The present invention relates to the Grb3-3 protein, nucleotide sequence encoding this protein, and variants thereof, such as antisense sequences. The invention further relates to vectors comprising these sequences and to methods for inducing cell death.
|
1. An isolated polynucleotide selected from the group consisting of:
a) a polynucleotide which encodes a polypeptide comprising the uninterrupted sequence SEQ ID NO: 2, and b) the complementary strand of a polynucleotide as defined in a).
2. The polynucleotide of
3. The polynucleotide of
4. An antisense polynucleotide comprising a polynucleotide of
5. An antisense polynucleotide comprising all or part of the polynucleotide of
7. A vector according to
8. A vector according to
9. A vector according to
10. A composition comprising a vector according to
11. A composition comprising a polynucleotide according to
13. A composition comprising a polypeptide according to
14. An antisense polynucleotide according to
15. An antisense RNA comprising a sequence complementary to all or part of a polynucleotide of
0. 16. An antisense RNA according to
17. An antisense RNA comprising a polynucleotide of
0. 18. A process for expressing Grb3-
19. A process for expressing Grb3-
20. A process for expressing Grb3-
21. A process for expressing Grb3-
22. The process according to
23. The process according to
24. The process according to
25. A process for preparing a Grb3-
26. A process for preparing a Grb3-
27. A process for preparing a Grb3-
28. A process for preparing a Grb3-
29. The process according to
30. The process according to
31. An antisense RNA according to - |
|||||||||||||||||||||
The methods conventionally used in molecular biology, such as preparative extractions of plasmid DNA, centrifugation of plasmid DNA in caesium chloride gradient, electrophoresis on agarose or acrylamide gels, purification of DNA fragments by electroelution, extraction of proteins with phenol or phenolchloroform, DNA precipitation in saline medium with ethanol or isopropanol, transformation in Escherichia coli, and the like are well known to persons skilled in the art and are abundantly described in the literature [Maniatis T. et al., "Molecular Cloning, a Laboratory Manual", Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., 1982; Ausubel F. M. et al. (eds), "Current Protocols in Molecular Biology", John Wiley & Sons, New York, 1987].
The pBR322 and pUC type plasmids and the phages of the M13 series are of commercial origin (Bethesda Research Laboratories).
For the ligations, the DNA fragments can be separated according to their size by agarose or acrylamide gel electrophoresis, extracted with phenol or with a phenol/chloroform mixture, precipitated with ethanol and then incubated in the presence of phage T4 DNA ligase (Biolabs) according to the recommendations of the supplier.
The filling of the protruding 5' ends can be carried out by the Klenow fragment of DNA polymerase I of E. coli (Biolabs) according to the specifications of the supplier. The destruction of the protruding 3' ends is carried out in the presence of phage T4 DNA polymerase (Biolabs) used according to the recommendations of the manufacturer. The destruction of the protruding 5' ends is carried out by a controlled treatment with S1 nuclease.
The site-directed mutagenesis in vitro with synthetic oligodeoxynucleotides can be carried out according to the method developed by Taylor et al. [Nucleic Acids Res. 13 (1985) 8749-8764] using the kit distributed by Amersham.
The enzymatic amplification of DNA fragments by the so-called PCR technique [Polymerase-catalyzed Chain Reaction, Saiki R. K. et a.l, Science 230 (1985) 1350-1354; Mullis K. B. et Faloona F. A., Meth. Enzym. 155 (1987) 335-350] can be carried out using a "DNA thermal cycler" (Perkin Elmer Cetus) according to the specifications of the manufacturer.
The verification of the nucleotide sequences can be carried out by the method developed by Sanger et al. [Proc. Natl. Acad. Sci. USA, 74 (1977) 5463-5467] using the kit distributed by Amersham.
1. Isolation of the Grb3-3 gene
The Grb3-3 gene was isolated by screening a human DNA library by means of a probe derived from the sequence of the Grb2 gene.
500,000 lambda gt11 recombinant phages carrying DNA fragments derived from a human placenta library (Clontech) were screened by means of a probe derived from the sequence of the Grb2 gene. The probe used corresponds to the first 8 amino acids of the Grb2 protein, and has the following sequence:
ATGGAAGCCATCGCCAAATATGAC (SEQ ID No. 3)
10 positive clones were thus identified. The insert of these 10 clones was isolated in the form of EcoRI fragments, cloned into the plasmid M13mp18 and sequenced. Among these 10 clones, 9 carried inserts identical to the Grb2 sequence. Only one of them carried an insert of a size smaller than the Grb2 gene, because of a deletion in the SH2 domain (FIG. 1). Analysis of the remaining sequence revealed a perfect identity with the corresponding regions of Grb2, including in the non-coding 5' and 3' regions. The open reading frame of this clone encodes a protein of 177 amino acids (SEQ ID No. 2), containing 2 SH3 domains bordering an incomplete SH2 domain (FIG. 1). The amino acids deleted in the SH2 domain (residues 60 to 100 of the Grb2 protein) correspond to the residues involved in the binding of Grb2 to the peptides containing phosphorylated tyrosines.
2. Binding activity of the Grb3-3 protein
As indicated above, the Grb2 protein is the mediator of the interaction between the phosphorylated growth factor receptors and the SOS factors. This example demonstrates that the Grb3-3 protein is incapable of interacting with the phosphorylated EGF receptor but that it conserves its capacity to interact with a proline-rich peptide derived from the sequence of the human SOS1 factor.
The binding capacity of Grb3-3 was studied using biotinylated Glutathione-S-transferase (GST) fusion proteins. This type of fusion permits a rapid and efficient purification of the recombinant products. For that, the sequences of the invention were expressed in the E. coli GT1 strain in the form of fusion proteins with GST according to the technique described by Smith and Johnson [Gene 67 (1988) 31]. Briefly, the Grb2 and Grb3-3 genes were first modified by introducing a BamHI site on either side of the start and stop codons. For that, the open reading frames of these genes were amplified by PCR by means of the following oligonucleotides:
| Oligonucleotide I (5')(SEQ ID NO. 4): | |
| GAATTCGGATCCATGGAAGCCATCGCCAAATATGACTTC | |
| Oligonucleotide II (3')(SEQ ID NO. 5): | |
| GAATTCGGATCCTTAGACGTTCCGGTTCACGGGGGTGAC |
The underlined part corresponds to the BamHI site created, followed or preceded by the start and stop codons.
The genes thus amplified were then cloned in the form of BamHI fragments into the vector pGEX 2T (Pharmacia) linearized by the same enzyme, in 3' and in frame in a cDNA encoding GST. The vectors thus obtained were then used to transform the E. coli TG1 strain. The cells thus transformed were precultured overnight at 37°C C., diluted 1/10 in LB medium, supplemented with IPTG in order to induce the expression (2 hours, 25°C C.) and then cultured for about 21 hours at 25°C C. The cells were then lysed, and the fusion proteins produced affinity-purified on an agarose-GHS column. For that, the bacterial lysate is incubated in the presence of the gel (prepared and equilibrated with lysis buffer) for 15 minutes at 4°C C. After 3 washes with Tris-HCl buffer pH 7.4, the proteins are eluted in the presence of a tris-HCl buffer pH 7.7 containing an excess of GST. The supernatent is harvested and centrifuged.
The same procedure was used to prepare a mutant of Grb2 in which the glycine 203 is replaced by an arginine (Grb2G203R) and a Grb3-3 mutant in which the glycine 162 is replaced by an arginine (Grb3-3G162R). The Grb2G203R mutant has been described as no longer having any activity in a test of reinitiation of DNA synthesis (Lowenstein et al., previously cited). The Grb3-3G162R mutant carries the same mutation in the same position, and should therefore also be inactive.
These mutants were prepared by mutagenesis by PCR on the Grb2 and Grb3-3 genes using, in 5', the oligonucleotide I described above, and in 3', the following oligonucleotide III in which the mutated codon is underlined:
Oligonucleotide III (3') (SEQ ID No. 6):
GACGTTCCGGTTCACGGGGGTGACATAATTGCGGGGAAACATGCGGGTC
The fragments thus amplified were then eluted, reamplified by PCR by means of the oligonucleotides I and II, and then cloned into the vector pGEX 2T. The mutants were then produced as described above.
The GST fusion proteins (GST-Grb2, GST-Grb3-3, GST-Grb3-3G162R and GST) were then biotinylated by conventional techniques known to persons skilled in the art (cf. general molecular biology techniques as well as Mayer et al., PNAS 88 (1991) 627), and used as probes to determine the binding to the immobilized phosphorylated EGF receptor (2.1.) and then to a peptide derived from hSOS1 (2.2.).
2.1. Binding to the phosphorylated EGF receptor
Procedure: The EGF receptor used was purified from A431 cells by immobilization on WGA-sepharose according to the technique described by Duchesne et al., (Science 259 (1993) 525). 2 μg of this receptor were first stimulated by 1 μM EGF, 10 min at 22°C C., and then incubated, with or without cold ATP (10 μM) in the presence of 2.5 mM MnCl2 in HNTG buffer (20 mM Hepes, 150 mM NaCl, 0.1% Triton, 10% glycerol, pH=7.5) at 4°C C. for 2 min. The phosphorylation of the receptor is then stopped by adding a degradation buffer. The samples are then deposited on a 4-20% SDS-PAGE gel and then transferred onto polyvinylidene difluoride membranes (PVDF). The blots were then incubated in the presence of various biotinylated GST fusions (2 μg/ml) and then revealed by means of alkaline-phosphatase coupled streptavidin (Promega). The EGF receptors were also subjected to an immunoblotting in the presence of anti-phosphotyrosine antibodies (anti-PY) in order to verify that the receptors have indeed been phosphorylated.
Results: The results obtained are presented in FIG. 2a. They show, as expected, that the Grb2 protein interacts with the EGF receptor in phosphorylated form alone. They also show that the Grb3-3 protein does not bind the EGF receptor, regardless of its degree of phosphorylation.
2.2. Binding to a peptide derived from hSOS1
Procedure: the following two proline-rich peptides were synthesized:
hSOS1 Peptide: GTPEVPVPPPVPPRRRPESA: This peptide corresponds to residues 1143 to 1162 of the hSOS1 protein (Li et al., Nature 363 (1993) 83) responsible for the interaction between Grb2 and hSOS1 (SEQ ID No. 7).
3BP1 Peptide: PPPLPPLV: This peptide is derived from the 3BP1 protein, which is known to efficiently bind the SH3 domain of Ab1 and Src (Cicchetti et al., Science 257 (1992) 803)(SEQ ID No. 8).
Each of these peptides (1 μl, 10 mg/ml) was immobilized on nitrocellulose membrane. The membranes were then incubated in a blocking buffer (20 mM Tris pH=7.6, 150 mM NaCl, 0.1% Tween, 3% bovine albumin). The membranes were then incubated overnight at 4°C C. in the presence of the various biotinylated GST fusions (4 μg/ml) and then revealed by means of alkaline phosphatase-coupled streptavidin (Promega).
Results: The results obtained are presented in FIG. 2b. They show that Grb3-3, like Grb2, is capable of binding the hSOS1 peptide. They also show that this interaction is specific since no binding is observed with the 3BP1 peptide. Moreover, the results also show that the Grb3-3G162R mutant is no longer capable of binding the hSOS1 peptide, which confirms the importance of this residue and the functional role of this interaction.
3. Activity of the Grb3-3 protein
This example demonstrates that, in spite of its deletion in the SH2 domain, the Grb3-3 protein has a functional effect.
The activity of the Grb3-3 protein was studied by determining its capacity to cooperate with ras for the transactivation of a promoter possessing ras response elements (RRE) and governing the expression of a reporter gene.
The procedure used has been described for example in Schweighoffer et al., Science 256 (1992) 825. Briefly, the promoter used is a synthetic promoter composed of the murine promoter of the thymidine kinase gene and 4 repeated PEA1 elements derived from the polyoma enhancer (Wasylyk et al., EMBO J. 7 (1988) 2475): Py-TK promoter. This promoter directs the expression of the reporter gene, in this case of the bacterial gene for chloramphenicol acetyl transferase (CAT): Py-TK-CAT vector. The vectors for expressing the tested genes were constructed by inserting the said genes, in the form of BamHI fragments, into the BglII site of the plasmid pSV2. This site makes it possible to place the genes under the control of the early SV40 promoter.
ER22 cells which are 40% confluent were transfected with 0.5 μg of the vector Py-TK-CAT alone (Py) or in the presence of the expression vector carrying, under the control of the early SV40 promoter, the gene: Grb2, 2 μg, Grb3-3, 2 μg, Grb2(G203R) 2 μg, Grb3-3(G162R) 2 μg, or Grb3-3, 2 μg+Grb2, 2 μg. In each case, the total quantity of DNA was adjusted to 5 μg with an expression vector without insert. The transfection was carried out in the presence of lipospermine (Transfectam, IBF-Sepracor). The cells were maintained for 48 hours in culture in a DMEM medium supplemented with 0.5% foetal calf serum. The CAT activity (transactivation of the RER) was then determined as described by Wasylyk et al. (PNAS 85 (1988) 7952).
The results obtained are presented in FIG. 3. They show clearly that the expression of the Grb3-3 protein prevents the effects of the activation of a growth factor receptor. They also show that Grb2 in excess prevents the effects of Grb3-3 on the response to the growth factor.
4. Grb3-3 induces cellular apoptosis
This example demonstrates the direct involvement of Grb3-3 in cellular apoptosis. This property offers particularly advantageous applications for the treatment of pathologies resulting from a cellular proliferation (cancers, restenosis, and the like).
The induction of cellular apoptosis by Grb3-3 was demonstrated (i) by injecting recombinant protein into 3T3 fibroblasts and (ii) by transferring the Grb3-3 encoding sequence into the 3T3 cells.
(i) Injection of the recombinant protein
The recombinant Grb3-3 protein was prepared in the form of fusion protein with GST according to the procedure described in Example 2. The fusion protein was then treated with thrombin (0.25%, Sigma) in order to separate the GST part, and then purified by ion-exchange chromatography on a monoQ column. The fractions containing the recombinant protein were then concentrated by means of Microsep microconcentrators (Filtron) in a 20 mM phosphate buffer (pH 7) containing 100 mM NaCl. The purified protein thus obtained was injected (1 to 3 mg/ml) into cultured 3T3 cells by means of an automatic Eppendorf microinjector. The cells were then incubated at 34°C C. and photographed at regular intervals in order to follow the morphological transformations. The results obtained show that 5 hours after the injection of Grb3-3, most of the cells were dead whereas the injection under the same conditions of Grb2 or of the Grb3-3 mutant (G162R) had no effect on the viability of the cells.
(ii) Transfer of the sequence encoding the recombinant protein
A plasmid was constructed comprising the sequence SEQ ID No. 1 encoding the Grb3-3 protein under the control of the early promoter of the SV40 virus.
The 3T3 fibroblasts which are 40% confluent were transfected in the presence of lipospermine (Transfectam, IBF-Sepracor) with 0.5 or 2 μg of this expression plasmid. 48 hours after the transfection, 50% of the cells were in suspension in the medium, and the remaining cells, adhering to the wall, exhibited very substantial morphological changes (FIG. 4). Analysis by agarose gel electrophoresis showed, moreover, that the cells had an oligo-nucleosomal DNA fragmentation pattern characteristic of dead cells (FIG. 4). In contrast, the cells transfected under the same conditions with a Grb2, Grb3-3 (G162R) or Grb2 (G203R) expression plasmid retain a normal morphology, are always viable and show no DNA fragmentation. As shown in
These results therefore clearly show that Grb3-3 constitutes a killer gene capable of inducing cellular apoptosis. As indicated above, this property offers particularly advantageous applications for the treatment of pathologies resulting from a cellular proliferation such as especially cancers, restenosis and the like.
5. Demonstration of the expression of Grb3-3 in lymphocytes infected by the HIV virus
This example shows that, during the cycle for infection of the T lymphocytes by the HIV virus, the relative proportion of the Grb2 and Grb3-3 mRNAs is modified, and that the Grb3-3 messenger is overexpressed at the time of massive viral production and cell death.
Peripheral blood lymphocytes were infected with the HIV-1 virus at two dilutions (1/10 and 1/100) for 1, 4 or 7 days. The mRNAs from the cells were then analysed by inverse-PCR by means of oligonucleotides specific for Grb2 and Grb3-3 in order to determine the relative proportion of the Grb2 and Grb3-3 messengers. The Grb3-3-specific oligonucleotides used are the following:
| Oligonucleotide IV (3'): | |
| ATCGTTTCCAAACGGATGTGGTTT (SEQ ID NO. 9) | |
| Oligonucleotide V (5'): | |
| ATAGAAATGAAACCACATCCGTTT (SEQ ID NO. 10) |
The results obtained are presented in FIG. 5. They show clearly that 7 days after the infection with the HIV virus, the Grb3-3 MRNA is overexpressed. As shown by assaying the p24 protein and the virus reverse transcriptase, day 7 also corresponds to the period during which a massive viral production is observed.
Tocque, Bruno, Schweighoffer, Fabien
| Patent | Priority | Assignee | Title |
| Patent | Priority | Assignee | Title |
| 5434064, | Jan 18 1991 | New York University | Expression-cloning method for identifying target proteins for eukaryotic tyrosine kinases and novel target proteins |
| WO9407913, |
| Executed on | Assignor | Assignee | Conveyance | Frame | Reel | Doc |
| Aug 15 2000 | Aventis Pharma S.A. | (assignment on the face of the patent) | / |
| Date | Maintenance Fee Events |
| Feb 14 2006 | M1552: Payment of Maintenance Fee, 8th Year, Large Entity. |
| Jun 07 2010 | REM: Maintenance Fee Reminder Mailed. |
| Oct 29 2010 | EXP: Patent Expired for Failure to Pay Maintenance Fees. |
| Date | Maintenance Schedule |
| Dec 31 2005 | 4 years fee payment window open |
| Jul 01 2006 | 6 months grace period start (w surcharge) |
| Dec 31 2006 | patent expiry (for year 4) |
| Dec 31 2008 | 2 years to revive unintentionally abandoned end. (for year 4) |
| Dec 31 2009 | 8 years fee payment window open |
| Jul 01 2010 | 6 months grace period start (w surcharge) |
| Dec 31 2010 | patent expiry (for year 8) |
| Dec 31 2012 | 2 years to revive unintentionally abandoned end. (for year 8) |
| Dec 31 2013 | 12 years fee payment window open |
| Jul 01 2014 | 6 months grace period start (w surcharge) |
| Dec 31 2014 | patent expiry (for year 12) |
| Dec 31 2016 | 2 years to revive unintentionally abandoned end. (for year 12) |