosyl phosphatidyl inositol (GPI) anchoring domain.
An aspect of the invention provides a kit for assaying MAC deposition on ocular tissue or cells and for screening agents that inhibit deposition, the kit includes anti-MAC antibody, a container, and instructions for use with normal human serum. In a related embodiment, the kit further includes anti-emmprin antibody and/or normal human serum. In another related embodiment, the kit further includes CD59 protein as a positive control and the CD59 protein is a soluble form or a membrane-bound form, the latter for example embedded in a liposome preparation. In other related embodiments of the kit, at least one of the antibody, the serum, and the CD59 protein is a lyophil.
An aspect of the invention provides a method in a model cell system of assaying a serum complement component for prognosis or diagnosis of macular degeneration (MD), the method including: contacting detectably labeled cells with serum from a subject and measuring amount of extracellular and/or intracellular detectable agent for contacted cells; and comparing extracellular and/or intracellular agent in the cells to that in detectably labeled control cells not exposed to the serum and otherwise identical, such that amount of extracellular and/or intracellular agent in the contacted cells is compared to that in the control cells, such that a greater amount of extracellular detectably labeled agent in cells contacted with serum compared to the control cells is an indication of prognosis or diagnosis of MD.
An aspect of the invention provides a method of assaying in a model cell system a potential therapeutic agent for efficacy in treatment of human macular degeneration (MD), the method including: contacting a first sample of detectably labeled cells with serum from a subject and measuring amount of extracellular and/or intracellular detectable agent, and contacting a second sample of otherwise identical detectably labeled control cells with serum and a source of human CD59 protein and measuring amount of extracellular and/or intracellular detectable agent; and contacting at least a third sample of detectably labeled cells to at least one candidate therapeutic composition and otherwise identically to serum and measuring amount of extracellular and/or intracellular detectable agent, such that the amount of extracellular and/or intracellular detectable agent of the third sample compared to that in the first sample and the second sample is a measure of protection by the candidate composition, such that a greater amount of extracellular detectably labeled agent is an indication of MD, thereby assaying for a potential therapeutic agent for efficacy in treatment of human MD.
In various embodiments of the above methods, the detectable agent is at least one composition selected from the group consisting of a recombinant vector having a gene capable of expressing a detectable protein, a fluorescent agent, a colorimetric agent, an enzymatic agent, and a radioactive agent. For example, the detectable protein is at least one fluorescent protein selected from the group consisting: green fluorescent protein, aequorin, cyan fluorescent protein, DsRed fluorescent protein, enhanced green fluorescent protein, and yellow fluorescent protein. In other embodiments, the detectable agent is not a protein, for example, the detectable agent is at least one fluorescent agent selected from the group consisting of: Indocyanine Green, Doxorubicin, Riboflavin, Chlorophyll, and Porphyrin. In other embodiments, the detectable protein is enzyme, for example, β-galactosidase or alkaline phosphatase.
In embodiments of the above methods, the cells are hepatocytes; exemplary cells are of murine origin. In embodiments of the above methods, the source of CD59 protein is human. In certain embodiments of the above methods, the serum is normal human serum. Alternatively, the serum is from a diseased subject. In general, the subject is in need of diagnosis or prognosis of MD. In other embodiments, the CD59 protein is soluble. In other embodiments the protein is membrane-bound.
These photomicrographs further show a small extent of MAC staining in some AdCAGCD59 pretreated cells after seven minutes of NHS treatment (
Data from
These photographs show that protection from MAC on the corneal endothelium of AdCAGCD59 pretreated corneas (
Analysis of polymorphisms in several complement regulatory proteins including Factor H have implicated over-active complement in the pathogenesis of AMD (Hageman et al. Proc Natl Acad Sci USA, 102:7227-7232, 2005; Klein et al. Science, 308:385-389, 2005; and Haines et al., Science, 308:419-421, 2005; Edwards et al., Science, 308:421-424, 2005). Immunohistochemical analysis of drusen, which are yellow deposits under the retina, and retinal pigment epithelium (RPE) from AMD patients indicated the presence of a variety of complement proteins including the membrane attack complex (MAC). However, cross-species differences between human and non-human complement systems have limited ability to, test the efficacy of human complement regulatory proteins in non-human systems in vivo.
Provided herein is a humanized murine model for measuring human MAC deposition in vitro and in vivo. Examples herein use this model to measure protection by human CD59 of murine RPE, the pigmented cell layer just outside the neurosensory retina that nourishes retinal visual cells, from attack by human MAC. Using this model, local expression of exogenously delivered human complement regulatory protein CD59 was found to protect the RPE from human MAC deposition in vivo. Such protection of the RPE by CD59 indicates that this protection can prevent or treat AMD. The humanized model of MAC deposition on murine retina allows for safe and rapid testing of human complement proteins in vivo.
The complement system, a component of the overall immune system of an organism, is a biochemical cascade that assists clearing of pathogens within an organism. The complement system includes a number of small proteins found circulating in blood, usually as inactive zymogens. Stimulated by one of several triggers, proteases in the system cleave specific proteins to release cytokines and initiate an amplifying cascade of further cleavages. Activation of this biochemical cascade results in activation of MAC, a function for killing pathogens.
The complement system is classified into a set of differently activated pathways: the classical complement pathway, the alternative complement pathway, and the mannose-binding lectin pathway. These pathways generate homologous variants of a protease, the C3-convertase. The classical complement pathway typically involves antibodies for activation (specific immune response), while the alternative and mannose-binding lectin pathways are activated by C3 hydrolysis or antigens without the presence of antibodies (non-specific immune response).
In these pathways, a C3-convertase cleaves and activates component C3, creating C3a and C3b and causing a cascade of further cleavage and activation events. One such activation event initiates component C5b. Activation of C5b initiates the membrane attack pathway, which results in formation of MAC, a cytolytic endproduct of the complement cascade that forms a transmembrane channel and causes osmotic lysis of target cells.
MAC is formed for example, on the surface of intruding pathogenic bacterial cells as a result of activation of the complement system. MAC is a complex of four complement system proteins (C5b, C6, C7, and C8) that bind to the outer surface of a plasma membrane of a target cell, and with a fifth protein (C9) that binds subsequently (Sims et al., U.S. Pat. No. 7,166,568). The complement proteins bind together in such a conformation that an external face of the proteins is hydrophobic and associates with the lipid bilayer of the membrane of the target cell, while an internal face is hydrophilic, allowing passage of water through the cell. The proteins form a ring through the membrane of the cell and the ring structure acts as a tunnel through the membrane, allowing free diffusion of molecules through the cell which disrupts the internal environment of the cell killing it quickly.
CD59 Protein
Data in Examples herein show that CD59 acts to inhibit MAC, preventing lysis of retina cells. CD59 is a membrane-bound glycoprotein found associated with membranes of cells including human erythrocytes, lymphocytes, and vascular endothelial cells. CD59 protein inhibits assembly of functional MACs and thus protects cells from complement-mediated activation and/or lysis.
Without being limited by any particular theory or mechanism of action, it is here envisioned that plasma membranes of cells are normally protected from the effects of complement by cell-surface proteins, e.g., CD59, that specifically inhibit activation of the C5b-9 pore upon C9 complement protein binding to membrane C5b-8 (Holguin, et al., J. Clin. Invest. 84, 7 17, 1989; Sims et al., J. Biol. Chem. 264, 19228 19235, 1989; Davies, et al., J. Exp. Med. 170, 637 654, 1989; Rollins et al. J. Immunol. 144, 3478 3483, 1990; and Hamilton et al., Blood 76, 2572 2577, 1990). CD59 appears to function by competing with C9 complement protein for binding to C8 complement protein in the C5b-8 complex, thereby decreasing or preventing the formation of the C5b-9 membrane attack complex (Rollins et al., 1990). CD59 thus acts to reduce both cell activation and cell lysis by terminal complement MACs.
Mature human CD59 protein is composed of 77 amino acids and has a molecular weight of 1810. Precursor human CD59 protein has a molecular weight of 2110. Amino acid sequences of precursor human CD59, a mature human CD59, and CD59 of other mammals, e.g., baboon, African green monkey, owl monkey, marmoset, HVS-15, pig, rabbit, rat, and mouse, are shown in Sims et al. (U.S. Pat. No. 7,166,568, issued Jan. 23, 2007).
The protein structure of CD59 is characterized as a single cysteine-rich domain, having a hydrophobic core with three loops and a small fourth helical loop (Yu et al., Journal of Experimental Medicine, 185(4):745-753, 1997). Disulfide-bonded cysteine pairs connect each of these loops (Yu et al., 1997).
The structure of the gene encoding CD59 has been characterized (Fodor et al. U.S. Pat. No. 5,624,837, issued Apr. 29, 1997). The gene is located on the short arm of chromosome 11 in humans, specifically chromosome 11p13 and 11p14 (Online Mendelian Inheritance in Man accession number and 107271), and consists of 4 exons spanning 20 kb (Petranka et al. Proc. Nat. Acad. Sci. 89:7876-7879, 1992). An untranslated first exon is preceded by a G and C-rich promoter region that lacks a consensus TATA or CAAT motif. The second exon encodes the hydrophobic leader sequence of the protein, and the third exon encodes the N-terminal portion of the mature protein. The fourth exon encodes the remainder of the mature protein, including the hydrophobic sequence for glycophosphoinosital anchor attachment to a cell membrane.
Analysis of the physical association of CD59 with components of MAC show that separate binding sites for CD59 are contained within the α-chains of each of human C8 and human C9 (Sims et al.). The binding site for interactions of human CD59 with human C9 has been identified as amino acid residues 42 to 58 in the sequence of mature human CD59, that bind to the region of human C9 corresponding to human amino acid residues 334 to 418 of that protein, more particularly human C9 amino acid residues 359 to 384, immediately C-terminal to the predicted membrane-inserting domain of C9 (PCT/US96/17940 “C9 Complement Inhibitor” by Oklahoma Medical Research Foundation; Sims et al.).
The active surface exposed amino acid residue side chains that are available to bind C8/C9, identified from solution structure of mature human CD59 from published NMR data and the knowledge of the active portion of the CD59 molecule, are histidine at position 44, asparagine at position 48, aspartic acid at position 49, threonine at positions 51 and 52, arginine at position 55, and glutamic acid at position 58. NMR structures for CD59 are described in deposits by Kieffer et al., Human Complement Regulatory Protein CD59 (Extracellular Region, Residues 1 70; NMR, 10 Structures), MMDB Id: 891, PDB Id: 1ERH; Kieffer et al., Human Complement Regulatory Protein CD59 (Extracellular Region, Residues 1 70; NMR, Restrained), MMDB Id: 890, PDB Id: 1ERG; Fletcher et al., CD59 Complexed With Glcnac-Beta-1,4-(Fuc-Alpha-1,6)-Glcnac-Beta-1 (NMR, 10 Structures), MMDB Id: 498, PDB Id: 1CDS; Fletcher et al., CD59 Complexed With Glcnac-Beta-1,4-Glcnac-Beta-1 (NMR, 10 Structures), MMDB Id: 497, PDB Id: 1 CDR. The 1 CDS and 1 CDR deposits by Fletcher et al. Amino acid sequences of CD59 that present these side chains at the same relative positions function in a manner similar to human CD59 (Sims et al.), and such variants are within the scope of the methods, kits and pharmaceutical compositions herein.
Thus in certain embodiments, the CD59 protein includes conservative sequence modifications. As used herein, the term “conservative sequence modifications” refers to amino acid modifications that do not significantly affect or alter the characteristics of the CD59 protein containing the amino acid sequence, i.e., amino acid sequences of CD59 that present these side chains at the same relative positions will function in a manner similar to human CD59. Such conservative modifications include amino acid substitutions, additions and deletions. Modification of the amino acid sequence of CD59 is achieved using any known technique in the art e.g., site-directed mutagenesis or PCR based mutagenisis. Such techniques are described in Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Plainview, N.Y., 1989 and Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York, N.Y., 1989.
Conservative amino acid substitutions are ones in which the amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, tryptophan), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine).
In certain embodiments, the CD59 amino acid sequence is an amino acid sequence that is substantially identical to that of the wild type sequence. The term “substantially identical” is used herein to refer to a first amino acid sequence that contains a sufficient or minimum number of amino acid residues that are identical to aligned amino acid residues in a second amino acid sequence such that the first and second amino acid sequences can have a common structural domain and/or common functional activity. For example, amino acid sequences that contain a common structural domain having at least about 60% identity, or at least 75%, 85%, 95%, 96%, 98%, or 99% identity.
Calculations of sequence identity between sequences are performed as follows. To determine the percent identity of two amino acid sequences, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second amino acid sequence for optimal alignment). The amino acid residues at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the proteins are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences.
The comparison of sequences and determination of percent identity between two sequences are accomplished using a mathematical algorithm. Percent identity between two amino acid sequences is determined using an alignment software program using the default parameters. Suitable programs include, for example, CLUSTAL W by Thompson et al., Nuc. Acids Research 22:4673, 1994 (www.ebi.ac.uk/clustalw), BL2SEQ by Tatusova and Madden, FEMS Microbiol. Lett. 174:247, 1999 (www.ncbi.nlm.nih.gov/blast/b12seq/b12.html), SAGA by Notredame and Higgins, Nuc. Acids Research 24:1515, 1996 (igs-server.cnrs-mrs.fr/˜cnotred), and DIALIGN by Morgenstern et al., Bioinformatics 14:290, 1998 (bibiserv.techfak.uni-bielefeld.de/dialign).
Vectors
In various embodiments of the invention herein, a method for treating AMD is provided, the method including contacting cells or tissue with a pharmaceutical composition including a source of CD59 protein or as a source of CD59 expression in vivo. For example, the CD59 protein is administered as a recombinantly produced protein. The term “recombinant” refers to proteins produced by manipulation of genetically modified organisms, for example micro-organisms.
In accordance with the present invention a source of CD59 includes polynucleotide sequences that encode the CD59 protein, for example, engineered into recombinant DNA molecules to direct expression of the CD59 protein in appropriate host cells. To express a biologically active CD59 protein, a nucleotide sequence encoding the CD59 protein, or functional equivalent, is inserted into an appropriate expression vector, i.e., a vector that contains the necessary nucleic acid encoding elements that regulate transcription and translation of the inserted coding sequence, operably linked to the nucleotide sequence encoding the CD59 protein amino acid sequence.
Methods that are well known to those skilled in the art are used to construct expression vectors containing a sequence encoding the CD59 protein operably linked to appropriate transcriptional and translational control elements. These methods include in vitro recombinant DNA techniques, synthetic techniques and in vivo recombination or genetic recombination. Such techniques are described in Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Plainview, N.Y., 1989.
A variety of commercially available expression vector/host systems are useful to contain and express a CD59 protein encoding sequence. These include but are not limited to microorganisms such as bacteria transformed with recombinant bacteriophage, plasmid or cosmid DNA expression vectors; yeast transformed with yeast expression vectors; insect cell systems contacted with virus expression vectors (e.g., baculovirus); plant cell systems transfected with virus expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or transformed with bacterial expression vectors (e.g., Ti, pBR322, or pET25b plasmid); or animal cell systems. See Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York, N.Y., 1989.
Virus vectors include, but are not limited to, adenovirus vectors, lentivirus vectors, adeno-associated virus (AAV) vectors, and helper-dependent adenovirus vectors. Virus vectors deliver a nucleic acid sequence that encodes CD59 protein that as shown herein interferes with the deleterious action of the MAC in pathogenesis of AMD. Adenovirus packaging vectors are commercially available from American Type Tissue Culture Collection (Manassas, Va.). Methods of constructing adenovirus vectors and using adenovirus vectors are shown in Klein et al., Opthalmology, 114:253-262, 2007 and van Leeuwen et al., Eur. J. Epidemiol., 18:845-854, 2003.
Adenovirus vectors have been used in eukaryotic gene expression (Levrero et al., Gene, 101:195-202, 1991) and vaccine development (Graham et al., Methods in Molecular Biology: Gene Transfer and Expression Protocols 7, (Murray, Ed.), Humana Press, Clifton, N.J., 109-128, 1991). Further, recombinant adenovirus vectors are used for gene therapy (Wu et al., U.S. Pat. No. 7,235,391).
Recombinant adenovirus vectors are generated, for example, from homologous recombination between a shuttle vector and a provirus vector (Wu et al., U.S. Pat. No. 7,235,391). The adenovirus vectors herein are replication defective, for example, are conditionally defective, lacking adenovirus E1 region, and a polynucleotide encoding CD59 is introduced at the position from which the E1-coding sequences have been removed. The polynucleotide encoding the CD59 gene alternatively is inserted in the E3 region, or is inserted in an E4 region using a helper cell line.
Helper cell lines may be derived from human cells such as, 293 human embryonic kidney cells, muscle cells, hematopoietic cells or other human embryonic mesenchymal or epithelial cells. Alternatively, the helper cells may be derived from the cells of other mammalian species that are permissive for human adenovirus, e.g., Vero cells or other monkey embryonic mesenchymal or epithelial cells. Generation and propagation of these replication defective adenovirus vectors using a helper cell line is described in Graham et al, J. Gen. Virol., 36:59-72, 1977.
Lentiviral vector packaging vectors are commercially available from Invitrogen Corporation (Carlsbad Calif.). An HIV-based packaging system for the production of lentiviral vectors is prepared using constructs in Naldini et al., Science 272: 263-267, 1996; Zufferey et al., Nature Biotechnol., 15: 871-875, 1997; and Dull et al., J. Virol. 72: 8463-8471, 1998.
A number of vector constructs are available to be packaged using a system, based on third-generation lentiviral SIN vector backbone (Dull et al., J. Virol. 72: 8463-8471, 1998). For example the vector construct pRRLsinCMVGFPpre contains a 5′ LTR in which the HIV promoter sequence has been replaced with that of Rous sarcoma virus (RSV), a self-inactivating 3′ LTR containing a deletion in the U3 promoter region, the HIV packaging signal, RRE sequences linked to a marker gene cassette consisting of the Aequora jellyfish green fluorescent protein (GFP) driven by the CMV promoter, and the woodchuck hepatitis virus PRE element, which appears to enhance nuclear export. The GFP marker gene allows quantitation of transfection or transduction efficiency by direct observation of UV fluorescence microscopy or flow cytometry (Kafri et al., Nature Genet., 17: 314-317, 1997 and Sakoda et al., J. Mol. Cell. Cardiol., 31: 2037-2047, 1999).
Manipulation of retroviral nucleic acids to construct a retroviral vector containing the gene that encodes for CD59 protein and packaging cells is accomplished using techniques known in the art. See Ausubel, et al., 1992, Volume 1, Section III (units 9.10.1-9.14.3); Sambrook, et al., 1989. Molecular Cloning: A Laboratory Manual. Second Edition. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.; Miller, et al., Biotechniques. 7:981-990, 1989; Eglitis, et al., Biotechniques. 6:608-614, 1988; U.S. Pat. Nos. 4,650,764, 4,861,719, 4,980,289, 5,122,767, and 5,124,263; and PCT patent publications numbers WO 85/05629, WO 89/07150, WO 90/02797, WO 90/02806, WO 90/13641, WO 92/05266, WO 92/07943, WO 92/14829, and WO 93/14188.
A retroviral vector is constructed and packaged into non-infectious transducing viral particles (virions) using an amphotropic packaging system. Examples of such packaging systems are found in, for example, Miller, et al., Mol. Cell. Biol. 6:2895-2902, 1986; Markowitz, et al., J. Virol. 62:1120-1124, 1988; Cosset, et al., J. Virol. 64:1070-1078, 1990; U.S. Pat. Nos. 4,650,764, 4,861,719, 4,980,289, 5,122,767, and 5,124,263, and PCT patent publications numbers WO 85/05629, WO 89/07150, WO 90/02797, WO 90/02806, WO 90/13641, WO 92/05266, WO 92/07943, WO 92/14829, and WO 93/14188.
Generation of “producer cells” is accomplished by introducing retroviral vectors into the packaging cells. Examples of such retroviral vectors are found in, for example, Korman, et al., Proc. Natl. Acad. Sci. USA. 84:2150-2154, 1987; Morgenstern, et al., Nucleic Acids Res. 18:3587-3596, 1990; U.S. Pat. Nos. 4,405,712, 4,980,289, and 5,112,767; and PCT patent publications numbers WO 85/05629, WO 90/02797, and WO 92/07943.
Herpesvirus packaging vectors are commercially available from Invitrogen Corporation, (Carlsbad, Calif.). Exemplary herpesviruses are an α-herpesvirus, such as Varicella-Zoster virus or pseudorabies virus; a herpes simplex virus such as HSV-1 or HSV-2; or a herpesvirus such as Epstein-Barr virus. A method for preparing empty herpesvirus particles that can be packaged with a desired nucleotide segment, for example a CD59 nucleotide or polynucleotide sequence, in the absence of a helper virus that is capable to most herpesviruses is shown in Fraefel et al. (U.S. Pat. No. 5,998,208, issued Dec. 7, 1999).
The herpesvirus DNA vector can be constructed using techniques familiar to the skilled artisan. For example, DNA segments encoding the entire genome of a herpesvirus is divided among a number of vectors capable of carrying large DNA segments, e.g., cosmids (Evans, et al., Gene 79, 9-20, 1989), yeast artificial chromosomes (YACS) (Sambrook, J. et al., MOLECULAR CLONING: A LABORATORY MANUAL, 2nd Edition, Cold Spring Harbor Press, Cold Spring Harbor, N.Y., 1989) or E. coli F element plasmids (O'Conner, et al., Science 244:1307-1313, 1989).
For example, sets of cosmids have been isolated which contain overlapping clones that represent the entire genomes of a variety of herpesviruses including Epstein-Barr virus, Varicella-Zoster virus, pseudorabies virus and HSV-1. See M. van Zijl et al., J. Virol. 62, 2191, 1988; Cohen, et al., Proc. Nat'l Acad. Sci. U.S.A. 90, 7376, 1993; Tomkinson, et al., J. Virol. 67, 7298, 1993; and Cunningham et al., Virology 197, 116, 1993.
AAV is a dependent parvovirus in that it depends on co-infection with another virus (either adenovirus or a member of the herpes virus family) to undergo a productive infection in cultured cells (Muzyczka, Curr Top Microbiol Immunol, 158:97 129, 1992). For example, recombinant AAV (rAAV) virus is made by co-transfecting a plasmid containing the gene of interest, for example, the CD59 gene, flanked by the two AAV terminal repeats (McLaughlin et al., J. Virol., 62(6):1963 1973, 1988; Samulski et al., J. Virol, 63:3822 3828, 1989) and an expression plasmid containing the wild-type AAV coding sequences without the terminal repeats. Cells are also contacted or transfected with adenovirus or plasmids carrying the adenovirus genes required for AAV helper function. Recombinant AAV virus stocks made in such fashion include with adenovirus which must be physically separated from the recombinant AAV particles (for example, by cesium chloride density centrifugation).
Adeno-associated virus (AAV) packaging vectors are commercially available from GeneDetect (Auckland, New Zealand). AAV has been shown to have a high frequency of integration and infects nondividing cells, thus making it useful for delivery of genes into mammalian cells in tissue culture (Muzyczka, Curr Top Microbiol Immunol, 158:97 129, 1992). AAV has a broad host range for infectivity (Tratschin et al., Mol. Cell. Biol., 4:2072 2081, 1984; Laughlin et al., J. Virol., 60(2):515 524, 1986; Lebkowski et al., Mol. Cell. Biol., 8(10):3988 3996, 1988; McLaughlin et al., J. Virol., 62(6):1963 1973, 1988).
Methods of constructing AAV vectors and using AAV vectors are described, for example in U.S. Pat. Nos. 5,139,941 and 4,797,368. Use of AAV in gene delivery is further described in LaFace et al., Virology, 162(2):483 486, 1988; Zhou et al., Exp. Hematol, 21:928 933, 1993; Flotte et al., Am. J. Respir. Cell Mol. Biol., 7(3):349 356, 1992; and Walsh et al., J. Clin. Invest, 94:1440 1448, 1994.
Recombinant AAV vectors have been used successfully for in vitro and in vivo) transduction of marker genes (Kaplitt et al., Nat. Genet., 8(2):148 54, 1994; Lebkowski et al., Mol. Cell. Biol., 8(10):3988 3996, 1988; Samulski et al., EMBO J., 10:3941 3950, 1991; Shelling and Smith, Gene Therapy, 1: 165 169, 1994; Yoder et al., Blood, 82 (Supp.): 1:347 A, 1994; Zhou et al., Exp. Hematol, 21:928 933, 1993; Tratschin et al., Mol. Cell. Biol., 5:3258 3260, 1985; McLaughlin et al., J. Virol., 62(6):1963 1973, 1988) and transduction of genes involved in human diseases (Flotte et al., Am. J. Respir. Cell Mol. Biol., 7(3):349 356, 1992; Ohi et al., Gene, 89(2):279 282, 1990; Walsh et al., J. Clin. Invest, 94:1440 1448, 1994; and Wei et al., Gene Therapy, 1:261268, 1994).
Antibodies
The present invention relates also to diagnosing or prognosing presence or progression of macular degeneration by determining extent of MAC deposition on a retina by immunohistochemistry, using antibodies that are specific for human MAC. The term “antibody” as referred to herein includes whole antibodies and any antigen binding fragment (i.e., “antigen-binding portion”) or single chains of these. A naturally occurring “antibody” is a glycoprotein including at least two heavy (H) chains and two light (L) chains inter-connected by disulfide bonds.
As used herein, an antibody that “specifically binds to human MAC” is intended to refer to an antibody that binds to human MAC with a KD of 5×10−9 M or less, 2×10−9 M or less, or 1×10−10 M or less. For example, the antibody is monoclonal or polyclonal. The terms “monoclonal antibody” or “monoclonal antibody composition” as used herein refer to a preparation of antibody molecules of single molecular composition. A monoclonal antibody composition displays a single binding specificity and affinity for MAC or for a particular epitope of MAC. The antibody is an IgM, IgE, IgG such as IgG1 or IgG4.
Also useful for MAC assay is an antibody that is a recombinant antibody. The term “recombinant human antibody”, as used herein, includes all antibodies that are prepared, expressed, created or isolated by recombinant means, such as antibodies isolated from an animal (e.g., a mouse). Mammalian host cells for expressing the recombinant antibodies used in the methods herein include Chinese Hamster Ovary (CHO cells) including dhfr-CHO cells, described Urlaub and Chasin, Proc. Natl. Acad. Sci. USA 77:4216-4220, 1980 used with a DH FR selectable marker, e.g., as described in R. J. Kaufman and P. A. Sharp, 1982 Mol. Biol. 159:601-621, NSO myeloma cells, COS cells and SP2 cells. In particular, for use with NSO myeloma cells, another expression system is the GS gene expression system shown in WO 87/04462, WO 89/01036 and EP 338,841. To produce antibodies, expression vectors encoding antibody genes are introduced into mammalian host cells, and the host cells are cultured for a period of time sufficient to allow for expression of the antibody in the host cells or secretion of the antibody into the culture medium in which the host cells are grown. Antibodies can be recovered from the culture medium using standard protein purification methods.
Standard assays to evaluate the binding ability of the antibodies toward the target of various species are known in the art, including for example, ELISAs, western blots and RIAs. The binding kinetics (e.g., binding affinity) of the antibodies also can be assessed by standard assays known in the art, such as by Biacore analysis.
General methodologies for antibody production, including criteria to be considered when choosing an animal for the production of antisera, are described in Harlow et al. (Antibodies, Cold Spring Harbor Laboratory, pp. 93-117, 1988). For example, an animal of suitable size such as goats, dogs, sheep, mice, or camels are immunized by administration of an amount of immunogen, such as the intact protein or a portion thereof containing an epitope from human MAC, effective to produce an immune response. An exemplary protocol is as follows. The animal is subcutaneously injected in the back with 100 micrograms to 100 milligrams of antigen, dependent on the size of the animal, followed three weeks later with an intraperitoneal injection of 100 micrograms to 100 milligrams of immunogen with adjuvant dependent on the size of the animal, for example Freund's complete adjuvant. Additional intraperitoneal injections every two weeks with adjuvant, for example Freund's incomplete adjuvant, are administered until a suitable titer of antibody in the animal's blood is achieved. Exemplary titers include a titer of at least about 1:5000 or a titer of 1:100,000 or more, i.e., the dilution having a detectable activity. The antibodies are purified, for example, by affinity purification on columns containing human MAC.
The technique of in vitro immunization of human lymphocytes is used to generate monoclonal antibodies. Techniques for in vitro immunization of human lymphocytes are well known to those skilled in the art. See, e.g., Inai, et al., Histochemistry, 99(5):335 362, May 1993; Mulder, et al., Hum. Immunol., 36(3):186 192, 1993; Harada, et al., J. Oral Pathol. Med., 22(4):145 152, 1993; Stauber, et al., J. Immunol. Methods, 161(2):157 168, 1993; and Venkateswaran, et al., Hybridoma, 11(6) 729 739, 1992. These techniques can be used to produce antigen-reactive monoclonal antibodies, including antigen-specific IgG, and IgM monoclonal antibodies. Any antibody of fragment thereof having affinity and specific for human MAC is within the scope of the assay for MAC deposition provided herein.
The invention herein provides in one embodiment a method of assaying extent of macular degeneration (MD) arising from a complement component in a serum in a model cell system, the method including: exposing a first sample of cells to a sample of the serum and measuring resulting lysis, and comparing extent of lysis to that in a second sample of control cells not so exposed to the serum and otherwise identical, such that the extent of lysis in the first sample compared to that in the second sample is a measure of complement-induced MD.
In other embodiments, the invention provides methods of assaying a potential therapeutic agent for efficacy in treatment of human macular degeneration (MD) in a model cell system, the method including: contacting a first sample of cells to serum and measuring resulting lysis, and contacting a second sample of otherwise identical control cells with serum and a source of human CD59 protein and measuring resulting lysis; and contacting at least a third sample of cells to a candidate therapeutic composition and otherwise identically to serum and measuring lysis, such that the extent of lysis of the third sample compared to that in the first sample and the second sample is a measure of protection by the candidate composition, thereby assaying for a potential therapeutic agent for efficacy in treatment of human MD. The source of CD59 includes pure isolated CD59 without limitation, such as purified from a natural source or made recombinantly and purified, or delivered by a vector such as a viral vector or a nucleic acid vector, the vector encoding the CD59 and capable of expressing CD59 in vivo. In examples herein, contacting with CD59 is achieved by pretreating cells or tissues with a vector encoding the CD59 gene.
In an embodiment of these methods, cell lysis is measured by propidium iodide (PI) uptake. PI is commercially available from, for example, Fluka BioChemica (Buchs, Switzerland). PI is an intercalating agent that fluoresces when bound to DNA. PI is membrane impermeant and generally excluded from viable cells, thus PI is commonly used to identify and/or determine the amount of non-living cells in a mixed population.
In other embodiments, the invention provides methods in a model cell system of assaying a serum complement component for prognosis or diagnosis of macular degeneration (MD), the method including: contacting detectably labeled cells with serum from a subject and measuring amount of extracellular and/or intracellular detectable agent for contacted cells; and comparing extracellular and/or intracellular agent in the cells to that in detectably labeled control cells not exposed to the serum and otherwise identical, such that amount of extracellular and/or intracellular agent in the contacted cells is compared to that in the control cells, such that a greater amount of extracellular detectably labeled agent in cells contacted with serum is an indication of prognosis or diagnosis of MD.
In other embodiments, the invention provides methods of assaying a potential therapeutic agent for efficacy in treatment of human macular degeneration (MD) in a model cell system, the method including: contacting a first sample of detectably labeled cells with serum from a subject and measuring amount of extracellular and/or intracellular detectable agent, and contacting a second sample of otherwise identical detectably labeled control cells with serum and a source of human CD59 protein and measuring amount of extracellular and/or intracellular detectable agent; and contacting at least a third sample of detectably labeled cells to at least one candidate therapeutic composition and otherwise identically to serum and measuring amount of extracellular and/or intracellular detectable agent, such that the amount of extracellular and/or intracellular detectable agent of the third sample compared to that in the first sample and the second sample is a measure of protection by the candidate composition, such that a greater amount of extracellular detectably labeled agent is an indication of MD, thereby assaying for a potential therapeutic agent for efficacy in treatment of human MD.
In embodiments of these methods, the detectable agent is, for example, a recombinant vector having a gene capable of expressing a detectable protein, a fluorescent agent, a colorimetric agent, an enzymatic agent, and a radioactive agent.
In certain embodiments, the detectable protein is a fluorescent protein, for example, green fluorescent protein, aequorin, cyan fluorescent protein, DsRed fluorescent protein, enhanced green fluorescent protein, and yellow fluorescent protein. Green fluorescent protein (GFP) and aequorin are bioluminescent compositions isolated from the jellyfish Aequorea victoria. When a calcium ion binds to aequorin, the complex breaks down into apoaequorin and a luminescent composition, which emits blue light. Synthetic aequorin is commercially available from Sealite, Sciences (Bogart, Ga.) as AQUALITE®. GFP emits light in the lower green portion of the visible spectrum, and synthetic GFP is commercially available from Clontech (Mountain View, Calif.).
Mutations to the amino acid sequence of GFP have been made to produce derivative amino acid sequences of GFP that fluoresce different colors, for example, cyan fluorescent protein, DsRed fluorescent protein, enhanced green fluorescent protein, and yellow fluorescent protein. Synthetic cyan fluorescent protein, synthetic DsRed fluorescent protein, synthetic enhanced green fluorescent protein, and synthetic yellow fluorescent protein are each commercially available from Clontech (Mountain View, Calif.).
In alternative embodiments, the detectable agent is a fluorescent agent that is not a fluorescent protein, for example, Indocyanine Green, Doxorubicin, Riboflavin, Chlorophyll, and Porphyrin.
Indocyanine Green (ICG) is a tricarbocyanine dye that upon excitation, emits lights at about 800 nm, about 820 nm, about 840 nm or at about 860 nm. ICG is commercially available from H.W.Sands Corp. (Jupiter, Fla.). Doxorubicin is fluorescent and emits light at wavelengths of, for example, about 550 nm, 600 nm, or 650 nm. Doxorubicin is commercially available from Sigma-Aldrich (St. Louis, Mo.). Riboflavin is commercially available from Sigma-Aldrich (St. Louis, Mo.) and is fluorescent, emitting light at a wavelength of, for example, about 450 nm, about 550 nm, about 650 nm, or about 750 nm. Chlorophyll A is a green photosynthetic pigment that emits light at a wavelength of, for example, about 600 nm, about 700 nm, or about 800 nm. Chlorophyll A is commercially available from suppliers such as Sigma Chemical (St. Louis, Mo.) and Turner Designs (Sunnyvale, Calif.). Porphyrin is a heterocyclic macrocycle made from 4 pyrrole subunits linked on opposite sides through 4 methine bridges (═CH—). The extensive conjugated structure of Porphyin makes the compound chromatic, i.e., fluorescent at a wavelength of, for example, about 600 nm, or about 650 nm, or about 700 nm. Porphyrin is commercially available from Sigma-Aldrich (St. Louis, Mo.).
In other alternative embodiments, the detectable agent is an enzymatic agent which is a protein, for example, β-galactosidase or alkaline phosphatase, that can be expressed on a nucleotide vector.
β-galactosidase is a hydrolase enzyme that catalyzes the hydrolysis of β-galactosides into monosaccharides. A luminescent β-galactosidase detection kit is commercially available from Clontech (Mountain View, Calif.). Alkaline phosphatase is a hydrolase enzyme responsible for removing phosphate groups from many types of molecules, including nucleotides, proteins, and alkaloids. A luminescent alkaline phosphatase detection kit is commercially available from Sigma Aldrich (St. Louis, Mo.).
Pharmaceutical Compositions
An aspect of the present invention provides pharmaceutical compositions that include a CD59 protein or a source of CD59 protein expression. In certain embodiments, these compositions optionally further include one or more additional therapeutic agents. In certain embodiments, the additional therapeutic agent or agents are selected from the group consisting of growth factors, anti-inflammatory agents, vasopressor agents including but not limited to nitric oxide and calcium channel blockers, collagenase inhibitors, topical steroids, matrix metalloproteinase inhibitors, ascorbates, angiotensin II, angiotensin III, calreticulin, tetracyclines, fibronectin, collagen, thrombospondin, transforming growth factors (TGF), keratinocyte growth factor (KGF), fibroblast growth factor (FGF), insulin-like growth factors (IGFs), IGF binding proteins (IGFBPs), epidermal growth factor (EGF), platelet derived growth factor (PDGF), neu differentiation factor (NDF), hepatocyte growth factor (HGF), vascular endothelial growth factor (VEGF), heparin-binding EGF (HBEGF), thrombospondins, von Willebrand Factor-C, heparin and heparin sulfates, and hyaluronic acid.
In other embodiments, the additional agent is a compound, composition, biological or the like that potentiates, stabilizes or synergizes or even substitutes for the ability of CD59 protein to protect cells from MAC deposition. Also included are therapeutic agents that may beneficially or conveniently be provided at the same time as the CD59 protein, such as agents used to treat the same, a concurrent or a related symptom, condition or disease. In some embodiments, the drug may include without limitation anti-tumor, antiviral, antibacterial, anti-mycobacterial, anti-fungal, anti-proliferative or anti-apoptotic agents. Drugs that are included in the compositions of the invention are well known in the art. See for example, Goodman & Gilman's The Pharmacological Basis of Therapeutics, 9th Ed., Hardman, et al., eds., McGraw-Hill, 1996, the contents of which are herein incorporated by reference herein.
As used herein, the term “pharmaceutically acceptable carrier” includes any and all solvents, diluents, or other liquid vehicle, dispersion or suspension aids, surface active agents, isotonic agents, thickening or emulsifying agents, preservatives, solid binders, lubricants and the like, as suited to the particular dosage form desired. Remington's Pharmaceutical Sciences Ed. by Gennaro, Mack Publishing, Easton, Pa., 1995 provides various carriers used in formulating pharmaceutical compositions and known techniques for the preparation thereof. Some examples of materials which can serve as pharmaceutically acceptable carriers include, but are not limited to, sugars such as glucose and sucrose; excipients such as cocoa butter and suppository waxes; oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; glycols such a propylene glycol; esters such as ethyl oleate and ethyl laurate; agar; buffering agents such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline; Ringer's solution; ethyl alcohol; and phosphate buffer solutions, as well as other non-toxic compatible lubricants such as sodium lauryl sulfate and magnesium stearate, as well as coloring agents, releasing agents, coating agents, preservatives and antioxidants can also be present in the composition, according to the judgment of the formulator.
Therapeutically Effective Dose
Treatment of AMD by methods provided herein involves contacting retinal pigment cells with a pharmaceutical composition, for example, administering a therapeutically effective amount of a pharmaceutical composition having as an active agents a CD59 protein or a source of expression of a CD59 protein, to a subject in need thereof, in such amounts and for such time as is necessary to achieve the desired result.
The compositions, according to the method of the present invention, may be administered using any amount and any route of administration effective for treating AMD. Thus, the expression “amount effective for treating AMD”, as used herein, refers to a sufficient amount of composition to beneficially prevent or ameliorate the symptoms of AMD.
The exact dosage is chosen by the individual physician in view of the patient to be treated. Dosage and administration are adjusted to provide sufficient levels of the active agent(s) or to maintain the desired effect. Additional factors which may be taken into account include the severity of the disease state, e.g., intermediate or advanced stage of AMD; age, weight and gender of the patient; diet, time and frequency of administration; route of administration; drug combinations; reaction sensitivities; and tolerance/response to therapy. Long acting pharmaceutical compositions might be administered hourly, twice hourly, every 3 to four hours, daily, twice daily, every 3 to 4 days, every week, or once every two weeks depending on half-life and clearance rate of the particular composition.
The active agents of the invention are preferably formulated in dosage unit form for ease of administration and uniformity of dosage. The expression “dosage unit form” as used herein refers to a physically discrete unit of active agent appropriate for the patient to be treated. It will be understood, however, that the total daily usage of the compositions of the present invention will be decided by the attending physician within the scope of sound medical judgment. For any active agent, the therapeutically effective dose can be estimated initially either in cell culture assays or in animal models, as provided herein, usually mice, but also potentially from rats, rabbits, dogs, or pigs. The animal cell model provided herein is also used to achieve a desirable concentration and total dosing range and route of administration. Such information can then be used to determine useful doses and routes for administration in humans.
A therapeutically effective dose refers to that amount of active agent that ameliorates the symptoms or condition or prevents progression of AMD. Therapeutic efficacy and toxicity of active agents can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., ED50 (the dose is therapeutically effective in 50% of the population) and LD50 (the dose is lethal to 50% of the population). The dose ratio of toxic to therapeutic effects is the therapeutic index, and it can be expressed as the ratio, LD50/ED50. Pharmaceutical compositions which exhibit large therapeutic indices are preferred. The data obtained from cell culture assays and animal studies is used in formulating a range of dosage for human use.
The daily dosage of the products may be varied over a wide range, such as from 0.001 to 100 mg per adult human per day. For ocular administration, the compositions are preferably provided in the form of a solution containing 0.001, 0.01, 0.05, 0.1, 0.5, 1.0, 2.5, 5.0, 10.0, 15.0, 25.0, 50.0, 100.0, 250.0, or 500.0 micrograms of the active ingredient for the symptomatic adjustment of the dosage to the patient to be treated.
A unit dose typically contains from about 0.001 micrograms to about 500 micrograms of the active ingredient, preferably from about 0.1 micrograms to about 100 micrograms of active ingredient, more preferably from about 1.0 micrograms to about 10 micrograms of active ingredient. An effective amount of the drug is ordinarily supplied at a dosage level of from about 0.0001 mg/kg to about 25 mg/kg of body weight per day. For example, the range is from about 0.001 to 10 mg/kg of body weight per day, or from about 0.001 mg/kg to 1 mg/kg of body weight per day. The compositions may be administered on a regimen of, for example, one to four or more times per day.
Administration of a source of expression of a CD59 protein is administration of a dose of a viral vector or a nucleic acid vector, such that the dose contains at least about 50, 100, 500, 1000, or at least about 5000 particles per cell to be treated. Cell number can be calculated from retinal area in need of treatment by methods known to one of skill in the art of AMD.
Administration of Pharmaceutical Compositions
As formulated with an appropriate pharmaceutically acceptable carrier in a desired dosage, the pharmaceutical composition provided herein is administered to humans and other mammals topically such as ocularly (as by solutions, ointments, or drops), nasally, bucally, orally, rectally, parenterally, intracisternally, intravaginally, or intraperitoneally.
Ocular injections include intra-ocular injection into the aqueous or the vitreous humor, or injection into the external layers of the eye, such as via subconjunctival injection or subtenon injection.
Liquid dosage forms for ocular, oral, or other systemic administration include, but are not limited to, pharmaceutically acceptable emulsions, microemulsions, solutions, suspensions, syrups and elixirs. In addition to the active agent(s), the liquid dosage forms may contain inert diluents commonly used in the art such as, for example, water or other solvents, solubilizing agents and emulsifiers such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, dimethylformamide, oils (in particular, cottonseed, groundnut, corn, germ, olive, castor, and sesame oils), glycerol, tetrahydrofurfuryl alcohol, polyethylene glycols and fatty acid esters of sorbitan, and mixtures thereof. Besides inert diluents, the ocular, oral, or other systemically-delivered compositions can also include adjuvants such as wetting agents, and emulsifying and suspending agents.
Dosage forms for topical or transdermal administration of an inventive pharmaceutical composition include ointments, pastes, creams, lotions, gels, powders, solutions, sprays, inhalants, or patches. The active agent is admixed under sterile conditions with a pharmaceutically acceptable carrier and any needed preservatives or buffers as may be required. For example, ocular or cutaneous routes of administration are achieved with aqueous drops, a mist, an emulsion, or a cream. Administration may be therapeutic or it may be prophylactic. The invention includes opthalmological devices, surgical devices, audiological devices or products which contain disclosed compositions (e.g., gauze bandages or strips), and methods of making or using such devices or products. These devices may be coated with, impregnated with, bonded to or otherwise treated with a composition as described herein.
Transdermal patches have the added advantage of providing controlled delivery of the active ingredients to the body. Such dosage forms can be made by dissolving or dispensing the compound in the proper medium. Absorption enhancers can also be used to increase the flux of the compound across the skin. The rate can be controlled by either providing a rate controlling membrane or by dispersing the compound in a polymer matrix or gel.
Injectable preparations, for example, sterile injectable aqueous or oleaginous suspensions may be formulated according to the known art using suitable dispersing or wetting agents and suspending agents. The sterile injectable preparation may also be a sterile injectable solution, suspension or emulsion in a nontoxic parenterally acceptable diluent or solvent, for example, as a solution in 1,3-butanediol. Among the acceptable vehicles and solvents that may be employed are water, Ringer's solution, U.S.P. and isotonic sodium chloride solution. In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose any bland fixed oil can be employed including synthetic mono- or diglycerides. In addition, fatty acids such as oleic acid are used in the preparation of injectables. The injectable formulations can be sterilized, for example, by filtration through a bacterial-retaining filter, or by incorporating sterilizing agents in the form of sterile solid compositions which can be dissolved or dispersed in sterile water or other sterile injectable medium prior to use. In order to prolong the effect of an active agent, it is often desirable to slow the absorption of the agent from subcutaneous or intramuscular injection. Delayed absorption of a parenterally administered active agent may be accomplished by dissolving or suspending the agent in an oil vehicle. Injectable depot forms are made by forming microencapsule matrices of the agent in biodegradable polymers such as polylactide-polyglycolide. Depending upon the ratio of active agent to polymer and the nature of the particular polymer employed, the rate of active agent release can be controlled. Examples of other biodegradable polymers include poly(orthoesters) and poly(anhydrides). Depot injectable formulations are also prepared by entrapping the agent in liposomes or microemulsions which are compatible with body tissues.
Compositions for rectal or vaginal administration are preferably suppositories which can be prepared by mixing the active agent(s) of this invention with suitable non-irritating excipients or carriers such as cocoa butter, polyethylene glycol or a suppository wax which are solid at ambient temperature but liquid at body temperature and therefore melt in the rectum or vaginal cavity and release the active agent(s).
Solid dosage forms for oral administration include capsules, tablets, pills, powders, and granules. In such solid dosage forms, the active agent is mixed with at least one inert, pharmaceutically acceptable excipient or carrier such as sodium citrate or dicalcium phosphate and/or a) fillers or extenders such as starches, sucrose, glucose, mannitol, and silicic acid, b) binders such as, for example, carboxymethylcellulose, alginates, gelatin, polyvinylpyrrolidinone, sucrose, and acacia, c) humectants such as glycerol, d) disintegrating agents such as agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, and sodium carbonate, e) solution retarding agents such as paraffin, f) absorption accelerators such as quaternary ammonium compounds, g) wetting agents such as, for example, cetyl alcohol and glycerol monostearate, h) absorbents such as kaolin and bentonite clay, and i) lubricants such as talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate, and mixtures thereof.
Solid compositions of a similar type may also be employed as fillers in soft and hard-filled gelatin capsules using such excipients as milk sugar as well as high molecular weight polyethylene glycols and the like. The solid dosage forms of tablets, dragees, capsules, pills, and granules can be prepared with coatings and shells such as enteric coatings, release controlling coatings and other coatings well known in the pharmaceutical formulating art. In such solid dosage forms the active agent(s) may be admixed with at least one inert diluent such as sucrose or starch. Such dosage forms may also comprise, as is normal practice, additional substances other than inert diluents, e.g., tableting lubricants and other tableting aids such a magnesium stearate and microcrystalline cellulose. In the case of capsules, tablets and pills, the dosage forms may also comprise buffering agents. They may optionally contain opacifying agents and can also be of a composition that they release the active agent(s) only, or preferentially, in a certain part of the intestinal tract, optionally, in a delayed manner. Examples of embedding compositions which can be used include polymeric substances and waxes.
The invention having now been fully described, it is further illustrated by the following examples and claims, which are illustrative and are not meant to be further limiting.
A portion of this work was published in a paper entitled, “Evaluation of Adenovirus-Delivered Human CD59 as a Potential Therapy for AMD in a Model of Human Membrane Attack Complex Formation on Murine RPE”, co-authored by the inventors Kasmir Ramo, Siobhan Cashman, and Rajendra Kumar-Singh, (Invest Opthalmol V is Sci. September 2008; vol. 49, pp. 4126-4136), and this paper is hereby incorporated by reference herein in its entirety.
The invention now having been fully described, it is further exemplified by the following examples and claims. Those skilled in the art will recognize or be able to ascertain using no more than routine experimentation, numerous equivalents to the specific procedures described herein. Such equivalents are within the scope of the present invention and claims. The contents of all references including issued patents and published patent applications cited in this application are hereby incorporated by reference.
Compositions that include CD59 protein or a source of in vivo expression of CD59 protein are shown by the following Examples to be effective to treat AMD. A humanized murine model of measuring human MAC deposition in vitro and in vivo is shown in the following Examples, and this model is used to measure protection of murine RPE from the deleterious deposition of human MAC by a vector that expresses human CD59 protein.
Human CD59 cDNA was obtained from the American Type Tissue Culture Collection (ATCC, Manassas, Va.) and PCR amplified using a forward primer containing an XhoI site, (underlined; 5′ ccccctcgagtggacaatcacaatggg3′; SEQ ID NO:1) and a reverse primer with an EcoRV site (underlined; 5′ cccccgatatcaacggggagtttgggagaag3′; SEQ ID NO:2).
The PCR product was gel purified and, after XhoI/EcoRV digestion, cloned into XhoI/EcoRV digested pShCAG (constructed by cloning a SalI/BamHI fragment of pCAGEN into XhoI/BglIII digested pShuttle) generating pShCAGCD59. Automated sequencing confirmed that the CD59 sequence had been introduced into the generated plasmid. This shuttle plasmid was then used to produce the adenovirus vector using protocols published in Klein et al., Opthalmology, 114:253-262, 2007 and van Leeuwen et al., Eur. J. Epidemiol., 18:845-854, 2003. pShCAGCD59 was linearized with PmeI, gel purified and recombined with pAdEasy-1 by co-transformation of Escherichia coli BJ5183 cells. The recombined plasmid was linearized with PacI, transfected into the human embryonic retinoblast (911) cell line and the resulting vector (AdCAGCD59) was purified using the adenovirus purification kit Adenopure (Puresyn, Inc., Malvern, Pa.).
Control vector AdEMPTY was generated similarly by recombining the PmeI linearized pSHCAG with pAdEasy-1. The AdCAGGFP control vector is described in Johnson et al., Exp. Eye Res., 70:441-449, 2000.
Human embryonic retinoblast cell line 911 was maintained in Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and mouse hepatoma cell line hepa-1c1c7 (ATCC, Manassas, Va.) in α-MEM supplemented with 10% FBS. Cells were cultured in a humidified incubator at 37° C. under 5% CO2:95% air atmosphere.
For Western blot analysis or the human serum cell lysis assay 1.2×106 hepa-1c1c7 cells and for CD59 immunocytochemistry or the human serum MAC deposition assay 2.5×104 hepa-1c1c7 cells were contacted with either AdCAGGFP or AdCAGCD59 vectors at multiplicities of infection of the virus particles per cell as indicated, or control cells were not so contacted. Adenovirus contacting to cells was performed in media with 2% FBS. Three days after contacting, cells were further treated as described in Examples herein. While specific conditions are described herein, equivalent conditions of media, temperature, etc., to achieve effective pretreatment of cells or tissues with CD59 are within the scope of the methods herein.
Primary Mouse RPE cells were harvested from eyes of sacrificed 6-10 week old C57Bl/6J mice. After removing each of the anterior chamber, lens and retina as described below, eyecup tissues were incubated in 200 μl 0.25% trypsin-EDTA in 1.5 ml eppendorf tubes for 40 to 50 minutes at 37° C. Eyecup tissues were subsequently transferred to a 60 mm cell culture plate containing α-MEM supplemented with 10% FBS. The RPE cells were gently scraped with a pipet tip, the RPE sheets were aspirated using a 200 μl pipet and transferred to an eppendorf tube. After dispersing the RPE sheets by pipeting the media several times, cells were counted and about 3×104 cells (generally the yield obtained from one eye) were seeded in one chamber of a poly-D-lysine-coated chamberslide (Becton Dickinson, Franklin Lakes, N.J.). After one week in culture, cells were used as described in Examples herein. Contacting cells with adenovirus vector was performed in media with 2% FBS.
Cells were lysed in 50 mM Tris-HCl, pH 8.0/150 mM NaCl/0.1% sodium dodecyl sulfate/1% Triton X-100 containing 2% (v:v) protease inhibitor cocktail (Sigma-Aldrich, St. Louis, Mo.). Media from cells were collected, centrifuged, passed through a 0.22 μm filter or other filter as indicated in the figures, to remove remaining cell debris and media were concentrated 10× using a Biomax centrifugal filter with a 10,000 Dalton pore size (Millipore Corporation, Billerica, Mass.). Lysates were analyzed by gel electrophoresis under non-reducing conditions on a 15% Tris-glycine SDS-PAGE gel (Bio-Rad Laboratories, Hercules, Calif.) and proteins were transferred to a polyvinylidene fluoride (PVDF) membrane (Millipore, Billerica, Mass.). Following blocking in 5% (w:v) skim milk (Becton Dickinson, Sparks, Md.), the membrane was probed for human CD59 using a mouse anti-human CD59 monoclonal antibody (1:1000 dilution; Clone Mem-43; Abcam, Cambridge, Mass.), followed by a secondary antibody horseradish peroxidase-conjugated goat anti-mouse antibody (1:10 000 dilution; Jackson Immunoresearch, West Grove, Pa.). Following stripping and blocking as described above, the same membrane was probed for 3-Actin with a mouse anti-β-actin monoclonal antibody (1:5 000 dilution; Clone AC-15; Sigma-Aldrich, St. Louis, Mo.). Secondary detection was performed as described above.
Normal human serum (NHS) was purchased in lyophilized form from Sigma (St. Louis, Mo.) and reconstituted (per manufacturer instructions) with 1 ml of cold sterile deionized water to obtain a volume of serum equal to that of the human plasma from which the powder was obtained. The resulting human serum lots having a hemolytic titer of 43 CH50 units/ml or 74 CH50 units/ml respectively (determined by the manufacturer using the method of Kabat and Mayer) were aliquoted and stored at −80° C. The first lot with a hemolytic titer K) of 43 CH50 units/ml was used in experiments with hepa-1c1c7 cells. The second lot, with a hemolytic titer of 74 CH50 units/ml, was used in the other experiments.
For the human serum cell lysis assay, single cell suspensions of pretreated cells, i.e., including control cells not contacted with vector, or adenovirus contacted hepa-1c1c7 cells in a total volume of 500 μl were used. Following removal of media, cells were washed twice with 1× phosphate buffered saline (PBS) and after brief trypsinization (0.25% trypsin-EDTA, 4-6 mins), harvested with 1×PBS containing 0.5% FBS. Cells were collected by centrifugation at 4° C. and resuspended in ice-cold gelatin veronal buffer with Ca2+ and Mg2+ (GVB++, Complement Technology, Tyler, Tex.). Cells were counted on a hemacytometer and 5×105 cells were aliquoted into eppendorf tubes. Normal human serum (NHS) or heat inactivated (56° C. for 1 hour) normal human serum (HI-NHS) was added to cells, and the cell suspensions were incubated at 37° C. for 1 hour with gentle rotatory shaking. Cell lysis was determined by the propidium iodide (PI) exclusion method followed by FACS analysis.
Shortly prior to FACS, one microliter of PI (1 mg/ml; Fluka BioChemica, Buchs, Switzerland) was added to a cell suspension and 25,000 events per sample were counted on a FACSCalibur (Becton Dickinson, Franklin Lakes, N.J.). Results were analyzed using the CellQuest Pro software (Becton Dickinson, Franklin Lakes, N.J.) and percent cell lysis was calculated using the formula shown below.
% Cell Lysis=[1−(% live cells in HI-NHS/% live cells in NHS)]×100
Mouse hepa-1c1c7 cells were cultured for three days, and were pretreated by contacting with AdCAGGFP (negative control), or AdCAGCD59, in poly-D-lysine-coated chamberslides (Becton Dickinson, Franklin Lakes, N.J.) and were washed twice with 1×PBS. Cells were then incubated with 10% (v:v) NHS or HI-NHS in GVB++ (Complement Technology, Tyler, Tex.) at 37° C. for 1, 3, 5, 7 or 10 minutes.
Primary mouse RPE cells were incubated with or without 25 μg/ml goat anti-mouse emmprin antibody (R&D Systems, Minneapolis, Minn.) in GVB++ (Complement Technology, Tyler, Tex.) for 1 hour and either washed and fixed (for emmprin immunocytochemistry) or were treated for the MAC deposition assay followed by addition of NHS or HI-NHS (final concentration 50%) for 4 or 7 minutes. Thereafter cells were washed three times with ice cold 1×PBS and fixed with 3.7% formaldehyde (MP Biomedicals, Solon, Ohio) in 1×PBS for 15 minutes. Cells were washed another three times with 1×PBS to remove remaining fixative and stored in 1×PBS at 4° C. until immunocytochemical analysis, as described in Examples herein.
Fixed cells or tissues described above were incubated with primary mouse monoclonal antibodies to human CD59 (clone M-43) or human C5b-9 (clone aE11) (each at 1:50 dilution, Abcam, Cambridge, Mass.) in 1×PBS containing 6% (w:v) normal goat serum (Jackson Immunoresearch, West Grove, Pa.) for 2.5 hours with gentle rotatory shaking. Secondary detection was performed using a Cy3 conjugated goat anti-mouse antibody (1:400 dilution; Jackson Immunoresearch, West Grove, Pa.) for 1.5 hours in a dark chamber.
For RPE65 immunostaining, primary RPE cells were pre-blocked and permeabilized in 1×PBS containing 6% (w:v) normal goat serum (Jackson Immunoresearch, West Grove, Pa.) and 0.25% (v:v) Triton X-100 (Fisher Bio-reagents, Fair Lawn, N.J.) for 1 hour. A mouse anti-RPE65 antibody was then applied and primary and secondary detection were performed as above except that the antibody and washing solutions contained 0.25% (v:v) Triton X-100 (Fisher Bio-reagents, Fair Lawn, N.J.).
For mouse emmprin staining, goat anti-mouse emmprin antibody treated and fixed cells and tissues were blocked in 1×PBS containing 6% (w:v) normal donkey serum (Jackson Immunoresearch, West Grove, Pa.) for 1 hour and secondary detection was performed using a Cy3-conjugated donkey anti-goat antibody (1:400 dilution; Jackson Immunoresearch, West Grove, Pa.) in 1×PBS containing 6% (w:v) normal donkey serum for 1.5 hours.
Cells were treated as for the MAC deposition assay in cell culture as described in Examples above, except that after washing to remove the serum, cells were incubated in 0.1% trypan blue solution for 5 minutes. Cells were subsequently washed twice with 1×PBS and fixed as described in Examples above.
Mice (C57B1/6J) were purchased from Jackson Laboratories (Bar Harbor, Me.), bred and maintained in a 12-hour light-dark cycle. Mice were anesthetized by intraperitoneal injection of xylazine (10 mg/ml)/ketamine (1 mg/ml). Subretinal injections were performed as described in Anderson Am J. Opthalmol., 134:411-431, 2002, using the transcleral-transchoroidal approach with a 32-gauge needle attached to a 5 μl glass syringe (Hamilton, Reno, Nev.). One microliter of a control mixture of nine parts AdEMPTY and one part AdCAGGFP (total of 3×108 vector particles; control) or of a mixture of nine parts AdCAGCD59 and one part AdCAGGFP (total of 3×108 vector particles) was injected into each subject mouse.
Six days after administering to pretreat by injection, mice were sacrificed by CO2 inhalation and eyes were harvested and placed in 1×PBS containing penicillin (100 U/ml) and streptomycin (100 U/ml). A circular incision was made 1-2 mm posterior to the ora serata and the entire anterior chamber including the lens was carefully removed. After making a small incision at the base of the optic nerve to cut the ganglionic axons, the retina was removed and the eyecup tissue was either fixed immediately in 4% paraformaldehyde in phosphate buffer (pH 7.4) overnight (for CD59 immunohistochemistry) or incubated with 25 μg/ml goat anti-mouse emmprin antibody (R&D Systems, Minneapolis, Minn.) in cold GVB++ (Complement Technology, Tyler, Tex.) at 4° C. for 1 hour.
Eyecup tissues were then either washed three times with cold PBS and were fixed for emmprin immunohistochemistry. For MAC deposition assay, an equal volume of NHS or HI-NHS (final concentration 50%) was added to the eyecup tissues which were then incubated at 37° C. for 15 minutes and were washed three times with cold PBS and were fixed.
Cornea tissues were harvested from uninjected mice, the iris was removed and the corneas cultured in 300 μl of DMEM with 2% FBS. Corneas were contacted with 1.5×109 vector particles of AdCAGGFP (negative control) or the AdCAGCD59 vector. Three days post-harvesting/contacting, each of untreated corneas (negative control), AdCAGGFP pretreated corneas (negative control) and AdCAGCD59 pretreated corneas was mixed with anti-mouse emmprin antibody as with eyecup tissues, and each was either washed and fixed (for emmprin immunohistochemistry), or was contacted with 50% NHS or HI-NHS for 20 minutes and then washed and fixed (for the MAC deposition assay). Prior to immunohistochemistry, tissues were washed three times for ten minutes each with 1×PBS to remove remaining fixative.
To deliver human CD59 (hCD59) in order to pretreat murine RPE and retina in vivo, a first generation serotype 5 adenovirus containing hCD59 cDNA under control of chicken beta actin (CAG) promoter (AdCAGCD59 vector;
Human CD59 is an 18-21 kDa glycosylphosphatidylinositol (GPI)-anchored membrane protein. To analyze expression of the protein, mouse hepa-1c1c7 cells were contacted for pretreatment with a multiplicity of 1000 vector particles (vp/cell) of the purified AdCAGCD59 or control vector. Cell lysates were analyzed by Western blotting using a monoclonal antibody to hCD59, and the presence of hCD59 was observed in cell lysates of AdCAGCD59 pretreated cells (
Endogenous hCD59 was detected in human embryonic retinoblast (911) cell lysates (
Immunostaining of non-permeabilized AdCAGCD59 contacted mouse hepa-1c1c7 cells using the anti-hCD59 antibody showed expression and localization of hCD59 on the cell membrane (
To test the functional activity of hCD59 expressed from the AdCAGCD59 vector, human serum cell lysis assays were performed on mouse hepa-1c1c7 cells. Cell suspensions were incubated with NHS or HI-NHS (as a control for non-complement specific lysis) to expose the cells to complement, and percent cell lysis was determined by uptake of PI as detected and quantified by FACS analysis.
Effect of concentration of serum on the extent of lysis of control untreated cells was initially investigated (
Cells were pretreated with 1000 vp/cell of the AdCAGCD59 or the negative control AdCAGGFP vector and 65 hours after contacting, the cells were harvested and used in human serum cell lysis experiments. Adenovirus pretreatment at amounts used here did not result in cell toxicity as observed by microscopy or as detected by PI uptake followed by FACS, and by comparison with data obtained from cells contacted with the two vectors and from control untreated cells as shown herein. It was observed that cell lysis of contacted cells incubated in HI-NHS was minimal and was similar to that of cells not pretreated with a vector (control) incubated with HI-NHS (
In contrast, mouse cells pretreated with the negative control AdCAGGFP vector were not protected, i.e., remained susceptible to human complement, with extent of complement mediated cell lysis observed at 95.27%±0.01% of cells (
Protection of cells from lysis was obtained herein by expression of human CD59 in cells pretreated with AdCAGCD59 vector. It was further observed that protection was dependent on the multiplicity of AdCAGCD59 vector administered. Administering 250 vp/cell and 500 vp/cell of AdCAGCD59, respectively, inhibited cell lysis by over 50% and 70%, respectively (
Data in Examples above show that incubation of mouse hepa-1c1c7 cells with normal human serum led to complement activation and extensive cell lysis, and that this lysis was efficiently inhibited when recombinant human CD59 was expressed in these cells.
Examples were performed to determine whether recombinant human CD59 expressed by adenovirus pretreated mouse cells would prevent formation of the C5b-9 complex in an in vitro MAC deposition assay developed for this purpose.
Mouse cells in poly-D-lysine coated chamberslides were incubated with 10% NHS or HI-NHS in GVB++ at 37° C. for 1 to 10 minutes and subsequently washed and fixed. Incubation of these cells with NHS for 5 minutes caused significant changes in cell morphology (
Immunocytochemical analysis using a monoclonal antibody directed to a neoepitope on the C5b-9 complex revealed extensive membrane staining at the borders of cells exposed to NHS confirming deposition of the MAC on these cells (
Pretreating the mouse hepa-1c1c7 cells with 1000 vp/cell of the AdCAGCD59 vector was found to significantly protect these cells from human MAC deposition and eventual lysis (
It was observed that MAC staining was present on even a few of the AdCAGCD59 pretreated cells following 7 minutes of NHS treatment (
The different patterns of MAC immunostaining was more readily observed when cells were pre-contacted at lower multiplicities of the AdCAGCD59 vector. Following 5 minutes of NHS exposure, cells pretreated with 100 or 500 vp/cell showed more MAC immunostaining compared to cells contacted with 1000 vp/cell (
A MAC deposition assay was developed in order to use murine ocular tissues to assay extent of AMD damage or potential for AMD, and to use to screen agents to treat or prevent AMD.
Eyecup tissues were harvested from C57B1/6J mice and exposed to various concentrations of NHS or HI-NHS. Immunohistochemical analysis with the anti-human C5b-9 antibody was followed by an appropriate Cy3 conjugated secondary antibody. The data showed no fluorescent signal on the RPE, even when eyecup tissues were contacted with a concentration of NHS as high as 50%. Contacting with 100% NHS resulted in occasional scattered weak staining (
The MAC deposition assay was performed on primary mouse RPE cells in order to further explore the absence of MAC deposition on murine RPE cells following exposure to human serum, and to determine whether the extracellular matrix on the ocular tissues was interfering with accessibility of complement proteins to the RPE or endothelial cell surface. RPE cells were identified by presence of typical pigmentation, characteristic morphology and routine immunostaining for the RPE cell marker, RPE65 (
The absence of extensive MAC deposition on the RPE and corneal endothelium upon exposure to NHS could be due to inefficient complement activation and/or enhanced protection by murine complement regulatory proteins expressed on the surface of these cells. To determine if complement activation on murine RPE could be enhanced, an antibody against the extracellular domain of mouse emmprin, which is an abundantly expressed membrane protein on RPE as well as corneal endothelium was next used. An anti-mouse emmprin antibody produced in goat was selected to avoid potential cross-reactivity with the secondary antibody (Cy3-conjugated goat anti-mouse IgG and IgM) used for MAC immunostaining.
Incubation of mouse eyecup tissues or cornea tissues with the anti-mouse emmprin antibody followed by exposure to NHS (final concentration 50% for 15 minutes eyecup tissues, or 20 minutes cornea tissues at 37° C.) yielded extensive, bright MAC immunostaining of the RPE dissected tissue (
Similar results were also obtained with primary passage 0 mouse RPE cells (
To further investigate the effects of MAC deposition and protection, primary (passage 0) mouse RPE cells were pretreated with either a mixture of AdCAGCD59+AdCAGGFP (800+200 vp/cell respectively) or with a control mixture of AdEMPTY+AdCAGGFP (800+200 vp/cell respectively). After 7 minutes of NHS treatment, washing and fixation, cells were examined. Three days post-treatment, these cells were analyzed by the MAC deposition assay.
Presence of numerous GFP-positive vesicles associated with cells was observed (
Efficacy of hCD59 pretreatment to protect murine RPE from human MAC deposition was assessed. Mice were administered in vivo subretinal injections of each adenovirus vector. Six days after injection, expression of hCD59 on murine RPE following subretinal injection of the AdCAGCD59 vector was observed by immunohistochemistry with anti-hCD59 antibody (
For the MAC deposition assay, subretinal injections were performed in two groups of mice. Mice in one group were injected with a mixture of AdCAGCD59 and AdCAGGFP vectors in a 9:1 ratio (AdCAGGFP was co-injected to allow easy identification of the injection site and area of transgene expression by spontaneous fluorescence). Mice from the second group were injected with a control mixture of AdEMPTY and AdCAGGFP (negative controls) also in a 9:1 ratio. Six days after injection, eyes were harvested and eyecup tissues were exposed to anti-mouse emmprin and NHS, along with eyecup tissues from uninjected control mice.
Immunohistochemistry for human MAC of eyecup tissues injected with the mixture of AdCAGCD59 and AdCAGGFP (n=10) showed significantly reduced staining on the RPE at the area of GFP expression (which was used to identify and was found to correlate with hCD59 expression) compared to the uncontacted remaining area of eyecup tissue (
Quantification of the MAC immunofluorescence at the area of GFP expression revealed an overall reduction of ˜55% in mean MAC immunofluorescence intensity on the eyecup tissues injected with the mixture of AdCAGCD59 and AdCAGGFP (n=10) compared to eyecup tissues injected with the mixture of the negative control (n=10), a difference which was statistically significant (p=0.0014,
Eyecups were then pretreated with mixtures of each of AdEMPTY and AdCAGGFP, and with AdCAGCD59 and AdCAGGFP to analyze the possibility that reduced MAC was a function of transduction of the vector. No significant difference was observed in results between the two groups (n=10 per group) in GFP levels (
Quantification of reduction in MAC immunofluorescence at the area of GFP expression revealed an average of about 68% (p=0.0018) at 7.5 min NHS treatment and 56%) (p=0.0007) at 15 min NHS treatment on the AdCAGCD59+AdCAGGFP-pretreated eyecups compared to AdEMPTY+AdCAGGFP-pretreated eyecups (
It is possible that the difference in MAC deposition between AdCAGCD59 and negative control pretreated eyecup tissues was due to a difference in mouse emmprin expression and/or to a difference in anti-emmprin antibody binding. To evaluate this possibility, immunohistochemistry for mouse emmprin on eyecup tissues pretreated by pretreatment with the mixture of AdCAGCD59 and AdCAGGFP or eyecup tissues pretreated with the negative control (mixture of AdEMPTY+AdCAGGFP) was performed. Anti-mouse emmprin antibody analysis was performed using the same procedure as for the MAC deposition assay, and eyecup tissues were washed fixed and incubated with an appropriate Cy3-conjugated antibody. No differences in emmprin immunofluorescence on the RPE were observed between the area of transgene expression and the rest of the eyecup tissue (
No differences in emmprin immunofluorescence were observed between the areas of transgene expression of the mixture of AdCAGCD59+AdCAGGFP, and in control injected eyecups (
Primary murine RPE cells pretreated with AdCAGGFP (
Protection from MAC deposition was not due to differences in emmprin expression and/or anti-emmprin antibody binding as immunocytochemistry for mouse emmprin revealed no differences between control and AdCAGCD59 pretreated cells. The data described demonstrate the destructive effects of human MAC deposition on the RPE and on primary RPE cells and significant protection of these cells by expression of hCD59.
MAC deposition and protection by adenovirus-delivered hCD59 was further assayed using murine corneal epithelium. Corneal epithelium is easily accessible tissue and cultured, and pretreated with adenovirus and other vectors in vivo and ex vivo. In addition, assays herein using corneal endothelium were shown to be efficient for homogenous transduction of the endothelial cells and efficient measurement of other factors such as agents that affect complement regulators. Investigation of MAC deposition on corneal endothelium is further useful for screening inhibitors of MAC deposition and complements testing in RPE in vitro and in vivo.
Delivery ex vivo of hCD59 to the corneal endothelium was observed herein to significantly protect those cells from human MAC deposition upon further mixing with the anti-mouse emmprin antibody and 50% NHS for 20 minutes (
Contacting corneas with the anti-mouse emmprin antibody followed by addition of 50% NHS for 20 minutes at 37° C. resulted in extensive, bright MAC immunostaining on the corneal endothelium (
Data showed that expression of hCD59 on the corneal endothelium following ex vivo infection with the AdCAGCD59 was confirmed by immunohistochemistry using the anti-hCD59 antibody, while no staining for hCD59 was observed on control (AdCAGGFP)-pretreated corneas (
The protection from MAC deposition on the corneal endothelium of AdCAGCD59-pretreated corneas was shown not to be due to a difference in emmprin expression and/or anti-emmprin antibody binding, as immunohistochemistry data showed no differences in emmprin immunostaining on the corneal endothelium of each of AdCAGCD59 and AdCAGGFP-pretreated, and control not pretreated corneas (
These data further show that hCD59 pretreatment protects ocular tissues from MAC deposition. Protection on the corneal endothelium was observed to be higher than that of the RPE. Additional factors might affect this protection, such as higher and more homogenous transduction of endothelium of ex vivo pretreated corneas and efficiency of modulators and regulators of serum components, and of other possible agents that affect macular degeneration.
The CD59 constructs used in examples above was constructed to expression a membrane associated protein through a GPI linker. Human CD59 lacking the sequence coding for the C terminal 26 amino acids, which includes a signal sequence for attachment of the GPI anchor at the nucleotides encoding residue amino acid Asparagine at position 77 was PCR amplified using a forward primer containing an XhoI site (underlined) (5′ ccccctcgagtggacaatcacaatggg3′; SEQ ID No: 1) and a reverse primer with an EcoRV site (underlined) (5′ taaggagatatcttaattttcaagctgttcgtta3′; SEQ ID No: 3). The reverse primer introduced a stop codon following Asparagine 77 resulting in a sequence that encodes a soluble form of human CD59. The XhoI/EcoRV digested PCR product was cloned into XhoI/EcoRV digested pShCAG and the resulting plasmid pShCAGsCD59 was used to produce the adenovirus AdCAGsCD59 as described herein. Thus, the GPI signal was removed by recombinant methods to obtain a construct that expresses a soluble, secreted version, and analyses were performed to test whether the secreted version might be useful as a therapeutic agent, as it would more readily spread through the retina and confer protection from MAC deposition for cells that were not directly contacted and transduced with a gene transfer vector.
To evaluate this construct, cells were prepared that carry the soluble CD59 construct, either expressed on a plasmid or on an adenovirus, and were grown and expression in medium was determined.
To determine the effect of expression CD59 having no GPI signal, engineered so that soluble secreted CD59 protein spreads extracellularly through the retina and confers protection against MAC deposition on cells that were not directly transduced with a gene transfer vector, the soluble CD59 protein was expressed in retinal cells and in corneas. Thus these cells and tissues were prepared for in vivo testing of the soluble secreted CD59 construct as a potential improved therapeutic agent, to determine whether this construct is even more efficient in remediation of MAC deposition than the membrane-bound form.
Experiments were performed to determine the extent that the soluble secreted CD59 expressing vector protected tissues and cells from cell morphology changes and cell lysis associated with MAC deposition. The soluble secreted CD59 expressing vector was tested also in the a model of wet AMD.
Results from these experiments will be an indication of potential advantages of the soluble form of CD59 as a therapeutic agent for macular degeneration compared to the membrane-bound form. Additional possibilities include use of both the membrane-bound form and the soluble forms under different conditions, or in combination.
Kumar-Singh, Rajendra, Ramo, Kasmir, Cashman, Siobhan M
| Patent | Priority | Assignee | Title |
| 11654179, | Aug 28 2014 | Trustees of Tufts College | Compositions, methods and kits for treating complement related disorders |
| Executed on | Assignor | Assignee | Conveyance | Frame | Reel | Doc |
| Feb 13 2009 | Tufts University | (assignment on the face of the patent) | / | |||
| Aug 10 2010 | KUMAR-SINGH, RAJENDRA | Tufts University | ASSIGNMENT OF ASSIGNORS INTEREST SEE DOCUMENT FOR DETAILS | 024974 | /0056 | |
| Aug 10 2010 | CASHMAN, SIOBHAN | Tufts University | ASSIGNMENT OF ASSIGNORS INTEREST SEE DOCUMENT FOR DETAILS | 024974 | /0056 | |
| Sep 03 2010 | RAMO, KASMIR | Tufts University | ASSIGNMENT OF ASSIGNORS INTEREST SEE DOCUMENT FOR DETAILS | 024974 | /0056 | |
| Sep 28 2010 | TUFTS UNIVERSITY BOSTON | NATIONAL INSTITUTES OF HEALTH NIH , U S DEPT OF HEALTH AND HUMAN SERVICES DHHS , U S GOVERNMENT | CONFIRMATORY LICENSE SEE DOCUMENT FOR DETAILS | 026571 | /0553 |
| Date | Maintenance Fee Events |
| Jun 06 2016 | M2551: Payment of Maintenance Fee, 4th Yr, Small Entity. |
| Jun 04 2020 | M2552: Payment of Maintenance Fee, 8th Yr, Small Entity. |
| Oct 17 2022 | BIG: Entity status set to Undiscounted (note the period is included in the code). |
| Jun 04 2024 | M1553: Payment of Maintenance Fee, 12th Year, Large Entity. |
| Date | Maintenance Schedule |
| Dec 04 2015 | 4 years fee payment window open |
| Jun 04 2016 | 6 months grace period start (w surcharge) |
| Dec 04 2016 | patent expiry (for year 4) |
| Dec 04 2018 | 2 years to revive unintentionally abandoned end. (for year 4) |
| Dec 04 2019 | 8 years fee payment window open |
| Jun 04 2020 | 6 months grace period start (w surcharge) |
| Dec 04 2020 | patent expiry (for year 8) |
| Dec 04 2022 | 2 years to revive unintentionally abandoned end. (for year 8) |
| Dec 04 2023 | 12 years fee payment window open |
| Jun 04 2024 | 6 months grace period start (w surcharge) |
| Dec 04 2024 | patent expiry (for year 12) |
| Dec 04 2026 | 2 years to revive unintentionally abandoned end. (for year 12) |