Described are single domain antibodies with a specificity for BACE1. More specifically, described are single variable-domain antibodies derived from camelids that bind to BACE1 and are capable of inhibiting the activity of BACE1. The antibodies can be used for research and medical applications. Specific applications include the use of BACE1-specific antibodies for the treatment of Alzheimer's disease.
|
1. A single-domain antibody comprising the peptide of SEQ ID NO: 15.
2. The single-domain antibody of
3. The single-domain antibody of
4. A composition comprising:
the single domain antibody of
at least one pharmaceutically acceptable carrier.
5. A method of treating a subject suffering from Alzheimer's disease, the method comprising:
administering the single domain antibody of
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||
This application is a continuation of U.S. patent application Ser. No. 12/736,389, filed Dec. 27, 2010, pending, which application is a national stage filing under 35 U.S.C. § 371 of International Application No. PCT/EP2009/053985, filed on Apr. 3, 2009, and published in English on Oct. 8, 2009 as WO 2009/121948 A2, which application claims the benefit of U.S. Patent Application Ser. No. 61/041,965, filed Apr. 3, 2008.
Described are single domain antibodies with a specificity for BACE1. More specifically, described are single variable-domain antibodies derived from camelids that bind to BACE1 and are capable of inhibiting the activity of BACE1. The antibodies can be used for research and medical applications. Specific applications include the use of BACE1-specific antibodies for the treatment of Alzheimer's disease.
Alzheimer's disease (“AD”) is a devastating neurodegenerative disease that affects millions of elderly patients worldwide and is the most common cause of nursing home admittance. AD is clinically characterized by progressive loss of memory, orientation, cognitive function, judgment and emotional stability. With increasing age, the risk of developing AD increases exponentially, so that by age 85, some 20% to 40% of the population is affected. Memory and cognitive function deteriorate rapidly within the first five years after diagnosis of mild to moderate impairment, and death due to disease complications is an inevitable outcome. Definitive diagnosis of AD can only be made post-mortem, based on histopathological examination of brain tissue from the patient. Two histological hallmarks of AD are the occurrence of neurofibrillar tangles of hyperphosphorylated tau protein and of proteinaceous amyloid plaques, both within the cerebral cortex of AD patients. The amyloid plaques are composed mainly of a peptide of 37 to 43 amino acids designated “beta-amyloid,” also referred to as “beta amyloid,” “amyloid beta,” “Aβ” or “Abeta.” It is now clear that the Abeta peptide is derived from a type 1 integral membrane protein, termed “beta amyloid precursor protein” (also referred to as “APP”) through two sequential proteolytic events. First, the APP is hydrolyzed at a site N-terminal of the transmembrane alpha helix by a specific proteolytic enzyme referred to as “beta-secretase” (the membrane-bound protease BACE1). The soluble N-terminal product of this cleavage event diffuses away from the membrane, leaving behind the membrane-associated C-terminal cleavage product, referred to as “C99.” The protein C99 is then further hydrolyzed within the transmembrane alpha helix by a specific proteolytic enzyme referred to as “gamma-secretase.” This second cleavage event liberates the Abeta peptide and leaves a membrane-associated “stub.” The Abeta peptide thus generated is secreted from the cell into the extracellular matrix where it eventually forms the amyloid plaques associated with AD.
Despite intensive research during the last 100 years, prognosis of AD patients now is still quite the same as that of patients a century ago, since there is still no real cure available. There are two types of drugs approved by the U.S. Food and Drug Administration and used in clinics today to treat AD: Acetylcholinesterase (AchE) inhibitors and Memantine. There is ample evidence in the art that the amyloid beta peptide, the main component of the amyloid plaques that are specific to the AD etiology, has a key role in the development of AD disease. Therefore, one of the most favorite strategies to lower Aβ is to diminish its production by γ- and β-secretase inhibitors. One strategy was the development of gamma-secretase inhibitors; however, such inhibitors often result in serious side effects since gamma-secretase is involved in the proteolytic processing of at least 30 proteins.
Yet another attractive strategy is the development of BACE1 inhibitors. BACE1 is produced as a prepropeptide. The 21-amino acid signal peptide translocates the protease into the ER where the signal peptide is cleaved off and from where BACE1 is then directed to the cell surface. After its passage through the trans-Golgi network (TGN), part of BACE1 is targeted to the cell surface from where it is internalized into early endosomal compartments. BACE1 then either enters a direct recycling route to the cell surface or is targeted to late endosomal vesicles destined for the lysosomes or for the TGN. At the TGN, it might be retransported to the cell membrane. Given its long half-life and fast recycling rate, mature BACE1 may cycle multiple times between cell surface, endosomal system and TGN during the course of its lifespan. BACE1 inhibitory antibodies are described in US20060034848.
Herein, we sought to develop alternative inhibitors of the activity of BACE1 through the generation of single chain antibodies with a specificity for BACE1. In the resulting collection of binders of BACE1, we identified inhibitors of BACE1. In particular, these BACE1-specific camelid antibodies capable of inhibiting BACE1 activity can be used for the treatment of Alzheimer's disease.
Described are BACE1 single variable-domain antibodies that can be used in research and medical applications. More specifically, described is the detection of BACE1 overexpression and to the treatment of Alzheimer's disease using BACE1 single domain antibodies. As used herein, the antibodies are devoid of any light chain but comprise at least one heavy chain antibody. In a particular embodiment, the variable domain of a heavy chain antibody is derived from camelids. Such a variable domain heavy chain antibody is herein designated as a NANOBODY® or a VHH antibody. NANOBODY®, NANOBODIES®, and NANOCLONE® are trademarks of Ablynx NV (Belgium).
Thus, in a first embodiment, provided is a single variable-domain antibody, devoid of a light chain, specifically binding to BACE1. In a particular embodiment, the single domain antibody is derived from camelids. In the family of “camelids,” immunoglobulins devoid of light polypeptide chains are found. “Camelids” comprise old-world camelids (Camelus bactrianus and Camelus dromaderius) and new world camelids (for example, Lama paccos, Lama glama and Lama vicugna).
In another embodiment, provided is a single domain antibody derived from camelids, which amino acid sequence comprises SEQ ID NOS:1-28. The amino acid sequences of the dromedary/llama NANOBODIES® (also designated as VHH antibodies) are depicted in
In yet another embodiment, the single domain antibody is capable of inhibiting the activity of BACE1. It is understood that “inhibition of the activity” is equivalent with the wording “down-regulating the activity.” Generally, “inhibition” means that the activity of BACE1 is inhibited by at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or even 96%, 97%, 98%, 99% or even 100%. Inhibition of BACE1 can be determined as mentioned herein further in the examples.
In yet another embodiment, the single domain antibody is capable of inhibiting the activity of BACE1 and it comprises at least one of the complementarity-determining regions (CDRs) with an amino acid sequence selected from the group comprising SEQ ID NOS:29-37.
In yet another embodiment, the single domain antibody is capable of preventing the uptake of pro-BACE1 and its amino acid sequence comprises SEQ ID NOS:6, 22 or 26.
It should be noted that the term “NANOBODY®” as used herein in its broadest sense is not limited to a specific biological source or to a specific method of preparation. For example, the NANOBODIES® hereof can generally be obtained: (1) by isolating the VHH domain of a naturally occurring heavy chain antibody; (2) by expression of a nucleotide sequence encoding a naturally occurring VHH domain; (3) by “humanization” of a naturally occurring VHH domain or by expression of a nucleic acid encoding a such humanized VHH domain; (4) by “camelization” of a naturally occurring VH domain from any animal species and, in particular, from a mammalian species, such as from a human being, or by expression of a nucleic acid encoding such a camelized VH domain; (5) by “camelization” of a “domain antibody” or “Dab” as described in the art, or by expression of a nucleic acid encoding such a camelized VH domain; (6) by using synthetic or semi-synthetic techniques for preparing proteins, polypeptides or other amino acid sequences known per se; (7) by preparing a nucleic acid encoding a NANOBODY® using techniques for nucleic acid synthesis known per se, followed by expression of the nucleic acid thus obtained; and/or (8) by any combination of one or more of the foregoing. One preferred class of NANOBODIES® corresponds to the VHH domains of naturally occurring heavy chain antibodies directed against BACE1. As further described herein, such VHH sequences can generally be generated or obtained by suitably immunizing a species of camelid with BACE1 (i.e., so as to raise an immune response and/or heavy chain antibodies directed against BACE1), by obtaining a suitable biological sample from the camelid (such as a blood sample, serum sample or sample of B-cells), and by generating VHH sequences directed against BACE1, starting from the sample, using any suitable technique known per se. Such techniques will be clear to the skilled person.
Alternatively, such naturally occurring VHH domains against BACE1 can be obtained from naive libraries of Camelid VHH sequences, for example, by screening such a library using BACE1 or at least one part, fragment, antigenic determinant or epitope thereof using one or more known screening techniques per se. Such libraries and techniques are, for example, described in WO9937681, WO0190190, WO03025020 and WO03035694. Alternatively, improved synthetic or semi-synthetic libraries derived from naive VHH libraries may be used, such as VHH libraries obtained from naive VHH libraries by techniques such as random mutagenesis and/or CDR shuffling, such as, for example, described in WO0043507. Yet another technique for obtaining VHH sequences directed against BACE1 involves suitably immunizing a transgenic mammal that is capable of expressing heavy chain antibodies (i.e., so as to raise an immune response and/or heavy chain antibodies directed against BACE1), obtaining a suitable biological sample from the transgenic mammal (such as a blood sample, serum sample or sample of B-cells), and then generating VHH sequences directed against BACE1 starting from the sample, using any suitable technique known per se. For example, for this purpose, the heavy chain antibody-expressing mice and the further methods and techniques described in WO02085945 and in WO04049794 can be used.
A particularly preferred class of NANOBODIES® hereof comprises NANOBODIES® with an amino acid sequence that corresponds to the amino acid sequence of a naturally occurring VHH domain, but that has been “humanized,” i.e., by replacing one or more amino acid residues in the amino acid sequence of the naturally occurring VHH sequence (and, in particular, in the framework sequences) by one or more of the amino acid residues that occur at the corresponding position(s) in a VH domain from a conventional four-chain antibody from a human being. This can be performed in a manner known per se, which will be clear to the skilled person, for example, on the basis of the further description herein and the prior art on humanization referred to herein. Again, it should be noted that such humanized NANOBODIES® of the invention can be obtained in any suitable manner known per se (i.e., as indicated under points (1)-(8) above) and, thus, are not strictly limited to polypeptides that have been obtained using a polypeptide that comprises a naturally occurring VHH domain as a starting material.
Another particularly preferred class of NANOBODIES® of the invention comprises NANOBODIES® with an amino acid sequence that corresponds to the amino acid sequence of a naturally occurring VH domain, but that has been “camelized,” i.e., by replacing one or more amino acid residues in the amino acid sequence of a naturally occurring VH domain from a conventional four-chain antibody by one or more of the amino acid residues that occur at the corresponding position(s) in a VHH domain of a heavy chain antibody. Such “camelizing” substitutions are preferably inserted at amino acid positions that form and/or are present at the VH-VL interface, and/or at the so-called Camelidae hallmark residues, as defined herein (see, for example, WO9404678). Preferably, the VH sequence that is used as a starting material or starting point for generating or designing the camelized NANOBODY® is preferably a VH sequence from a mammal, more preferably, the VH sequence of a human being, such as a VH3 sequence. However, it should be noted that such camelized NANOBODIES® of the invention can be obtained in any suitable manner known per se (i.e., as indicated under points (1)-(8) above) and, thus, are not strictly limited to polypeptides that have been obtained using a polypeptide that comprises a naturally occurring VH domain as a starting material. For example, both “humanization” and “camelization” can be performed by providing a nucleotide sequence that encodes a naturally occurring VHH domain or VH domain, respectively, and then changing, in a manner known per se, one or more codons in the nucleotide sequence in such a way that the new nucleotide sequence encodes a “humanized” or “camelized” NANOBODY® of the invention, respectively. This nucleic acid can then be expressed in a manner known per se, so as to provide the desired NANOBODY® of the invention.
Alternatively, based on the amino acid sequence of a naturally occurring VHH domain or VH domain, respectively, the amino acid sequence of the desired humanized or camelized NANOBODY® of the invention, respectively, can be designed and then synthesized de novo using techniques for peptide synthesis known per se. Also, based on the amino acid sequence or nucleotide sequence of a naturally occurring VHH domain or VH domain, respectively, a nucleotide sequence encoding the desired humanized or camelized NANOBODY® hereof, respectively, can be designed and then synthesized de novo using techniques for nucleic acid synthesis known per se, after which the nucleic acid thus obtained can be expressed in a manner known per se, so as to provide the desired NANOBODY® of the invention. Other suitable methods and techniques for obtaining the NANOBODIES® hereof and/or nucleic acids encoding the same, starting from naturally occurring VH sequences or preferably VHH sequences, will be clear from the skilled person, and may, for example, comprise combining one or more parts of one or more naturally occurring VH sequences (such as one or more FR sequences and/or CDR sequences), one or more parts of one or more naturally occurring VHH sequences (such as one or more FR sequences or CDR sequences), and/or one or more synthetic or semi-synthetic sequences, in a suitable manner, so as to provide a NANOBODY® hereof or a nucleotide sequence or nucleic acid encoding the same.
According to one non-limiting aspect hereof, a NANOBODY® may be as defined herein, but with the proviso that it has at least “one amino acid difference” (as defined herein) in at least one of the framework regions compared to the corresponding framework region of a naturally occurring human VH domain, and, in particular, compared to the corresponding framework region of DP-47. More specifically, according to one non-limiting aspect of the invention, a NANOBODY® may be as defined herein, but with the proviso that it has at least “one amino acid difference” (as defined herein) at at least one of the Hallmark residues (including those at positions 108, 103 and/or 45) compared to the corresponding framework region of a naturally occurring human VH domain, and, in particular, compared to the corresponding framework region of DP-47. Usually, a NANOBODY® will have at least one such amino acid difference with a naturally occurring VH domain in at least one of FR2 and/or FR4, and, in particular, at at least one of the Hallmark residues in FR2 and/or FR4 (again, including those at positions 108, 103 and/or 45). Also, a humanized NANOBODY® hereof may be as defined herein, but with the proviso that it has at least “one amino acid difference” (as defined herein) in at least one of the framework regions compared to the corresponding framework region of a naturally occurring VHH domain. More specifically, according to one non-limiting aspect hereof, a NANOBODY® may be as defined herein, but with the proviso that it has at least “one amino acid difference” (as defined herein) at at least one of the Hallmark residues (including those at positions 108, 103 and/or 45) compared to the corresponding framework region of a naturally occurring VHH domain. Usually, a NANOBODY® will have at least one such amino acid difference with a naturally occurring VHH domain in at least one of FR2 and/or FR4, and, in particular, at at least one of the Hallmark residues in FR2 and/or FR4 (again, including those at positions 108, 103 and/or 45). As will be clear from the disclosure herein, it is also within the scope hereof to use natural or synthetic analogs, mutants, variants, alleles, homologs and orthologs (herein collectively referred to as “analogs”) of the NANOBODIES® hereof as defined herein, and, in particular, analogs of the NANOBODIES® of SEQ ID NOS:6, 22 or 26. Thus, according to one embodiment, the term “NANOBODY® hereof” in its broadest sense also covers such analogs. Generally, in such analogs, one or more amino acid residues may have been replaced, deleted and/or added, compared to the NANOBODIES® hereof as defined herein. Such substitutions, insertions or deletions may be made in one or more of the framework regions and/or in one or more of the CDRs, and, in particular, analogs of the CDRs of the NANOBODIES® of SEQ ID NOS:6, 22 or 26, the CDRs corresponding with SEQ ID NOS:29-37 (see Table 1,
TABLE 1
CDRs of BACE1-specific NANOBODIES ®
Nb
CDR1
CDR2
CDR3
Nb_B9
EYTYGYCSMG
TITSDGSTSYV
KTCANKLGAKFIS
(SEQ ID
(SEQ ID NO:
DSVKG (SEQ
(SEQ ID NO:
NO: 6)
29)
ID NO: 30)
31)
Nb_10C4
GYTYSTCSMA
SIRNDGSTAYA
RIGVGPGGTCSIYA
(SEQ ID
(SEQ ID NO:
DSVKG (SEQ
PY (SEQ ID NO:
NO: 22)
32)
ID NO: 33)
34)
Nb_4A2
GFTFETQYMT
SINSGGTIKYY
GQWAGVGAASS
(SEQ ID
(SEQ ID NO:
ANSSVKG (SEQ
(SEQ ID NO:
NO: 26)
35)
ID NO: 36)
37)
When such substitutions, insertions or deletions are made in one or more of the framework regions, they may be made at one or more of the Hallmark residues and/or at one or more of the other positions in the framework residues. Substitutions, insertions or deletions at the Hallmark residues are generally less preferred (unless these are suitable humanizing substitutions as described herein). By means of non-limiting examples, a substitution may, for example, be a conservative substitution (as described herein) and/or an amino acid residue may be replaced by another amino acid residue that naturally occurs at the same position in another VHH domain. Thus, any one or more substitutions, deletions or insertions, or any combination thereof, that either improve the properties of the NANOBODY® hereof or that at least do not detract too much from the desired properties or from the balance or combination of desired properties of the NANOBODY® of the invention (i.e., to the extent that the NANOBODY® is no longer suited for its intended use) are included within the scope of the disclosure.
A skilled person will generally be able to determine and select suitable substitutions, deletions or insertions, or suitable combinations thereof, based on the disclosure herein and optionally after a limited degree of routine experimentation, which may, for example, involve introducing a limited number of possible substitutions and determining their influence on the properties of the NANOBODIES® thus obtained. For example, and depending on the host organism used to express the NANOBODY® or polypeptide of the disclosure, such deletions and/or substitutions may be designed in such a way that one or more sites for post-translational modification (such as one or more glycosylation sites) are removed, as will be within the ability of the person skilled in the art.
Alternatively, substitutions or insertions may be designed so as to introduce one or more sites for attachment of functional groups (as described herein), for example, to allow site-specific pegylation. One preferred class of analogs of the NANOBODIES® hereof comprise NANOBODIES® that have been humanized (i.e., compared to the sequence of a naturally occurring NANOBODY® of the invention). As mentioned in the background art cited herein, such humanization generally involves replacing one or more amino acid residues in the sequence of a naturally occurring VHH with the amino acid residues that occur at the same position in a human VH domain, such as a human VH3 domain.
Examples of possible humanizing substitutions or combinations of humanizing substitutions will be clear to the skilled person, from the possible humanizing substitutions mentioned in the background art cited herein, and/or from a comparison between the sequence of a NANOBODY® and the sequence of a naturally occurring human VH domain. The humanizing substitutions should be chosen such that the resulting humanized NANOBODIES® still retain the favorable properties of NANOBODIES® as defined herein and, more preferably, such that they are as described for analogs in the preceding paragraphs. A skilled person will generally be able to determine and select suitable humanizing substitutions or suitable combinations of humanizing substitutions, based on the disclosure herein and optionally after a limited degree of routine experimentation, which may, for example, involve introducing a limited number of possible humanizing substitutions and determining their influence on the properties of the NANOBODIES® thus obtained. Generally, as a result of humanization, the NANOBODIES® of the disclosure may become more “human-like,” while still retaining the favorable properties of the NANOBODIES® of the invention as described herein. As a result, such humanized NANOBODIES® may have several advantages, such as a reduced immunogenicity, compared to the corresponding naturally occurring VHH domains.
Again, based on the disclosure herein and optionally after a limited degree of routine experimentation, the skilled person will be able to select humanizing substitutions or suitable combinations of humanizing substitutions that optimize or achieve a desired or suitable balance between the favorable properties provided by the humanizing substitutions on the one hand and the favorable properties of naturally occurring VHH domains on the other hand. Examples of such modifications, as well as examples of amino acid residues within the NANOBODY® sequence that can be modified in such a manner (i.e., either on the protein backbone but preferably on a side chain), methods and techniques that can be used to introduce such modifications and the potential uses and advantages of such modifications will be clear to the skilled person. For example, such a modification may involve the introduction (e.g., by covalent linking or in another suitable manner) of one or more functional groups, residues or moieties into or onto the NANOBODY® of the invention, and, in particular, of one or more functional groups, residues or moieties that confer one or more desired properties or functionalities to the NANOBODY® of the invention.
Examples of such functional groups and of techniques for introducing them will be clear to the skilled person, and can generally comprise all functional groups and techniques mentioned in the general background art cited hereinabove, as well as the functional groups and techniques known per se for the modification of pharmaceutical proteins and, in particular, for the modification of antibodies or antibody fragments (including ScFvs and single domain antibodies), for which reference is, for example, made to Remington's Pharmaceutical Sciences, 16th ed., Mack Publishing Co., Easton, Pa. (1980). Such functional groups may, for example, be linked directly (for example, covalently) to a NANOBODY® of the invention, or optionally, via a suitable linker or spacer, as will again be clear to the skilled person.
One of the most widely used techniques for increasing the half-life and/or reducing immunogenicity of pharmaceutical proteins comprises attachment of a suitable pharmacologically acceptable polymer, such as poly(ethyleneglycol) (PEG) or derivatives thereof (such as methoxypoly(ethyleneglycol) or mPEG). Generally, any suitable form of pegylation can be used, such as the pegylation used in the art for antibodies and antibody fragments (including, but not limited to, (single) domain antibodies and ScFvs); reference is made to, for example, Chapman, Nat. Biotechnol. 54:531-545 (2002); by Veronese and Harris, Adv. Drug Deliv. Rev. 54:453-456 (2003); by Harris and Chess, Nat. Rev. Drug Discov. 2 (2003); and in WO04060965. Various reagents for pegylation of proteins are also commercially available, for example, from Nektar Therapeutics, USA. Preferably, site-directed pegylation is used, in particular, via a cysteine-residue (see, for example, Yang et al., Protein Engineering 16, 10:761-770 (2003). For example, for this purpose, PEG may be attached to a cysteine residue that naturally occurs in a NANOBODY® hereof. A NANOBODY® hereof may be modified so as to suitably introduce one or more cysteine residues for attachment of PEG, or an amino acid sequence comprising one or more cysteine residues for attachment of PEG may be fused to the N- and/or C-terminus of a NANOBODY® hereof, all using techniques of protein engineering known per se to the skilled person. Preferably, for the NANOBODIES® and proteins of the disclosure, a PEG is used with a molecular weight of more than 5000, such as more than 10,000 and less than 200,000, such as less than 100,000; for example, in the range of 20,000-80,000.
Another, usually less preferred modification comprises N-linked or O-linked glycosylation, usually as part of co-translational and/or post-translational modification, depending on the host cell used for expressing the NANOBODY® or polypeptide of the disclosure. Yet another modification may comprise the introduction of one or more detectable labels or other signal-generating groups or moieties, depending on the intended use of the labeled NANOBODY®. Suitable labels and techniques for attaching, using and detecting them will be clear to the skilled person and, for example, include, but are not limited to, fluorescent labels (such as fluorescein, isothiocyanate, rhodamine, phycoerythrin, phycocyanin, allophycocyanin, o-phthaldehyde, and fluorescamine and fluorescent metals such as Eu or others metals from the lanthanide series), phosphorescent labels, chemiluminescent labels or bioluminescent labels (such as luminal, isoluminol, theromatic acridinium ester, imidazole, acridinium salts, oxalate ester, dioxetane or GFP and its analogs), radio-isotopes, metals, metal chelates or metallic cations or other metals or metallic cations that are particularly suited for use in in vivo, in vitro or in situ diagnosis and imaging, as well as chromophores and enzymes (such as malate dehydrogenase, staphylococcal nuclease, delta-V-steroid isomerase, yeast alcohol dehydrogenase, alpha-glycerophosphate dehydrogenase, triose phosphate isomerase, biotinavidin peroxidase, horseradish peroxidase, alkaline phosphatase, asparaginase, glucose oxidase, beta-galactosidase, ribonuclease, urease, catalase, glucose-VI-phosphate dehydrogenase, glucoamylase and acetylcholine esterase). Other suitable labels will be clear to the skilled person and, for example, include moieties that can be detected using NMR or ESR spectroscopy. Such labeled NANOBODIES® and polypeptides of the disclosure may, for example, be used for in vitro, in vivo or in situ assays (including immunoassays known per se, such as ELISA, RIA, EIA and other “sandwich assays,” etc.) as well as in vivo diagnostic and imaging purposes, depending on the choice of the specific label.
As will be clear to the skilled person, another modification may involve the introduction of a chelating group, for example, to chelate one of the metals or metallic cations referred to above. Suitable chelating groups include, for example, without limitation, diethyl-enetriaminepentaacetic acid (DTPA) or ethylenediaminetetraacetic acid (EDTA).
Yet another modification may comprise the introduction of a functional group that is one part of a specific binding pair, such as the biotin-(strept)avidin binding pair. Such a functional group may be used to link the NANOBODY® of the invention to another protein, polypeptide or chemical compound that is bound to the other half of the binding pair, i.e., through formation of the binding pair. For example, a NANOBODY® hereof may be conjugated to biotin, and linked to another protein, polypeptide, compound or carrier conjugated to avidin or streptavidin. For example, such a conjugated NANOBODY® may be used as a reporter, for example, in a diagnostic system where a detectable signal-producing agent is conjugated to avidin or streptavidin. Such binding pairs may, for example, also be used to bind the NANOBODY® of the invention to a carrier, including carriers suitable for pharmaceutical purposes. One non-limiting example is the liposomal formulations described by Cao and Suresh, Journal of Drug Targeting 8, 4:257 (2000). Such binding pairs may also be used to link a therapeutically active agent to the NANOBODY® hereof.
It is expected that the NANOBODIES® and polypeptides of the disclosure will generally bind to all naturally occurring or synthetic analogs, variants, mutants, alleles, parts and fragments of BACE1, or at least to those analogs, variants, mutants, alleles, parts and fragments of BACE1, that contain one or more antigenic determinants or epitopes that are essentially the same as the antigenic determinant(s) or epitope(s) to which the NANOBODIES® and polypeptides of the disclosure bind in BACE1 (e.g., in wild-type BACE1). Again, in such a case, the NANOBODIES® and polypeptides of the disclosure may bind to such analogs, variants, mutants, alleles, parts and fragments with an affinity and/or specificity that are the same as, or different from (i.e., higher than or lower than), the affinity and specificity with which the NANOBODIES® hereof bind to (wild-type) BACE1.
It is also included within the scope hereof that the NANOBODIES® and polypeptides of the disclosure bind to some analogs, variants, mutants, alleles, parts and fragments of BACE1, but not to others. Also, in determining the degree of sequence identity between two amino acid sequences, the skilled person may take into account so-called “conservative” amino acid substitutions, which can generally be described as amino acid substitutions in which an amino acid residue is replaced with another amino acid residue of similar chemical structure and which has little or essentially no influence on the function, activity or other biological properties of the polypeptide. Such conservative amino acid substitutions are well known in the art, for example, from WO04037999, WO9849185, WO0046383 and WO0109300; and (preferred) types and/or combinations of such substitutions may be selected on the basis of the pertinent teachings from WO04037999, as well as WO9849185. Such conservative substitutions preferably are substitutions in which one amino acid within the following groups (a)-(e) is substituted by another amino acid residue within the same group: (a) small aliphatic, nonpolar or slightly polar residues: Ala, Ser, Thr, Pro and Gly; (b) polar, negatively charged residues and their (uncharged) amides: Asp, Asn, Glu and Gln; (c) polar, positively charged residues: His, Arg and Lys; (d) large aliphatic, nonpolar residues: Met, Leu, His, Val and Cys; and (e) aromatic residues: Phe, Tyr and Trp. Particularly preferred conservative substitutions are as follows: Ala into Gly or into Ser; Arg into Lys; Asn into Gln or into His; Asp into Glu; Cys into Ser; Gln into Asn; Glu into Asp; Gly into Ala or into Pro; His into Asn or into GIn; His into Leu or into Val; Leu into His or into Val; Lys into Arg, into Gln or into Glu; Met into Leu, into Tyr or into His; Phe into Met, into Leu or into Tyr; Ser into Thr; Thr into Ser; Trp into Tyr; Tyr into Trp; and/or Phe into Val, into His or into Leu.
Polypeptide therapeutics and, in particular, antibody-based therapeutics, have significant potential as drugs because they have exquisite specificity to their target and a low inherent toxicity. However, it is known by the skilled person that an antibody that has been obtained for a therapeutically useful target requires additional modification in order to prepare it for human therapy, so as to avoid an unwanted immunological reaction in a human individual upon administration. The modification process is commonly termed “humanization.” It is known by the skilled artisan that antibodies raised in species, other than in humans, require humanization to render the antibody therapeutically useful in humans ((1) CDR grafting: Protein Design Labs: U.S. Pat. No. 6,180,370, U.S. Pat. No. 5,693,761; Genentech U.S. Pat. No. 6,054,297; Celltech: EP626390, U.S. Pat. No. 5,859,205; (2) Veneering: Xoma: U.S. Pat. No. 5,869,619, U.S. Pat. No. 5,766,886, U.S. Pat. No. 5,821,123). There is a need for a method for producing antibodies that avoids the requirement for substantial humanization or that completely obviates the need for humanization.
There is a need for a new class of antibodies that have defined framework regions or amino acid residues and that can be administered to a human subject without the requirement for substantial humanization, or the need for humanization at all. According to one aspect of the invention, NANOBODIES® are polypeptides that are derived from heavy chain antibodies and whose framework regions and complementary determining regions are part of a single domain polypeptide. Examples of such heavy chain antibodies include, but are not limited to, naturally occurring immunoglobulins devoid of light chains. Such immunoglobulins are disclosed in WO9404678, for example. The antigen-binding site of this unusual class of heavy chain antibodies has a unique structure that comprises a single variable domain. For clarity reasons, the variable domain derived from a heavy chain antibody naturally devoid of light chain is known herein as a VHH or VHH domain or NANOBODY®. Such a VHH domain peptide can be derived from antibodies raised in Camelidae species, for example, in camel, dromedary, llama, alpaca and guanaco. Other species besides Camelidae (e.g., shark, pufferfish) may produce functional antigen-binding heavy chain antibodies naturally devoid of light chain. VHH domains derived from such heavy chain antibodies are within the scope of the invention.
Camelidae antibodies express a unique, extensive repertoire of functional heavy chain antibodies that lack light chains. The VHH molecules derived from Camelidae antibodies are the smallest intact antigen-binding domains known (approximately 15 kDa, or ten times smaller than conventional IgG) and, hence, are well suited toward delivery to dense tissues and for accessing the limited space between macromolecules. Other examples of NANOBODIES® include NANOBODIES® derived from VH domains of conventional four-chain antibodies that have been modified by substituting one or more amino acid residues with Camelidae-specific residues (the so-called camelization of heavy chain antibodies, WO9404678). Such positions may preferentially occur at the VH-VL interface and at the so-called Camelidae hallmark residues (WO9404678), comprising positions 37, 44, 45, 47, 103 and 108. NANOBODIES® correspond to small, robust and efficient recognition units formed by a single immunoglobulin (Ig) domain.
A “fragment of a NANOBODY®” as used herein refers to less than 100% of the sequence (e.g., 99%, 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10% etc.), but comprising 5, 6, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more amino acids. A fragment is preferably of sufficient length such that the interaction of interest is maintained with affinity of 1×106 M or better. A “fragment” as used herein also refers to optional insertions, deletions and substitutions of one or more amino acids that do not substantially alter the ability of the target to bind to a NANOBODY® raised against the wild-type target. The number of amino acid insertions, deletions or substitutions is preferably up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69 or 70 amino acids. One embodiment of the present invention relates to a polypeptide comprising at least one NANOBODY® wherein one or more amino acid residues have been substituted without substantially altering the antigen binding capacity.
In a particular embodiment, the antibody of the invention is bivalent and formed by bonding together, chemically or by recombinant DNA techniques, two monovalent single domains of heavy chains. In another particular embodiment, the antibody of the invention is bi-specific and formed by bonding together two variable domains of heavy chains, each with a different specificity (i.e., one with a specificity for BACE1 and the other one with a specificity for a neuron, such as, for example, ICAM5 or telencephalin). Similarly, polypeptides comprising multivalent or multi-specific single domain antibodies are included here as non-limiting examples.
In yet another embodiment, a single domain antibody that is capable of preventing the uptake of BACE1 can be used as a medicament. In yet another embodiment, a single domain antibody that comprises at least one of the complementarity-determining regions (CDRs) with an amino acid sequence selected from the group comprising SEQ ID NOS:29-37 can be used as a medicament. In yet another embodiment, a single domain antibody, which amino acid comprises SEQ ID NOS:6, 22 or 26, can be used as a medicament.
In yet another embodiment, a single domain antibody that is capable of preventing the uptake of pro-BACE1 can be used for the manufacture of a medicament to treat diseases associated with an overexpression of BACE1. An example of a disease where an overexpression of BACE1 occurs is Alzheimer's disease. In general, “therapeutically effective amount,” “therapeutically effective dose” and “effective amount” means the amount needed to achieve the desired result or results (inhibiting BACE1 binding; treating or preventing Alzheimer's disease). One of ordinary skill in the art will recognize that the potency and, therefore, an “effective amount” can vary for the NANOBODY® that inhibits BACE1 binding used in the invention. One skilled in the art can readily assess the potency of the NANOBODY®. By “pharmaceutically acceptable” is meant a material that is not biologically or otherwise undesirable, i.e., the material may be administered to an individual along with the compound without causing any undesirable biological effects or interacting in a deleterious manner with any of the other components of the pharmaceutical composition in which it is contained.
The term “medicament to treat” relates to a composition comprising antibodies as described above and a pharmaceutically acceptable carrier or excipient (both terms can be used interchangeably) to treat or to prevent diseases as described herein. The administration of a NANOBODY® as described above or a pharmaceutically acceptable salt thereof may be by way of oral, inhaled or parenteral administration. In particular embodiments, the NANOBODY® is delivered through intrathecal or intracerebroventricular administration. The active compound may be administered alone or preferably formulated as a pharmaceutical composition.
An amount effective to treat Alzheimer's disease that expresses the antigen recognized by the NANOBODY® depends on the usual factors, such as the nature and severity of the disorder being treated and the weight of the mammal. However, a unit dose will normally be in the range of 0.01 to 50 mg, for example, 0.01 to 10 mg, or 0.05 to 2 mg of NANOBODY® or a pharmaceutically acceptable salt thereof. Unit doses will normally be administered once or more than once a day, for example, two, three, or four times a day, more usually one to three times a day, such that the total daily dose is normally in the range of 0.0001 to 1 mg/kg; thus a suitable total daily dose for a 70 kg adult is 0.01 to 50 mg, for example, 0.01 to 10 mg or more, usually 0.05 to 10 mg.
In certain embodiments, the compound or a pharmaceutically acceptable salt thereof is administered in the form of a unit-dose composition, such as a unit dose oral, parenteral, or inhaled composition. Such compositions are prepared by admixture and are suitably adapted for oral, inhaled or parenteral administration and, as such, may be in the form of tablets, capsules, oral liquid preparations, powders, granules, lozenges, reconstitutable powders, injectable and infusable solutions or suspensions or suppositories or aerosols. Tablets and capsules for oral administration are usually presented in a unit dose, and contain conventional excipients such as binding agents, fillers, diluents, tableting agents, lubricants, disintegrants, colorants, flavorings, and wetting agents. The tablets may be coated according to well-known methods in the art. Suitable fillers for use include cellulose, mannitol, lactose and other similar agents. Suitable disintegrants include starch, polyvinylpyrrolidone and starch derivatives such as sodium starch glycolate. Suitable lubricants include, for example, magnesium stearate. Suitable pharmaceutically acceptable wetting agents include sodium lauryl sulphate. These solid oral compositions may be prepared by conventional methods of blending, filling, tableting, or the like. Repeated blending operations may be used to distribute the active agent throughout those compositions employing large quantities of fillers. Such operations are, of course, conventional in the art.
Oral liquid preparations may be in the form of, for example, aqueous or oily suspensions, solutions, emulsions, syrups, or elixirs, or may be presented as a dry product for reconstitution with water or other suitable vehicle before use. Such liquid preparations may contain conventional additives such as suspending agents, for example, sorbitol, syrup, methyl cellulose, gelatin, hydroxyethylcellulose, carboxymethyl cellulose, aluminium stearate gel or hydrogenated edible fats, emulsifying agents, for example, lecithin, sorbitan monooleate, or acacia; non-aqueous vehicles (which may include edible oils), for example, almond oil, fractionated coconut oil, oily esters such as esters of glycerine, propylene glycol, or ethyl alcohol; preservatives, for example, methyl or propyl p-hydroxybenzoate or sorbic acid, and, if desired, conventional flavoring or coloring agents. Oral formulations also include conventional sustained release formulations, such as tablets or granules having an enteric coating.
Preferably, compositions for inhalation are presented for administration to the respiratory tract as a snuff or an aerosol or solution for a nebulizer, or as a microfine powder for insufflation, alone or in combination with an inert carrier such as lactose. In such a case, the particles of active compound suitably have diameters of less than 50 microns, preferably less than 10 microns, for example, between 1 and 5 microns, such as between 2 and 5 microns. A favored inhaled dose will be in the range of 0.05 to 2 mg, for example, 0.05 to 0.5 mg, 0.1 to 1 mg or 0.5 to 2 mg.
For parenteral administration, fluid unit dose forms are prepared containing a compound of the present invention and a sterile vehicle. The active compound, depending on the vehicle and the concentration, can be either suspended or dissolved. Parenteral solutions are normally prepared by dissolving the compound in a vehicle and filter sterilizing before filling into a suitable vial or ampoule and sealing. Advantageously, adjuvants such as a local anesthetic, preservatives and buffering agents are also dissolved in the vehicle. To enhance the stability, the composition can be frozen after filling into the vial and the water removed under vacuum. Parenteral suspensions are prepared in substantially the same manner except that the compound is suspended in the vehicle instead of being dissolved and sterilized by exposure to ethylene oxide before suspending in the sterile vehicle.
Advantageously, a surfactant or wetting agent is included in the composition to facilitate uniform distribution of the active compound. Where appropriate, small amounts of bronchodilators, for example, sympathomimetic amines such as isoprenaline, isoetharine, salbutamol, phenylephrine and ephedrine; xanthine derivatives such as theophylline and aminophylline; corticosteroids such as prednisolone; and adrenal stimulants such as ACTH, may be included. As is common practice, the compositions will usually be accompanied by written or printed directions for use in the medical treatment concerned.
In yet another embodiment, one or more single domain antibodies of the invention can be linked (optionally, via one or more suitable linker sequences) to one or more (such as two and preferably one) amino acid sequences that allow the resulting polypeptide of the invention to cross the blood brain barrier. In particular, the one or more amino acid sequences that allow the resulting polypeptides of the invention to cross the blood brain barrier may be one or more (such as two and preferably one) NANOBODIES®, such as the NANOBODIES® described in WO 02/057445, of which FC44 (SEQ ID NO:189 of WO 06/040153) and FC5 (SEQ ID NO:190 of WO 06/040154) are preferred examples.
The present invention further provides a pharmaceutical composition for use in the treatment and/or prophylaxis of herein-described disorders, which comprises a pharmaceutically acceptable salt thereof, or a pharmaceutically acceptable solvate thereof, and, if required, a pharmaceutically acceptable carrier thereof.
It should be clear that the therapeutic method hereof for addressing Alzheimer's disease can also be used in combination with any other AD disease therapy known in the art, such as gamma-secretase inhibitors or other beta-secretase inhibitors.
In a particular embodiment, the single domain antibodies hereof can be used for the preparation of a diagnostic assay. BACE1 can be detected in a variety of cells and tissues, especially in brain cells and tissues, wherein the degree of expression corroborates with the severity of Alzheimer's disease. Therefore, there is provided a method of in situ detecting localization and distribution of BACE1 expression in a biological sample. The method comprises the step of reacting the biological sample with a detectable BACE1 NANOBODY® and detecting the localization and distribution of the detectable NANOBODY®. The term “biological sample” refers to cells and tissues, including, but not limited to, brain cells and tissues. The term further relates to body fluids.
Therefore, there is provided a method of detecting BACE1 protein in a body fluid of a patient. The method comprises the steps of reacting the body fluid with an anti-BACE1 NANOBODY® hereof and monitoring the reaction. The body fluid is, for example, plasma, urine, cerebrospinal fluid, pleural effusions or saliva. Monitoring the reaction may be effected by having the NANOBODY® labeled with a detectable moiety, or to use its constant region as an inherent detectable moiety, to which a second antibody, which includes a detectable moiety, can specifically bind. CSF BACE1 can, for example, be detected in patients suffering from Alzheimer's disease. According to a preferred embodiment of the present invention, reacting the body fluid with the anti-BACE1 NANOBODY® is effected in solution.
Alternatively, reacting the body fluid with the anti-BACE1 NANOBODY® is effected on a substrate capable of adsorbing proteins present in the body fluid, all as well known in the art of antibody-based diagnosis. Further, according to the disclosure, there is provided a method of detecting the presence, absence or level of BACE1 protein in a biological sample. The method comprises the following steps. First, proteins are extracted from the biological sample, thereby a plurality of proteins are obtained. The protein extract may be a crude extract and can also include non-proteinaceous material. Second, the proteins are size separated, e.g., by electrophoresis, gel filtration, etc. Fourth, the size-separated proteins are interacted with an anti-BACE1 NANOBODY®. Finally, the presence, absence or level of the interacted anti-BACE1 NANOBODY® is detected. In case of gel electrophoresis, the interaction with the NANOBODY® is typically performed following blotting of the size-separated proteins onto a solid support (membrane).
The following examples more fully illustrate the disclosure. Starting materials and reagents disclosed below are known to those skilled in the art, and are available commercially or can be prepared using well-known techniques.
To generate BACE1-specific antibodies, a dromedary was immunized six times with recombinant human BACE1 over a period of about six weeks. After this period, a BACE1-specific humoral response, as assessed by ELISA, was observed for each of the three different IgG subclasses that exist in Camelidae, namely the conventional IgG1 molecules and the heavy chain-only subclasses IgG2 and IgG3 (IgG classes reviewed in Conrath et al., 2003). The variable chain of the HCAbs (VHH), which contains the antigen-binding fragment, was amplified from isolated dromedary lymphocytes and cloned into a pHEN4 phagemid vector to generate a library of 4×107 individual transformants. After rescuing this bank with M13K07 helper phages, the VHH repertoire was expressed on the surface of bacteriophages. With these phages, BACE1-specific VHHs could be isolated from the whole VHH pool using panning, an in vitro selection technique (reviewed in Smith and Petrenko, 1997). For this, the phages were incubated onto a solid phase passively coated with the immunogen. After washing, bound phages were eluted and used to infect exponentially growing E. coli TG1 cells to produce new virions. These virions were used in a next selection round in order to enrich for BACE1-specific binders. After two to three consecutive rounds of panning, individual colonies were randomly picked and incubated with IPTG to induce expression of the NANOBODIES®. The VHH protein fragments were extracted from the bacterial periplasm and tested individually by ELISA for their ability to interact with BACE1. The positive scoring clones were sequenced and, as such, twenty different specific NANOBODIES® were identified.
Fourteen out of the twenty selected BACE1-binders are clearly derived from VHH germ-line genes: Nb_B1, Nb_B2, Nb_B3, Nb_B5, Nb_B8, Nb_B9, Nb_B10, Nb_B11, Nb_B12, Nb_B15, Nb_B16, Nb_B21, Nb_B25, and Nb_B26, corresponding with SEQ ID NOS:1-14, respectively (
Due to the high sequence similarity of the six VH-like NANOBODIES®, it is most likely they are all derived from one and the same B cell lineage. The differences in amino acid sequence could be the result of the ongoing somatic hypermutation of the antibody gene fragments in maturing B cells and the subsequent antigen-driven selection, a continuous process leading to ever better fitting antibodies. The six VH-like NANOBODIES® also differ from the other binders in that they contain a leucine residue at position 11 in their framework-1 (FR1), another characteristic of VH genes that is important for the interaction with a light chain (Lesk and Chothia, 1988; Padlan, 1994).
In a typical VHH FR1, this Leu residue is often replaced by a smaller and hydrophilic residue, usually a serine, as seen in the 14 BACE1 binders with a true VHH motif. The VH-like molecules all have a short CDR3 of only six amino acids, whereas, the other binders have significantly larger H3 loops, ranging from 13 to 21 residues, with an average length of 17. This is consistent with the average VHH-CDR3 length of 15 to 16 residues reported before in literature (reviewed in Muyldermans and Lauwereys, 1999).
In general, the CDR2 and CDR1 of VHHs consist of 16 to 17 and 10 residues, respectively, but about 30% of dromedary VHH cDNAs were reported to be off-sized. This does not adversely affect their function, but instead, even increases the antigen-binding repertoire (Nguyen et al., 2000). Unusual CDR1 and CDR2 lengths are also observed for our BACE1 binders. The CDR2 of Nb_B15 contains 19 residues due to a tandem repetition of two amino acids, whereas, that of Nb_B21 consists of 18 residues. Aberrant CDR1 sizes are found in Nb_B1, Nb_B15 and Nb_B16 due to an insertion, a deletion of one amino acid and a deletion of two residues, respectively. Finally, Nb_B25 has an unusually long framework-3 region with a tandem repetition of two amino acid residues. Deviating lengths in the BACE1-binders are due to changes located at three typical VHH insertion/deletion hot spots, surrounding residues 30±3, 54±3 and 74±1. These hot spots can be found within or at the border of peculiar DNA sequences, such as palindromic sequences (corresponding to residues 30-33 and 54-57) or heptamer-like sequences of an Ig recombination signal (often found at residues 76-78) (Nguyen et al., 2000).
Besides the conserved disulphide bridge between Cys22 and Cys92, extra non-canonical cysteine residues do not frequently occur in conventional antibodies, although they are not totally excluded. However, an additional pair of cysteines is encountered in 75% of reported dromedary VHHs (Arbabi Ghahroudi et al., 1997; Lauwereys et al., 1998; Conrath et al., 2001a; Saerens et al., 2004). One of these extra cysteine residues is typically located within the CDR3 loop, whereas, the other one can be found either on position 30, 32 or 33 within the CDR1 or at position 45 in FR2. Since the VHH CDR3 loop folds back onto the CDR1-FR2 region, the two cysteine residues come into contact distance and are likely engaged into an interloop disulphide bond that cross-links the antigen-binding loops (Desmyter et al., 1996). Such a bond reduces flexibility of the long CDR3 loop and thus provides increased stability. Besides, the interloop bond might lead to a constrained, but new conformation of the CDR loops, thereby increasing the antigen-binding repertoire.
Compared to the percentages known from literature, there is a low incidence of additional cysteines in the BACE1 binders. A putative additional disulphide bond is only present in four out of the 14 NANOBODIES® with VHH motif. Nb_B25 has a cysteine residue at position 33 within the CDR1; Nb_B9 has one at position 32; and in Nb_B5, an additional bridge will probably be formed between Cys45 and the CDR3. A cysteine at position 53, as seen in Nb_B12, has been described so far for neither dromedary, nor llama VHHs.
The cDNAs of the 20 isolated BACE1-binders were subcloned into the pHEN6 prokaryotic expression vector and expressed in E. coli WK6 cells to produce his-tagged soluble proteins. The recombinant VHHs were subsequently purified by Ni-NTA affinity chromatography, followed by size-exclusion chromatography. The expression levels of the distinct clones varied between 1 and 15 mg per liter of culture medium. The affinity of all VHHs for BACE1 was determined quantitatively using the surface plasmon resonance technology on Biacore 3000. Each of the different VHHs was injected at concentrations ranging from 0 to 0.5 μM on a chip onto which BACE1 was coupled. Binding was evaluated both at pH 7.0 and pH 5.0. Measurements at pH 5.0 were included because a firm interaction between BACE1 and a VHH should be preserved at this pH, since the endosomal compartment with its slightly acidic content was reported to be the major subcellular site of β-site cleavage of APP (Koo, 1994). Besides, BACE1 was shown to have optimal β-secretase activity at about pH 5.0 in vitro (Sinha et al., 1999; Vassar et al., 1999; Yan et al., 1999; Lin et al., 2000). The dissociation constants obtained for all VHHs vary between 4 and 669 nM at pH 7.0 and between 4.2 nM and 6.8 μM at pH 5.0 (
For the immunization of the dromedary, the isolation of the BACE1-specific binders during panning and the in vitro affinity measurements by Biacore, we used recombinant human soluble BACE1, completely devoid of carbohydrate chains. This recombinant protein, supplied by Dr. S. Masure (Johnson & Johnson, Beerse, Belgium) was obtained from an insect cell expression system using slightly truncated BACE1 cDNA in which the four N-glycosylation sites and the whole membrane anchor were removed (Bruinzeel et al., 2002). It is not unthinkable that epitopes that are easily accessible in the “naked” BACE1, used for the immunization, are shielded by glycan chains or other post-translational modifications of BACE1 proteins generated in mammalian cells. Therefore, we wondered whether the selected binders would all be able to recognize glycosylated BACE1 expressed in mammalian cells.
To test this, 2 μg of his-tagged VHH molecules were incubated with 4 μg of total protein extract from COS cells transiently transfected with human BACE1 cDNA. Nickel-beads were subsequently used to pull down the VHH molecules together with the bound proteins. After extensive washing, bound proteins were eluted, separated by SDS-PAGE and BACE1 protein was detected by Western blotting using a rabbit polyclonal BACE1-specific antibody (ProSci, 2253) (
Note that in the group of the 6 VH-like NANOBODIES® (Nb_B4, Nb_B6, Nb_B7, Nb_B13, Nb_B14 and Nb_B24), huge differences are observed in the ability of each NANOBODY® to bind to glycosylated BACE1, even though they probably originated from the same B-cell lineage. Despite a high overall sequence similarity of about 90%, Nb_B13 and Nb_B14 share only 70% of amino acids in their antigen-binding CDR regions and this difference apparently is sufficient to adversely affect the affinity of Nb_B14 for its antigen when compared to Nb_B13.
In a next step, we decided to express some of the VHHs into mammalian cells. Thereto, COST-B1 cells, stably expressing low levels of BACE1, were co-transfected with APPSw and either Nb_B26 or Nb_B9. Control cells were either transfected with empty vector or with APPSw alone. The cDNAs (of Nb_B26 or Nb_B9) were cloned into a eukaryotic expression vector, downstream of the signal peptide of BACE1 and with a myc-epitope tag at its C-terminus (
In a next step, NANOBODY® Nb_B9 was tested as to whether it could also affect APP processing when added to culture medium of cells. At least part of BACE1 is directed to the plasma membrane before being targeted to endosomes, so BACE1-specific antibodies could potentially bind to the ectodomain at the cell surface and be smuggled inside cells by co-internalization with their antigen. Since β-secretase cleavage of wild-type APP predominantly occurs within the endosomal compartments, neutralizing the enzyme's activity from the plasma membrane might be sufficient to decrease β-site APP proteolysis. SH-SY5Y cells, neuroblastoma cells with relatively high endogenous BACE1 activity, were infected with recombinant adenoviruses containing the cDNA encoding either human APP wild-type or the FAD APPSw mutant. The FAD mutant was included since it is a much better BACE1 substrate, which enables easier detection of Aβ and β-CTF. However, the majority of APPSw has been shown to be cleaved at the β-site in the secretory pathway before reaching the plasma membrane (Martin et al., 1995; Thinakaran et al., 1996), so BACE1-neutralizing VHHs binding at the cell surface might not be capable of preventing β-site APPSw cleavage.
Two days after adenoviral infection, the SH-SY5Y cells were radioactively labeled and incubated with 2 μM Nb_B9 for six hours. The conditioned medium was used to immunoprecipitate secreted Aβ, whereas, APP full-length and C-terminal fragments were pulled down from cell lysates. APP fragments were separated by SDS-PAGE. Gels were fixed, dried and analyzed by phosphorimaging. The presence of Nb_B9 caused clear detectable change in amounts of β-CTF or Aβ compared to non-treated cells (
Further, a new screening of the VHH phage libraries was performed using a different panning strategy, while Nb_B9 was included for further analysis. Phage pannings of the two VHH libraries were performed using biotinylated antigen (the ectodomain of human BACE1). After three rounds of consecutive panning, 500 single colonies were randomly picked for phage ELISA screening. One hundred fifty-eight out of 500 colonies scored positive in phage ELISA screening. The positive colonies were further screened by periplasmic extract ELISA; 44 colonies out the 158 colonies were scored positive. The positive colonies isolated from periplasmic extract ELISA screening were analyzed by PCR and restriction enzyme digestion to group them according to restriction pattern and for further sequencing analysis. Fourteen new VHHs were identified from the screening.
The alignment of the VHHs sequence was listed in
All 15 VHHs (14 new VHHs+Nb_B9) were first tested in a cellular assay by adding them to the medium of SH-SY5Y cells stably expressing APPwt at a final concentration of 20 μM. As shown in
In parallel, the capacity of the VHHs to modulate β-secretase activity was tested in an in vitro β-secretase assay that is based on the Fluorescence Resonance Energy Transfer (FRET) technology. This assay makes use of a synthetic peptide substrate that mimics the BACE1 cleavage site of APP and is coupled to a fluorophore on its N-terminus and a fluorescence acceptor on its C-terminus. The light emitted by the fluorophore is absorbed by the fluorescence acceptor as long as these two moieties are in close proximity. Only upon proteolysis, when recombinant BACE1 is added to the synthetic substrate, energy transfer no longer occurs and the amount of light emitted, which is linearly related to the amount of cleaved product and, hence, to the β-secretase activity, can be measured. All VHHs were tested by this BACE1 FRET assay at a final concentration of 10 μM.
As shown in
The dose-response curves of 10C4, 4A2 and B9 on BACE1 activity were established by FRET assay. As shown in
The contradictory results from B9 modulating BACE1 activity in opposite ways in the cellular assay and the FRET assay implicates that B9 might have different effects on BACE1 cleavage of a large substrate or a small substrate (APP as the cellular substrate for BACE1 contains 695 amino acids while the peptide substrate in FRET assay contains only ten amino acids). Therefore, it was tested whether B9 could inhibit BACE1 cleavage of a big substrate in another cell-free enzymatic assay MBP-ELISA, which uses the maltose binding protein connected to the C-terminal 125 amino acids of APPswe (MBP-APPswe-C125) as BACE1 substrate. As shown in
The binding affinities of VHHs B9, 10C4 and 4A2 to human BACE1 ectodomain were analyzed by Biacore. As shown in Table 2 (left), B9 had the best affinity among the three inhibitory VHHs, with a Kd of 3.67 nM at pH 7.0. 10C4 and 4A2 had affinities of 74.7 nM and 48.2 nM, respectively, which are all within the normal range of affinities for VHH antibodies.
Further, it was tested if the affinities of the VHHs were stable at pH 4.5, at which BACE1 has its optimal activity. As shown in Table 2 (right), there was no significant change in the affinities of the three VHHs at pH 4.5 compared to that in neutral pH, indicating that all three VHHs have binding affinities to BACE1 that were acidic stable.
TABLE 2
VHH affinities to human BACE1 at pH 7.0 and pH 4.5
pH 7.0
pH 4.5
kon
koff
KD
kon
koff
KD
(M−1s−1)
(s−1)
(nM)
(M−1s−1)
(s−1)
(nM)
Nb_B9
2.67E+05
9.80E−04
3.67
6.62E+05
1.30E−03
1.96
Nb_4A2
4.79E+05
2.31E−02
48.2
3.97E+05
8.41E−03
21.2
Nb_10C4
1.06E+05
7.92E−03
74.7
4.51E+05
1.25E−02
27.7
The cross-reactivity of three VHHs to mouse BACE1 was investigated in anticipation of tests in primary cultures of mouse neurons. As shown in Table 3, both at neutral pH and acidic pH condition, all three VHHs cross-reacted with mouse BACE1, and their affinities to mouse BACE1 were within the same range of affinities as those measured with human BACE1.
TABLE 3
VHH affinities to mouse BACE1 at pH 7.0 and pH 4.5
pH 7.0
pH 4.5
kon
koff
KD
kon
koff
KD
(M−1s−1)
(s−1)
(nM)
(M−1s−1)
(s−1)
(nM)
Nb_B9
5.02E+05
8.90E−04
1.77
1.06E+06
1.18E−03
1.11
Nb_4A2
1.65E+05
5.81E−03
35.2
2.51E+05
2.16E−03
8.61
Nb_10C4
1.90E+05
7.97E−03
41.9
9.84E+05
9.88E−03
10
VHHs Nb_B9 and Nb_4A2 were tested in the neuronal cell culture assay (
As shown in
Camel single domain antibodies, the minimal-sized antibodies, which have superior properties for intracellular expression and function, including solubility, stability and functionality without the requirement for association between heavy and light chains of conventional antibodies, are candidate therapeutic molecules for in vivo gene delivery. The BACE1 inhibitory VHH Nb_B9 is tested in a transgenic mouse model of Alzheimer's disease through viral vector-mediated gene delivery. Adeno-associated virus (AAV), one of the most effective vehicles for gene delivery to the central nervous system, is used in this experimentation. The cDNA of VHH Nb_B9, fused with a signal peptide from BACE1 at its N-terminal and a Myc-tag at its C-terminal, was constructed into an AAV vector. The AAV vector used here contains a hybrid cytomegalovirus/chicken β-actin promoter and a wood-chuck post-transcriptional regulatory element, which is an optimized cassette for driving protein expression in neurons (Björklund et al., 2000).
For in vivo testing, Dutch-mutant APP transgenic mice are used, which overexpress E693Q-mutated human APP under the control of a neuron-specific Thy1 promoter element (Herzig et al., 2004). The E693Q Dutch mutation site on human APP is 21 amino acid residues behind BACE1 cleavage site, which does not interfere with APP processing by BACE1. Transgenic mice overexpressing the Dutch-mutant APP generate predominantly Aβ40 peptide, which is used as readout for BACE1 activity for in vivo test of VHH Nb_B9. Two administrative routes, including stereotactic injection to the hippocampus region of adult mouse brain (Fukuchi et al., 2006) and intracranial injection to neonatal mouse brain (Levites et al., 2006) are used for the delivery of AAV vector packaged VHH Nb_B9. AAV vector packaged GFP and VHH Nb_B24 are used as negative controls.
Materials and Methods
Cell Culture
COS, BHK, MEF, CHO, HEK-APPSw, N2A and HeLa cells were cultured at 37° C. in a 5% CO2 environment in Dulbecco's modified Eagle's medium/nutrient mixture F-12 (1:1) (Gibco) supplemented with 10% (v/v) Fetal Bovine Serum (FBS) (Hyclone). The HEK-APPSw cells were kindly provided by Prof C. Haass (Adolf Butenandt Institute, Ludwig-Maximilians University, Munich, Germany). For transient liposome-based transfections, a mix of FuGENE 6 (Roche Applied Science) and plasmid DNA with a ratio of 3:1 (in μl and μg, respectively) was added to a culture dish containing a 50% to 80% confluent monolayer of cells, according to the manufacturer's instructions. COS-hBACE1 stable cells were obtained after transient transfection of COS cells with pcDNA3.1zeo-hBACE1 and selection in 400 μg/ml zeocin (Invitrogen). SH-SY5Y cells were grown in DMEM G
Primary cortical neuronal cultures were isolated from E14 mouse embryos (according to Goslin and Banker, 1991). Briefly, dissected brain cortices were trypsinized with 0.25% trypsin in HBSS medium (Gibco), pelleted and transferred to DMEM (Invitrogen, San Diego, Calif.), supplemented with 10% (v/v) FBS and dissociated by passing them through Pasteur pipettes of decreasing diameters. Dispersed cells were collected by centrifugation and plated on poly-L-lysine (Sigma)-coated dishes and maintained in neurobasal medium (Gibco) supplemented with 0.5 μM L-glutamine (Invitrogen) and 2% (v/v) B27 Serum-free Supplement (Gibco). Cytosine arabinoside (5 μM) was added 24 hours after plating to prevent proliferation of glial cells.
Metabolic Labeling and Immunoprecipitation of APP Fragments
Cells were washed in Met-free or Met/Cys-free medium (GIBCO) and radioactively labeled in the appropriate medium containing, respectively, 100 μCi 35S Met or 35S Met/Cys (Trans 35S Label, MP Biomedicals, Irvine, Calif.). In case of incubations with FK-506, rapamycin and Nb_B26 (2.1 μM), compounds were added to the labeling medium. After six hours incubation, the culture supernatant was collected as a source of secreted Aβ or sAPPIβ and centrifuged to remove detached cells. Cells were lysed in DIP buffer (20 mM Tris-HCl pH 7.4, 150 mM NaCl, 1% TRITON® X-100, 1% sodium desoxycholate, 0.1% SDS), except for the HEK-APPSw cells, which were lysed in Tris buffered saline (TBS: 150 mM NaCl, 20 mM Tris-HCl, pH 7.5), containing 1% TRITON® X-100 and a cocktail of protease inhibitors (Complete, Roche). This lysis buffer still allows determination of protein concentration (Bio-Rad Protein Assay) to analyze efficiency of RNA interference on equal amounts of protein extract.
APP full-length and APP C-terminal stubs were precipitated from cell extracts using the APP C-terminal antibodies B63.1, B11/4 or B12/6 (1:200) and immunocomplexes were captured by protein G-sepharose. For Aβ species, samples of the cell-conditioned medium were incubated with either B7/8 or 4G8 (1:200). For the neurons overexpressing different BACE1 mutants, BACE1 proteins were precipitated from cell extracts with B45.1.
Immunoprecipitates were washed extensively in DIP buffer, followed by one washing step in TBS 1/3, eluted in LDS sample buffer (Invitrogen) supplemented with 1% β-mercapto ethanol and separated on 10% NuPAGE® gel (Novex) run in MES buffer for the APP fragments and MOPS for the BACE1 mutants. Gels were fixed, dried and exposed to a phosphor-imaging screen. Intensity of radioactive bands was quantified using PhosphorImaging (Typhoon, PerkinElmer) and the I
To detect sAPPβ, samples of conditioned medium were subjected to SDS-PAGE and Western blotting using B53/4 antibody.
Deglycosylation Experiments
Cells were harvested in Dulbecco's PBS (GIBCO), pelleted and lysed in 100 mM phosphate buffer at pH 5.8 for EndoH treatment (46% of 0.2 M NaH2PO4, 4% of 0.2 M Na2HPO4 and 50% water) and pH 7.4 for EndoF (9.5% of 0.2 M NaH2PO4, 40.5% of 0.2 M Na2HPO4 and 50% water), supplemented with 0.1% SDS, 0.5% TRITON® X-100, 0.5% β-mercapto-ethanol and protease inhibitors (Complete, Roche). Lysates were first denatured by heating them for 10 minutes at 70° C. and then treated with EndoH (1 unit/30 μl, Roche Applied Science) or EndoF (1 unit/30 μl, Roche Applied Science) for 19 hours at 37° C. and analyzed by SDS-PAGE and Western blotting.
Generation of Recombinant GST-Fusion Proteins
pGEX-4T-1 plasmids (Pharmacia) encoding GST fusion proteins were introduced in BL21-competent cells (Merck Eurolab) and expression of the GST proteins was induced by 0.1 mM isopropyl β-D-thiogalactopyranoside (IPTG, Promega). Recombinant proteins were released from the bacteria by sonication in a Tris-saline buffer (150 mM NaCl, 10 mM Tris) containing a protease inhibitor cocktail (1 mM EDTA, 14 μg/ml aprotinin, 2 μg/ml pepstatin), 100 μg/ml lysozyme, 5 mM DTT and 0.5% N-laurylsarcosine (sarcosyl) (Frangioni and Neel, 1993). After centrifugation at 12500 rpm (Beckman J2-21M/E) to remove insoluble bacterial debris, TRITON® X-100 was added to a final concentration of 1% to neutralize the effects of the ionic detergent sarcosyl.
Immunization of a Dromedary and Llama and Analysis of the Immune Response
The immunization of dromedary and llama, the isolation of BACE1-binders and affinity measurements were done in collaboration with Prof. S. Muyldermans, VUB, Belgium.
With weekly intervals, a dromedary and llama were immunized six times subcutaneously with 150 μg of pure recombinant human BACE1 mixed with GERBU adjuvant (GERBU Biochemicals). The immunogen used for the immunization of the dromedary was provided by Dr. S. Masure (Johnson & Johnson Pharmaceutical Research & Development, Beerse, Belgium). In order to obtain large amounts of active recombinant BACE1, insect cells were infected with baculoviruses encoding BACE1 ectodomain (sBACE1) in which the four putative N-glycosylation sites were removed by substituting the respective Asn codons for Gln codons (Bruinzeel et al., 2002). The lack of glycosylation made it possible to produce a large, homogeneous pool of BACE1.
A llama was immunized with a different source of BACE1. In this case, the antigen was purified from sBACE1-overexpressing HEK293 cells (obtained from Prof. N. Mertens, Protein Service Facility, VIB, UGent) and, hence, resembled much better native, mature and thus fully glycosylated BACE1.
Forty-five days after the first injection, anticoagulated blood was collected. BACE1-specific antibody titers for each IgG subclass were analyzed using ELISA. The three individual IgG subclasses were first purified from serum based on their differential absorption on Protein A and Protein G and distinct elution conditions (Conrath et al., 2001a). Solid-phase coated BACE1 protein was incubated with serial dilutions of the different IgG subclasses and bound IgGs were subsequently detected with a rabbit anti-dromedary IgG antiserum and anti-rabbit IgG-alkaline phosphatase conjugates (Saerens et al., 2004).
Construction of a VHH Gene Fragment Library
Peripheral lymphocytes were isolated from the dromedary/llama sera (LYMPHOPREP®, NYCOMED®) and total RNA was extracted (according to Chomczynski and Sacchi, 1987). After RT-PCR with a dN6 primer, the cDNA obtained was used as template for the amplification of a DNA fragment spanning the IgG variable domain until the CH2 domain, using primers CALL001 and CALL002 (see Table 4). These primers anneal to the IgG leader sequence and the CH2 exon of the heavy chain of all three IgG subclasses existing in dromedary, respectively. Using agarose gel extraction, the 600 bp fragment coming from heavy chain-only antibodies (VHH-CH2, without CH1 domain) was separated from the 900 bp fragment derived from conventional antibodies (VH-CH1-CH2 exons). VHH gene fragments were then amplified by PCR on the 600 bp DNA with a pair of nested primers, AE6 and FR4FOR (see Table 4). AE6 anneals to the VHH framework-1 and contains a Pst I site, whereas FR4FOR with a Not I site is complementary to the framework-4. The different VHH fragments were ligated into a pHEN4 phagemid vector and transformed into E. coli TG1 cells to create a library of 4×107 transformants. Colony PCR screening showed that approximately 90% of the colonies were transformed with a phagemid vector containing an insert with the size expected for a VHH fragment.
TABLE 4
Sequences of the different primers used for the
VHH gene fragment library construction
Primer
Sequence (5′ to 3′)
SEQ ID NO:
CALL001
GTCCTGGCTGCTCTTCTACAAGG
44
CALL002
GGTACGTGCTGTTGAACTGTTCC
45
AE6
GATGTGCAGCTGCAGGAGTCTGGAGGAGG
46
FR4FOR
GGACTAGTGCGGCCGCTGCAGACGGTGAC
47
CTGGGT
Selection of BACE1-Specific VHH Fragments
The VHH repertoire was expressed onto the surface of phages after rescuing the library with M13K07 helper phages. Specific VHHs against BACE1 were enriched by three consecutive rounds of in vitro selection, a technique also known as panning (Smith and Petrenko, 1997). For this, the VHHs were incubated on a solid phase coated with antigen. Unbound phages were washed away in PBS plus 0.05% TWEEN® 20 and bound phages were eluted with 100 mM triethylamine (pH 10.0). Eluted phage particles were immediately neutralized with 1 M Tris-HCl (pH 7.5) and used to re-infect exponentially growing E. coli TG1 cells. After the second and third round of selection, individual colonies were randomly picked.
Enzyme-Linked Immunosorbent Assay (ELISA)
Expression of the selected VHH was induced with 1 mM IPTG. The recombinant soluble C-terminally Hemagglutinin (HA)-tagged VHHs (the gene encoding the HA-epitope is included in the pHEN4 phagemid vector) were extracted from the periplasm by an osmotic shock (200 mM Tris-HCl pH 8.0, 250 mM sucrose, 0.5 mM EDTA) (Skerra and Pluckthun, 1988) and tested for their capacity to recognize their antigen in ELISA tests. Maxisorb 96-well plates (Nunc) were coated overnight with BACE1 protein (100 μl of 1 μg/ml in PBS) at 4° C. Residual binding sites were blocked for two hours at room temperature with 1% (w/v) casein dissolved in PBS. This antigen-coated solid phase was then incubated with the different periplasmic extracts for one hour at room temperature. After washing, the solid phase was successively incubated with mouse anti-HA, alkaline phosphatase-conjugated anti-mouse (Sigma) and 2 mg/ml p-nitrophenyl phosphate (Sigma). Signals were analyzed at 410 nm.
Expression and Purification of VHHs
The VHH genes of the clones scoring positive in ELISA were subcloned into the expression vector pHEN6, using Pst I and BstE II. Thereby, the HA-epitope tag at the C-terminus of the VHH molecules was replaced by a his6-tag. E. coli WK6 cells were transformed with the pHEN6 plasmids and expression of the recombinant soluble VHH proteins was induced by IPTG (Saerens et al., 2004). Soluble VHH molecules were extracted from the bacteria using an osmotic shock (Skerra and Pluckthun, 1988). The his-tagged recombinant proteins were then captured on a nickel-nitrilotriacetic acid superflow Sepharose column (QIAGEN®), eluted with an acetate buffer (pH 4.7), and additionally purified by size-exclusion chromatography.
BIAcore Measurements
The kinetic constants and affinity of the VHH-antigen interactions were determined by surface plasmon resonance technology on a Biacore 3000 (Biacore AB). Purified VHH molecules, in a concentration range of 0-500 nM in Hepes Buffered Saline pH 7.0 or citrate buffer pH 5.0, were injected at 30 μl/minute onto BACE1 (500 resonance units), immobilized on a CM5 chip (according to De Genst et al., 2005). The kinetic and equilibrium constants (kon, koff and KD) were determined with the BIAevaluation v3.1 software (Biacore AB).
In Vitro FRET-Based Analysis of β-Secretase Activity
To determine whether the VHHs affect BACE1 activity, an in vitro BACE1 FRET assay kit was used (Panvera P2985). This assay uses a synthetic BACE1 substrate that emits light upon cleavage. The amount of total fluorescence is linearly related to the cleavage rate of the substrate and hence to β-secretase activity. Reaction mixtures containing 20 nM of recombinant BACE1 enzyme and 250 nM of synthetic substrate were incubated with an excess of each VHH (2.2 μM) or the BACE1 inhibitor STA-200 (Enzyme System Products, 2.2 μM) in 50 mM sodium acetate, pH 4.5 at room temperature, protected from light. After two hours, fluorescence was measured at 595 nm using VICTOR 1420 multilabel counter (Perkin Elmer Life Sciences). For each VHH, the background signal, emitted by a mix containing VHH and substrate but no enzyme, was subtracted from the signal measured for the mix containing VHH, substrate and BACE1. As an alternative source of β-secretase activity, microsomal membranes were generated from HeLa cells ectopically expressing BACE1 as described hereinbefore. The resulting microsomal pellet was resuspended in 50 mM sodium acetate, pH 4.5. Fifty μg of microsomal proteins were mixed with 250 nM of the synthetic BACE1 substrate and 2.2 μM of VHH or STA-200. The enzymatic reaction and analysis were performed as before except that reactions were gently mixed every ten minutes during the two-hour incubation.
In another approach, FRET peptide substrate MCA-S-E-V-N-L-D-A-E-F-R-K(Dnp)-R-R-R-R-NH2 (SEQ ID NO:48) was synthesized by Ana Spec Inc. (San Jose, Calif., USA). Enzyme human BACE1 (1-460): IgGFc was purified from HEK293 cells according to the protocol described previously (Yang et al., 2004). For the reaction, enzyme was diluted in reaction buffer (50 mM Ammonium Acetate, pH 4.6, 3% BSA, 0.7% TRITON® X-100) at a concentration of 1 μg/ml, and substrate was diluted in reaction buffer at a concentration of 125 μM. Twenty μl VHH (diluted in reaction buffer) were mixed with 30 μl enzyme dilution and 50 μl substrate dilution in 96-well black polystyrene plates (Costar). The plates were read immediately for baseline signal with Envision (355 nm excitation, 430 nm emission, 1 second/well), followed by incubation overnight in the dark at room temperature. The plates were read the following morning using the same reader protocol; the FRET signal (-baseline signal) was used as the readout of enzyme activity in each reaction.
Co-Precipitation of Human BACE1 with his-Tagged VHHs Using Ni-Beads
BACE1-overexpressing COS cells were lysed in PBS containing 1% TRITON® X-100 and protease inhibitors (1 μg/ml pepstatin, 14 μg/ml aprotinin, 0.5 mM PEFABLOC®). One hundred μg of this protein extract were incubated overnight at 4° C. with 2 μg of his-tagged VHH proteins and Ni-PDC beads (Affiland) in binding buffer (342 mM NaCl, 16.2 mM Na2HPO4, 6.7 mM KCl, 3.7 mM KH2PO4 with 1% TRITON® X-100) with the same protease inhibitors as used for cell lysis. The precipitates were washed in binding buffer supplemented with 10 mM imidazole, to reduce unspecific interactions, eluted using 300 μM imidazole and resolved by SDS-PAGE. BACE1 was visualized by Western blotting using a polyclonal rabbit anti-BACE1 antibody (ProSci Inc).
Phage Libraries Panning with Biotin-Labeled Antigen
Pannings of VHH phage library were performed with biotin-streptavidin system. Purified BACE1 ectodomain protein was labeled with Sulfo-NHS-SS-Biotin (Pierce) according to the manufacturer's protocol. VHH libraries were rescued with M13K07 helper phage to generate phages. For panning, 1011 phages were blocked with 1% BSA in 400 μl panning buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl, and 0.05% TWEEN® 20 for 30 minutes at RT. One hundred μl biotinylated BACE1 was added to phage to a final concentration at 200 nM. Phage and biotinylated BACE1 were incubated for one hour at RT with rotation. Meanwhile, 40 μl immobilized streptavidin (Pierce) were blocked in 1% BSA. After one-hour incubation, pre-blocked immobilized streptavidin were added to phage-biotinylated BACE1 solution and incubated for 40 minutes at RT with rotation. After incubation, immobilized streptavidin were spinned down by centrifugation at 3000 rpm for one minute, the supernatant containing unbound phage were discarded. The immobilized streptavidin were washed five times with 1 ml panning buffer; each wash lasted five minutes with rotation. After wash, 50 mM DTT were added to immobilized streptavidin and incubated for 40 minutes at RT with rotation. The immobilized streptavidin were spinned down and the supernatants containing eluted phages were used to re-infect E. coli TG1 cells for the next round of phage panning After three rounds of consecutive panning, recovered phages were used to infect E. coli TG1 cells and plated out at 10−4 to 10−6 dilution, and single colonies were picked for further analysis.
Phage ELISA Screening
To generate phage particles with VHHs displayed on the surface for ELISA screening, single colonies from phage panning were inoculated in 2 ml 2×TY medium supplemented with 50 μg/ml ampicillin and 1% glucose in 24-well plates at 37° C. for eight hours with shaking at 220 rpm. After an eight-hour incubation, 5×108 pfu M13K07 helper phages were added to infect each well of bacterials. Infected bacterials were grown at 37° C. overnight with shaking at 220 rpm. The next morning, bacterials were spinned down by centrifugation at 3000 rpm for 20 minutes; supernatants containing phage particles were transferred into 24-well plates. Twenty percent PEG 6000/2.5 M NaCl were added to the supernatants using ⅙ volume to precipitate phage particles at 4° C. for 30 minutes. Phage particles were later retrieved by centrifugation at 3000 rpm for 30 minutes, and pellets were resuspended in 100 μl PBS.
For ELISA assay of phage particles, BACE1 ectodomain protein was coated on 48 wells of each 96-well microtiter plate at 100 ng/well at 4° C. overnight, the non-coated wells were used for control. The next morning, microtiter plates were blocked with 3% mild for one hour at RT. After blocking, 100 μl phage particles were added to each coated and non-coated well, and were incubated for two hours at RT. Plates were then washed five times with washing buffer (PBS, 0.05% TWEEN® 20). After wash, HRP-conjugated anti-M13 antibody (Amersham) was added to each well using 1:3000 dilution in 3% milk and incubated for one hour. Plates were then washed five times with washing buffer. After wash, developing substrate 0.02 mg/ml ABTS (Sigma) supplemented with 0.3% H2O2 (Sigma) were added to microtiter plates and incubated for 30 minutes at RT. Plates were read at OD405 nm with an ELISA reader.
Periplasmic Extract ELISA Screening
Expression vector pHEN4 containing a PelB (Pectate lysase) signal sequence before the VHH cDNAs, thus VHHs are exported to the periplasmic space after expressed in bacterial system. To generate periplasmic extract containing VHH proteins for ELISA test, single colonies from phage panning were inoculated in 1 ml Terrific Broth (TB) medium supplemented with 100 μg/ml ampicillin in 24-well plates at 37° C. with shaking at 220 rpm. When OD600 reached 0.6, 1 mM IPTG was added to the culture to induce the expression of VHH proteins. Bacterials were further incubated for 15 hours at 28° C. for protein expression. After the incubation, bacterials were harvested by centrifugation at 3000 rpm for 20 minutes, cell pellets were dissolved in TES solution (20 mM Tris-HCl pH 7.4, 1 mM EDTA, 250 mM sucrose) and incubated on ice for 30 minutes. The osmotic shock was given by adding 1.5× volume TES/4 to the bacterials and incubated on ice for 45 minutes. Supernatants containing VHH proteins were collected by centrifugation at 300 rpm for 20 minutes and further used for ELISA. The ELISA assays followed the same protocol described above for phage ELISA. To detect VHH proteins generated with a C-terminal HA tag, anti-HA monoclonal antibody (Amersham) was used as primary antibody and alkaline phosphatase conjugated goat anti-mouse antibody (Amersham) were used as secondary antibody. ELISA plates were developed with p-Nitrophenyl-phosphate (PNPP) substrate (Sigma) and read at OD 405 nm with an ELISA reader.
Adeno-Associated Virus (AAV) Construction and Preparation
For AAV generation, a standard method was followed (Levites et al., 2006). Briefly, the cDNA of VHH Nb_B9, fused with a signal peptide from BACE1 at its N-terminal and a Myc-tag at its C-terminal, was constructed into an AAV vector containing a hybrid cytomegalovirus/chicken β-actin promoter and a woodchuck post-transcriptional regulatory element. AAVs were generated by plasmid transfection with helper plasmids in HEK293T cells. Forty-eight hours after transfection, the cells were harvested and lysed in the presence of 0.5% sodium deoxycholate and 50 U/ml Benzonase (Sigma) by freeze thawing, and the virus was isolated using a discontinuous iodixanol gradient purified on a HITRAP® HQ column (Amersham Biosciences). The genomic titer of virus was determined by quantitative PCR.
Mice
All animal experiments were in compliance with protocols approved by the local Animal Care and Use Committees. Dutch-mutant APP transgenic mice (C57BL/6J-TgN(Thy-APPE693D)) were kindly provided by the laboratory of Mathias Jucker, University of Tubingen, Germany.
Stereotaxic Injections
In the first series of experiments, AAV vectors expressing VHH Nb_B9 and GFP (negative control), and VHH Nb_B24 (negative control) were administrated directly into the hippocampus of three-month-old Dutch-mutant APP transgenic mice. Mice were anesthetized with avertin and placed in a stereotaxic apparatus. AAV preparations were injected bilaterally (2 μl per site) into the CA3 region of the hippocampus (−2.0 mm antero-posterior from bregma, +/−2.3 mm medio-lateral from bregma, and 1.7 mm below dura). Mice were then individually housed and allowed to recover from surgery. Their brains were processed for analyses five weeks after treatment.
Neonatal Injections
The procedure was described previously (Levites et al., 2006). Briefly, postnatal day 0 (P0) pups were cryoanesthetized on ice for five minutes. AAV preparations (2 μl) were injected intracerebroventricularly into both hemispheres using a 10 ml Hamilton syringe with a 30 gauge needle. The pups were then placed on a heating pad with their original nesting materials for three to five minutes and returned to their mother for further recovery. Their brains were processed for analyses three months after injection.
Tissue Preparation and Biochemical Analysis of Aβ
To analyze Aβ, the hippocampus (from stereotaxic injections) and the whole brains (from neonatal injections) were homogenized in Tissue Protein Extraction reagent (Pierce) supplemented with COMPLETE™ protease inhibitor and phosphatase inhibitor tablets (Roche Applied Science). The homogenized samples were centrifuged at 4° C. for one hour at 100,000×g, and the supernatant was used for immunoblot analysis and for Aβ ELISA measurements using ELISA kits (The Genetics Company).
De Strooper, Bart, Marjaux, Els, Zhou, Lujia, Muyldermans, Serge
| Patent | Priority | Assignee | Title |
| 11773185, | Nov 08 2017 | DENALI THERAPEUTICS INC | Anti-BACE1 antibodies and methods of use thereof |
| Patent | Priority | Assignee | Title |
| 5693761, | Dec 28 1988 | PDL Biopharma, Inc | Polynucleotides encoding improved humanized immunoglobulins |
| 5766886, | Dec 13 1991 | XOMA TECHNOLOGY LTD | Modified antibody variable domains |
| 5821123, | Aug 13 1993 | XOMA TECHNOLOGY LTD | Modified antibody variable domains |
| 5859205, | Dec 21 1989 | Celltech R&D Limited | Humanised antibodies |
| 5869619, | Dec 13 1991 | XOMA TECHNOLOGY LTD | Modified antibody variable domains |
| 6054297, | Jun 14 1991 | Genentech, Inc. | Humanized antibodies and methods for making them |
| 6180370, | Dec 28 1988 | PDL Biopharma, Inc | Humanized immunoglobulins and methods of making the same |
| 20060034848, | |||
| EP626390, | |||
| WO43507, | |||
| WO190190, | |||
| WO2057445, | |||
| WO2085945, | |||
| WO247466, | |||
| WO3025020, | |||
| WO3035694, | |||
| WO4049794, | |||
| WO2006040153, | |||
| WO2006040154, | |||
| WO2009121948, | |||
| WO9404678, | |||
| WO9937681, |
| Executed on | Assignor | Assignee | Conveyance | Frame | Reel | Doc |
| Nov 17 2010 | DE STROOPER, BART | KATHOLIEKE UNIVERSITEIT LEUVEN, K U LEUVEN R&D | ASSIGNMENT OF ASSIGNORS INTEREST SEE DOCUMENT FOR DETAILS | 036311 | /0040 | |
| Nov 17 2010 | ZHOU, LUJIA | Vrije Universiteit Brussel | ASSIGNMENT OF ASSIGNORS INTEREST SEE DOCUMENT FOR DETAILS | 036311 | /0040 | |
| Nov 17 2010 | DE STROOPER, BART | Vrije Universiteit Brussel | ASSIGNMENT OF ASSIGNORS INTEREST SEE DOCUMENT FOR DETAILS | 036311 | /0040 | |
| Nov 17 2010 | DE STROOPER, BART | VIB VZW | ASSIGNMENT OF ASSIGNORS INTEREST SEE DOCUMENT FOR DETAILS | 036311 | /0040 | |
| Nov 17 2010 | ZHOU, LUJIA | VIB VZW | ASSIGNMENT OF ASSIGNORS INTEREST SEE DOCUMENT FOR DETAILS | 036311 | /0040 | |
| Nov 17 2010 | ZHOU, LUJIA | KATHOLIEKE UNIVERSITEIT LEUVEN, K U LEUVEN R&D | ASSIGNMENT OF ASSIGNORS INTEREST SEE DOCUMENT FOR DETAILS | 036311 | /0040 | |
| Nov 25 2010 | MUYLDERMANS, SERGE | KATHOLIEKE UNIVERSITEIT LEUVEN, K U LEUVEN R&D | ASSIGNMENT OF ASSIGNORS INTEREST SEE DOCUMENT FOR DETAILS | 036311 | /0040 | |
| Nov 25 2010 | MUYLDERMANS, SERGE | Vrije Universiteit Brussel | ASSIGNMENT OF ASSIGNORS INTEREST SEE DOCUMENT FOR DETAILS | 036311 | /0040 | |
| Nov 25 2010 | MUYLDERMANS, SERGE | VIB VZW | ASSIGNMENT OF ASSIGNORS INTEREST SEE DOCUMENT FOR DETAILS | 036311 | /0040 | |
| Dec 17 2010 | MARJAUX, ELS | KATHOLIEKE UNIVERSITEIT LEUVEN, K U LEUVEN R&D | ASSIGNMENT OF ASSIGNORS INTEREST SEE DOCUMENT FOR DETAILS | 036311 | /0040 | |
| Dec 17 2010 | MARJAUX, ELS | VIB VZW | ASSIGNMENT OF ASSIGNORS INTEREST SEE DOCUMENT FOR DETAILS | 036311 | /0040 | |
| Dec 17 2010 | MARJAUX, ELS | Vrije Universiteit Brussel | ASSIGNMENT OF ASSIGNORS INTEREST SEE DOCUMENT FOR DETAILS | 036311 | /0040 | |
| Sep 11 2013 | Vrije Universiteit Brussel | (assignment on the face of the patent) | / | |||
| Sep 11 2013 | Katholieke Universiteit Leuven, K.U. Leuven R&D | (assignment on the face of the patent) | / | |||
| Sep 11 2013 | VIB VZW | (assignment on the face of the patent) | / |
| Date | Maintenance Fee Events |
| Oct 25 2021 | REM: Maintenance Fee Reminder Mailed. |
| Apr 11 2022 | EXP: Patent Expired for Failure to Pay Maintenance Fees. |
| Date | Maintenance Schedule |
| Mar 06 2021 | 4 years fee payment window open |
| Sep 06 2021 | 6 months grace period start (w surcharge) |
| Mar 06 2022 | patent expiry (for year 4) |
| Mar 06 2024 | 2 years to revive unintentionally abandoned end. (for year 4) |
| Mar 06 2025 | 8 years fee payment window open |
| Sep 06 2025 | 6 months grace period start (w surcharge) |
| Mar 06 2026 | patent expiry (for year 8) |
| Mar 06 2028 | 2 years to revive unintentionally abandoned end. (for year 8) |
| Mar 06 2029 | 12 years fee payment window open |
| Sep 06 2029 | 6 months grace period start (w surcharge) |
| Mar 06 2030 | patent expiry (for year 12) |
| Mar 06 2032 | 2 years to revive unintentionally abandoned end. (for year 12) |