soluble polypeptide fraction consisting of all or part one of at least one of the four immunoglobulin-type extracellular LAG-3 protein domains (amino acids 1-159, 160-230 239, 240-330 and 331-412 of the SEQ ID NO:1 sequence) or consisting of one peptide sequence derived from these domains by replacement, addition or deletion of one or more amino acids. The fraction of the invention has a specificity at least equal to that of LAG-3 in relation to its ligand.
|
0. 11. A soluble polypeptide comprising a first immunoglobulin type extracellular domain of LAG-
0. 1. A soluble polypeptide fraction consisting of at least one of the 4 immunoglobulin type extra-cellular domains of the LAG-3 protein (amino acids 1 to 4, 5 to 239, 240 to 330 and 331 to 412 of sequence SEQ ID NO:1), wherein one or more arginine (Arg) residues at positions 73, 75 and 76 of SEQ ID NO:1 are substituted with glutamic acid (Glu) and said at least one extra-cellular domain of LAG-3 protein is optionally fused to a supplementary peptide sequence as a fusion protein.
2. A soluble polypeptide fraction according to claim 1 11, further bound to a toxin or a radioisotope.
0. 3. A soluble polypeptide fraction according to
4. A soluble polypeptide fraction according to claim 3 13, wherein said supplementary peptide sequence comprises a portion of an immunoglobulin of IgG4 isotype.
5. A method for producing the soluble polypeptide fraction of claim 1 11, which soluble polypeptide fraction further comprises a portion of an immunoglobulin, comprising the steps of :
inserting a DNA molecule comprising a fusion of fragments of cDNA coding for the polypeptide regions corresponding to LAG-3 or derived from LAG3 with cDNA coding for the portion of the immunoglobulin; transfecting the DNA molecule into a host expression system; and producing the soluble polypeptide fraction by expression in the host.
0. 6. A soluble polypeptide fraction consisting of at least one of four immunoglobulin-type extracellular domains of LAG-3 protein corresponding to amino acid residues 1-4, 5-239, 240-330, and 331-412 of SEQ ID NO:1, fused to a supplementary peptide sequence as a fusion protein.
0. 7. A soluble polypeptide fraction according to
0. 8. A soluble polypeptide fraction according to
0. 9. A soluble polypeptide fraction according to
0. 10. A method for producing the soluble polypeptide fraction of
inserting a DNA molecule comprising a fusion of fragments of cDNA coding for the polypeptide regions corresponding to LAG-3 with cDNA coding for the portion of the immunoglobulin; transfecting the DNA molecule into a host expression system; and producing the soluble polypeptide fraction by expression in the host.
0. 12. A soluble polypeptide according to
13. A soluble polypeptide according to
14. A soluble polypeptide according to 15. A soluble polypeptide according to
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
This application is a §371 application of PCT/FR95/00593, filed May 5, 1995.
1. Field of the Invention
The invention relates to soluble forms derived from the LAG-3 membrane protein which are useful as immunosuppressants, as well as antibodies capable of preventing the specific binding of the LAG-3 protein to MHC (major histocompatibility complex) Class II molecules as immunostimulants.
2. Description of the Related Art
In WO-A 91/10682, a protein designated LAG-3 has been described.
The LAG-3 protein is a protein selectively expressed by NK cells and activated T lymphocytes. Similarity of the amino acid sequence, the comparative exon/intron organization and the chromosomal localization show that LAG-3 is related to CD4. The initial characterization of the LAG-3 gene has been described by TRIEBEL et al. (1).
The corresponding DNA codes for a type I transmembrane protein of 498 amino acids containing 4 extra-cellular sequences of the immunoglobulin type. LAG-3 is a member of the immunoglobulin superfamily.
The mature protein comprises 476 amino acids (SEQ ID No. 1) with a theoretical molecular weight of 52 kD. The extracellular region contains 8 cysteine residues and 4 potential N-glycosylation sites. By Western blot analysis, it was shown that LAG-3 inside PRA-blasts or activated NK cells has an apparent mass Mr of 70,000. After treatment with N-glycosidase F, a reduction in size to 60 kD was obtained, thereby demonstrating that native LAG-3 is glycosylated. Fuller details are described in WO-A 91/10682.
BAIXERAS et al., in J. Exp. Med. 176, 327-337 (2), have, in addition, described their finding that rosette formation between cells transfected with LAG-3 (expressing LAG-3 at their surface) and B lymphocytes expressing MHC Class II was specifically dependent on LAG-3/MHC Class II interaction.
Surprisingly, this ligand for MHC Class II was detected with higher levels on activated CD8+ lymphocytes (MHC Class I-restricted) than on activated CD4+ lymphocytes. In vivo, only a few disseminated LAG-3+ cells (MHC Class II-restricted) were to be found in non-hyperplastic lymphoid tissue comprising the primary lymphoid organs, that is to say thymus and bone marrow. LAG-3+ cells were to be found in hyperplastic lymphoid nodules and tonsils, as well as among peripheral blood mononuclear cells (PBMC) of patients receiving injections of high doses of IL-2.
These observations confirm that LAG-3 is an activation antigen in contrast to CD4 expressed in a subpopulation of resting lymphocytes and other cell types, in particular macrophages.
The MHC comprises Class I and Class II molecules which are membrane glycoproteins which present fragments of protein antigens to the T lymphocyte receptors (TCR). Class I molecules are responsible for the presentation to CD8+ cytotoxic cells of peptides derived in large part from endogenously synthesized proteins, while Class II molecules present to CD4+ helper lymphocytes peptides originating in the first place from foreign proteins which have entered the endocytic, that is to say exogenous, pathway. T helper lymphocytes regulate and amplify the immune response, while cytotoxic lymphocytes are needed to destroy cells irrespective of the tissues expressing "non-self" antigens, for example viral antigens. The mechanism of recognition involves intercellular signals leading to an effective activity of T lymphocytes.
It is apparent that, to initiate an immune response mediated by T (CD4+) lymphocytes, the foreign antigens must be captured and internalized in the form of peptides by specialized cells, the antigen presenting cells (APC). The resulting antigenic peptides are reexpressed at the surface of the antigen presenting cells, where they are combined with MHC Class II molecules. This MHC Class
The examples which follow, together with the attached reference figures, will illustrate the invention in greater detail.
The anti-LAG-3 monoclonal antibodies used were 17B4, described in BAIXERAS et al. (2) and deposited at the CNCM under No. I-1240 on Jul. 10, 1992, and 11E3, described in HUARD et al. (8).
These antibodies belong to the isotype IgG1. These antibodies were tested for their biological effects on activated T lymphocytes, stimulated by specific antigenic peptides or processed antigens presented by MHC Class II molecules expressed by autologous antigen presenting cells, expressing LAG-3.
An anti-CD48 monoclonal antibody designated 10 H3 was used as irrelevant IgG1 antibody (negative control).
The saturating concentrations of anti-LAG-3 and anti-CD48 antibodies were determined by immunofluorescence on PHA (phytohaemagglutinin)-blasts and cell lines transformed by Epstein-Barr virus (EBV). In the proliferation tests, the monoclonal antibodies were added in the proportion of 5 times the saturating concentration.
The T lymphocyte lines used were, on the one hand the clone 154 derived from peripheral blood lymphocytes, raised against a peptide mimicking an influenza haemagglutinin (HA) fragment having an amino acid sequence extending from amino acid 306 to 329 (p20 peptide), and on the other hand the clone 28, a T lymphocyte clone derived from peripheral lymphocytes of a single human donor, raised against diphtheria toxoid (DT). The antigen presenting cells (APC) corresponding to clone 154 were EBV-transformed B lymphocytes of the same donor (DR3/DR11) as T 154. The antigen presenting cells corresponding to clone 28 were EBV-transformed B lymphocytes of the same donor. This clone was restricted to HLA DR7.
For clone 154, the APC (5×106) were incubated at 37°C C. for one and a half hours with variable doses of the p20 peptide, then washed and irradiated (10,000 rad). The cells were plated out on 96-well microtitration plates at the same time as the clone 154 cells (0.5×105 to 10×105 cells/ml) in a 3:1 ratio. For clone 28, the responding cells/stimulating cells ratio was 1.
The HLA DR7/EBV APC cells were either treated with mitomycin or irradiated, then added to the T lymphocytes in the presence of DT (which remained in the culture). The final concentration of clone 28 cells was 100,000 cells/ml.
[3H]Thymidine (1 μCi/well) was added at varying time intervals from day 2 to day 10 of culture.
Each experiment was carried out in triplicate.
The results were expressed as the mean cpm and after subtraction of the cpm found in the negative control (T lymphocytes cocultured with APC unladen with immunogens). The proliferation tests were carried out on 96-well plates. The absorption of tritiated thymidine in the individual 200 μl wells was measured after adding 1 μCi of thymidine for the last 18 hours of culture. The results were expressed in the form of the mean of 3 tests. The standard deviation was usually less than 12% (a little more in the case of very low cpm measurements). Moreover, mixed culture (clone 154/APC) supernatants were combined, filtered through 0.22 μm membranes, divided into samples and frozen at -20°C C. until the time of titration using commercial immunoassay kits: Immunotech IL-2 and INF-α titration kit, Genzyme IFN-γ kit and Cayman Chemicals IL-4 kit.
A dose determination study was carried out to establish the proliferation profiles of clone 154 brought into contact with the p20 specific antigen at varying concentrations and in the presence or absence of anti-LAG-3 monoclonal antibodies or irrelevant monoclonal antibodies (negative control).
The individual results of 16 separate tests showed that, irrespective of the concentration of added antigen, the initial point up to the peak of proliferation was not modified, but a significant prolongation of the proliferation of T lymphocytes incubated with the anti-LAG-3 monoclonal antibodies was observed systematically. Fab fragments of the monoclonal antibody 17B4 were prepared and used in a test of proliferation of clone 154. The proliferation profile of T lymphocytes activated by the antigen with the 17B4 Fab fragments (15 μg/ml) was similar to that of cells incubated in the presence of whole 17B4 monoclonal antibody (40 μg/ml) (FIG. 1). These results show that the observed biological effects are not attributable to a non-specific reaction induced by the Fc region of the anti-LAG-3 monoclonal antibodies.
Similar results were obtained with the 11E3 anti-LAG-3 monoclonal antibodies.
Clone 28 was also stimulated with the antigen (tetanus toxoid 10 μg/ml) in the presence of 17B4 monoclonal antibodies after coculture with the corresponding APC in the presence of DT. The results are shown in FIG. 2.
The effects of the anti-LAG-3 monoclonal antibodies observed with clone 28, namely the prolongation of proliferation, are similar to those observed with clone 154.
Tests were carried out designed to measure the miscellaneous cellular events occurring after the antigenic stimulation of clone 154 cells incubated in the presence of anti-LAG-3 monoclonal antibodies.
The cells were harvested during conventional antigenic stimulation of clone 154 in the presence of anti-LAG-3 or anti-CD48 monoclonal antibodies or in the absence of antibodies, and tested for the expression of LAG-3 and CD25 transmembrane receptors, and samples of culture supernatants were collected at different time intervals after stimulation and tested for the presence of IFN-γ, TNF-α, IL-4 and IL-2.
Two-colour direct immunofluorescence tests (anti-CD3 monoclonal antibodies and anti-CD25 monoclonal antibodies) showed that IL-2 receptors were weakly but significantly increased 5 days after the antigenic stimulation. Similar tests with anti-CD3 and 11E3 (anti-LAG-3) monoclonal antibodies showed that LAG-3 was over-expressed from the day following activation onwards. In addition, the secretion of IL-2, IL-4, IFN-γ and TNF-α was also modulated by incubation with anti-LAG-3 monoclonal antibodies, thus showing that different cellular events are modified by the presence of anti-LAG-3 monoclonal antibodies and that some events already take place 24 hours after stimulation.
These results show indirectly that LAG-3 plays a regulatory role for CD4+ cells. The fact that anti-LAG-3 monoclonal antibodies increase proliferation, and hence act as immunopotentiators, suggest that LAG-3 is involved in the "deactivation" of CD4+ T lymphocytes with a negative role of LAG-3 on the antigen-dependent stimulation.
Soluble proteins derived from LAG-3 were obtained by a recombinant DNA technique using suitable vectors comprising DNA coding for LAG-3 and DNA coding for an immunoglobulin fragment. The transient expression system consisted of transfected Cos cells. This system makes it possible to produce several mg of recombinant fusion proteins. Recombinant DNA techniques were carried out as described by MANIATIS et al. (22). The modifications were made as recommended by the manufacturer.
Fragments coding for the D1D2 or D1-D4 regions were amplified (30 cycles) from a fragment of cDNA (FDC sequence) encompassing LAG-3 cDNA (TRIEBEL et al. (1)), using Taq polymerase free from 5'-endonuclease activity and relatively resistant to an exposure to very high temperature; the amplification was followed by a denaturation at 98°C C. (with a Perkin Elmer Cetus "DNA thermal cycle"). Specific primers were used as recorded in the table below.
The resulting amplified fragments (739 bp and 1312 bp for LAG-3 D1-D2 and LAG-3 D1-D4, respectively) were inserted into a pBS plasmid (Stratagene).
Inserts were prepared after digestion with XhoI and BglII and introduced into the XhoI/BamHI sites of the vector pCDM7-CD8-IgG1 (pCDM7 being derived from pCDM8 marketed by Stratagene), as illustrated in
| TABLE 3 | |
| Primers used to amplify LAG-3 DNA sequences by PCR | |
| Resulting | |
| encoded subfrag- | |
| ment fused with | |
| Primers used for amplification of the DNA | a subfragment Ig |
| Primer (5') | LAG-3 D1D2 |
| 5' GCGCCTCGAGGCCCAGACCATAGGAGAGATGT 3' (SEQ ID NO: 2) | from the leader |
| coupling untranslated start of | sequence to |
| site 5' sequences translation | amino acid241 |
| 239 | |
| Primer (3') | |
| 5' GCGCAGATCTCTCCAGACCCAGAACAGTGAGGTTATACAT 3' (SEQ ID NO: 3) | |
| BglII coup- End of D2 | |
| ling site | |
| Primer (5') | LAG-3 D1-D4 |
| identical to LAG-3 D1D2 | from the leader |
| Primer (3') | sequence to |
| 5' GCGCAGATCTACCTGGGCTAGACAGCTCTGTGAA 3' (SEQ ID NO: 4) | amino acid 412 |
| BglII coup- End of D4 | |
| ling site | |
CDM7 is a eukaryotic expression vector derived from the vectors developed by SEED et al. (10) for the cloning of DNA and its expression in E. coli and eukaryotic cells. CDM7 possesses the following features: (i) the human cytomegalovirus promoter for transient expression in mammalian cells; (ii) a viral origin of SV40 for an autosomal replication of mammalian cells expressing T antigen; (iii) πVX (type Col E1) as plasmid origin for a high copy number; (iv) a Sup F selection for resistance to ampicillin and tetracycline in Tetamb and Ampamb E. coli strains; (v) an origin of replication of M13 for the release of a single strand; (vi) a T7 RNA promoter; and (vii) a polylinker for an efficient cloning of heterologous DNA.
Cos cells (5×106) were transfected with 30 μg of DNA of suitable expression vectors (coding for either LAG-3 D1D2 Ig, or LAG-3 D1-D4 Ig, or CD8 Ig) by electroporation (200 V, 1500 μF, 30-40 msec) using a Cellject apparatus (Eurogentech, Liège, BE). The cells were plated out again and cultured on a medium containing 5% of foetal calf serum. The supernatants were withdrawn 6 days after transfection.
The synthesis of the resulting fusion proteins was analysed from the supernatants as well as from cell extracts of transfected cells, by Western blot analysis with the 17B4 monoclonal antibodies. Immunoreactive materials were observed in the supernatant of cells transfected with DNA coding for LAG-3 D1D2 Ig or LAG-3 D1-D4 Ig.
Concomitantly, a recombinant CD8 immunoadhesin (CD8 Ig) was obtained as negative control using the same expression system and the expression vector pCDM7-CD8 (FIG. 3).
The recombinant proteins LAG-3 D1D2 Ig. LAG-3 D1-D4 Ig and CD8 Ig were purified by means of the standard method on protein A-Sepharose. The resulting material was analysed by SDS-PAGE, followed by Coomassie staining or a Western blot analysis using anti-human Ig antibody.
In order to produce large amounts of recombinant proteins, a stable expression system consisting of transfected mammalian cells was developed. The host cells are anchorage-dependent hamster ovary (CHO) cells isolated from CHO cells deficient in dihydrofolate reductase (DHFR) and consequently necessitating glycine, a purine and thymidine for their growth. The pivotal role of DHFR in the synthesis of nucleic acid precursors, combined with the sensitivity of DHFR-deficient cells with respect to tetrahydrofolate analogues such as methotrexate (MTX), has two major advantages. Transfection of these cells with expression vectors containing the DHFR gene permits the secretion of recombinant DHFR-resistant clones, and the culturing of these cells on selective media containing increasing amounts of MTX results in amplification of the DHFR gene and the DNA associated therewith.
Fragments of DNA coding for the D1, D1D2 or D1-D4 regions were amplified using a PCR method identical to the one described previously, using the primers specified in the table below.
| TABLE 4 | |
| Primers used for amplifying LAG-3 DNA sequences by PCR | |
| Resulting | |
| encoded | |
| Primers used for amplification of the DNA | subfragment |
| Primer (5') | LAG-3 D1 |
| 5' CGCCGTCGACCGCTGCCCAGACCATAGGAGAGATGTG 3' (SEQ ID NO:5) | from the leader |
| SalI coup- untranslated start of | sequence to |
| ling site 5' sequences translation | amino acid 149 159 |
| Primer (3') | |
| 5' GCGCGTCGACTTAACCCAGAACAGTGAGGTTATAC 3' (SEQ ID NO: 6) | |
| SalI coup- End of D1 | |
| ling site | |
| Primer (5') | LAG-3 D1D2 |
| identical to LAG-3 D1 | from the leader |
| Primer (3') | sequence to |
| 5' GCGCGTCGACTTAACCCAGAACAGTGAGGTTATAC 3' (SEQ ID NO: 7) | amino acid 239 |
| SalI[II] coup- End of D2 | |
| ling site | |
| Primer (3') | amino acid 149 |
| 5' GCGCGTCGACTTAACCCAGAACAGTGAGGTTATAC 3' (SEQ ID NO: 6) | |
| SalI coup- End of D1 | |
| ling site | |
| Primer (5') | LAG-3 D1-D4 |
| identical to LAG-3 D1 | from the leader |
| Primer (3') | sequence to |
| 5' GCGCGTCGACTTAACCCTGGGCTAGACAGCTCTCTGTG 3' (SEQ ID NO:8) | amino acid 412 |
| SalI coup- End of D4 | |
| ling site | |
The resulting amplified fragments were digested with SalI and inserted into the SalI site of pUC 18 (Stratagene).
The amplified sequences were verified, and the inserts subcloned into the expression vector pCLH3 AXS V2 DHFR hα IVS as described by COLE et al. (Biotechnology 11, 1014-1024, 1993) (FIG. 4).
This vector is a eukaryotic expression vector which is multifunctional for the expression C cDNA and its amplification in eukaryotic cells. It possesses the following features: (i) the murine promoter of the metallothionein-1 gene and a polyadenylation sequence SV 40 (comprising a donor-acceptor splicing site) to bring about transcription of the gene of interest, (ii) a human intervening sequence A containing the donor-acceptor splicing site of the gene for the subunit of α glycoprotein for obtaining high levels of transcription of cDNA, (iii) the pML sequence containing the origin of replication of pBR322 and a gene for resistance to aampicillin ampicillin for bacterial amplification, and (iv) a DHFR transcription unit of SV 40 to bring about transcription of the sequences used for selection and amplification of the transfectants.
The expression vectors coding for LAG-3 D1, LAG-3 D1D2 and LAG-3 D1-D4 were used to transfect CHO DUKX cells, and these cells were cultured on a selective medium. Cells capable of multiplying under these conditions were combined and cultured on a medium containing increasing amounts of MTX. Levels of expression were measured by Western blot analysis using the 17B4 monoclonal antibody. Clones producing high levels of recombinant soluble molecules derived from LAG-3 were propagated in bioreactors, and the material derived from LAG-3 was purified by ion exchange chromatography and immunoaffinity.
Western blot analyses revealed, in supernatants of cells transfected with expression vectors coding for LAG-3 D1, LAG-3 D1D2 and LAG-3 D1-D4, bands with apparent Mr values of 15 to 18 kD, 34-36 kD (doublets) and 55 kD (2 possible bands). The respective Mr values of these immunoreactive materials corresponded to the expected Mr values of glycosylated LAG-3 D1 Ig (139 amino acids and a putative N-glycosylation site), glycosylated LAG-3 D1D2 Ig (239 amino acids containing 3 glycosylation sites) and glycosylated LAG-3 D1-D4 (412 amino acids containing 4 glycosylation sites).
The reactivity of the monoclonal antibodies and of LAG-3 D1-D4 Ig was studied by indirect immunofluorescence. Target cells (4×105) were incubated for 30 minutes at 4°C C. in the presence of LAG-3 D1-D4 Ig, CD8 Ig, a murine monoclonal antibody, (949) anti-human MHC Class II (DR, DP, DQ) conjugated to FITC (isothiocyanate fluoride) from a Coulter clone, or murine Ig-FITC; an irrelevant immunoglobulin G conjugated to FITC. The cells were washed and incubated at 4°C C. for 30 minutes with either a goat anti-human Ig polyclonal F(ab')2 conjugated to fluorescein or a goat anti-mouse Ig polyclonal antibody conjugated to fluorescein (Coulter clone).
To confirm the LAG-3/MHC Class II binding, LAG-3 D1-D4 Ig was incubated with MHC Class II-positive or -negative cells. Four B lymphocyte lines expressing MHC Class II(L31, Phil EBV, Raji, Sanchez and Personnaz) were treated with anti-Class II monoclonal antibody 949, or the supernatants for Cos cells transfected with DNA coding either for LAG-3 D1-D4 Ig or for CD8 Ig. The five cell lines expressing the different haplotypes of MHC Class II molecules were recognized by LAG-3 Ig in the same way as by the anti-Class II monoclonal antibodies (positive control), while the supernatant containing CD8 Ig (negative control) did not bind to these cell lines, as could be expected. Four MHC Class II-negative cell lines (CEM, RJ, HSB2, K562) were treated with the same reagents as above. None reacted, either with the anti-MHC Class II (negative control) or with LAG-3 D1-D4 Ig, showing that the binding of LAG-3 D1-D4 is specific to MHC Class II molecules.
Further experiments were carried out using (i) mouse fibroblasts transfected or otherwise with genes coding for human DR7 or human DP4, (ii) mouse cells expressing or otherwise MHC Class II molecules, (iii) activated human CD4+ or CD8+ cells, and (iv) T lymphocyte lines expressing the different haplotypes of MHC Class II molecules (FIG. 8).
Unlike CD8 Ig, LAG-3 D1-D4 Ig binds to all cells expressing MHC Class II as efficiently as the anti-MHC Class II monoclonal antibody 949. LAG-3 D1-D4 Ig binds to all DR and DP haplotypes tested, to human MHC Class II molecules expressed by transfected mouse cells, to murine MHC Class II molecules and also to MHC Class II molecules expressed by CD4+ or CD8+ T lymphocytes.
These results represent for the first time proof that soluble molecules derived from a ligand for MHC Class II are capable of binding to cells expressing MHC Class II.
Similar experiments showed that LAG-3 D1D2 bound to cells expressing MHC Class II in as specific a manner and with the same efficiency as LAG-3 D1-D4.
The capacity of this immunoadhesin to bind to cell ligands is measured using a fluorescein-labeled goat serum directed against human immunoglobulins.
In these experiments, the target cells are first incubated with a human monoclonal antibody or an immunoadhesin for 30 min at 4°C C. in RPMI 1640 containing 10% of FCS (foetal calf serum). The cells are then incubated with an FITC-labelled goat anti-mouse immunoglobulin serum (Coulter) for the murine monoclonal antibodies or with an FITC-labelled goat anti-human immunoglobulin serum (Tago) for the immunoadhesins. The fluorescence is measured after two washes, analyzing 3,000 cells with an Elite cytometer (Coultronics, Hialeah, Fla.).
LAG-3Ig binds to mouse fibroblasts transfected for the gene for the HLA DR4 molecule, and does not bind to untransfected cells. CD8Ig is incapable of binding to HLA DR4+ fibroblasts under the same conditions.
The cellular distribution of the ligands for LAG-3Ig was evaluated on a cell population sample by immunofluorescence.
LAG-3Ig is visualized on all positive Class II cells tested, including B cell lines transformed by Epstein-Barr virus (derived from genetically unrelated donors, including 10 homozygous lines of DR1 to DR10 typing), as well as on activated T and NK cells.
The mean fluorescence intensity with LAG-3Ig is similar to that observed with antibody 949 which is specific for Class II antigens. The binding of LAG-3Ig to DR4 (FIG. 9). DR2, DR7 or DPw4 (not shown) expressed at the surface of mouse fibroblasts is, in contrast, weaker than that observed for antibody 949.
No binding is detected on cell lines which are negative for Class II antigens of T origin (peripheral blood T cells, CEM, HSB2, REX lines), of B origin (RJ 2.2.5 line) or of non-lymphoid origin (human lines, K562 of erythromyoloid origin and line originating from melanoma cells (not shown)).
Moreover, LAG-3Ig binds to xenogeneic Class II molecules of the MHC, such as the antigens expressed by mouse lymphoid A 20 and the monkey Classes II expressed by phytohaemagglutinin-stimulated blasts (data not shown).
The specificity of binding of LAG-3Ig was also verified using the monoclonal antibodies 17B4, whose capacity to block LAG-3/MHC Class II interactions in cell adhesion tests was demonstrated beforehand (FIG. 10).
In these experiments, the LAG-3Ig molecules are preincubated for 30 minutes at 4°C C. either with medium alone, or with 17B4 (1 mg/ml), or with OKT3 (1 mg/ml), before being brought into contact with Daudi cells.
The inhibition of LAG-3/MHC Class II interaction by the soluble fragments of LAG-3 may be observed directly in relation to the binding of LAG-3Ig by Class II MHC molecules, by competitive experiments with the soluble fragments.
To verify whether the soluble LAG-3D1D2 fragments produced by CHO cells could displace the binding of immunoadhesins derived from LAG-3, the following tests were carried out:
Daudi cells are incubated with soluble LAG3-D1D2 fragments so as to permit the binding of these molecules to the MHC Class II antigens expressed at the surface of the Daudi cells.
In a second step, the cells are incubated in the presence of LAG-3D1D4Ig in dimeric form or LAG-3D1D2Ig in monomeric form.
The binding of these immunoadhesins derived from LAG-3 is measured using a goat anti-human Ig F(ab')2 conjugated to fluorescein (GAH-FITC).
The control groups are represented by Daudi cells incubated with dimeric LAG-3D1D4Ig or monomeric LAG-3D1D2Ig without preincubation with the soluble LAG-3D1D2 fragments.
The results are recorded in Table 5, which shows that the soluble LAG-3D1D2 fragments are capable of displacing the immunoadhesins derived from LAG-3 in monoor mono or dimeric form.
| TABLE 5 | |||
| Mean Fluor- | |||
| Reactants | Detection | escence | Conclusion |
| -- | GAH-FITC | 0.3 | GAH does not |
| interfere | |||
| Dimeric | GAH-FITC | 20.8 | The binding of |
| LAG-3D1D4Ig | CHO/LAG-3D1D2 | ||
| inhibits the binding | |||
| CHO/LAG-3D1D2, | GAH-FITC | 8.5 | of dimeric |
| then dimeric | LAG-3D1D4Ig (58%) | ||
| LAG-3D1D4Ig | |||
| Monomeric | GAH-FITC | 62.5 | The binding of |
| LAG-3D1D2Ig | CHO/LAG-3D1D2 | ||
| inhibits the binding | |||
| CHO/LAG-3D1D2 | GAH-FITC | 10.9 | of monomeric |
| then monomeric | LAG-3D1D2Ig (27%) | ||
| LAG-3D1D2Ig | |||
These data confirm that the soluble LAG-3D1D2 fragments bind to MHC Class II molecules.
Rosette formation between Cos cells transfected with wild-type LAG-3 and B lymphocytes transformed with EBV expressing MHC Class II molecules was demonstrated by BAIXERAS et al. (2). This interaction is inhibited both by anti-LAG-3 and anti-MHC Class II monoclonal antibodies.
The method described in this publication was modified by replacing the visualization and counting of Cos cells binding to B lymphocytes by counting the radioactivity remaining after incubation of 51Cr-labelled B lymphocytes with Cos cells expressing LAG-3 (binding assay).
The possible inhibitory effects of soluble molecules derived from LAG-3 on LAG-3/MHC Class II interaction, and also on CD4/MHC Class II interaction, were studied.
Cos cells transfected with a suitable expression vector (coding for wild-type LAG-3 or for CD4). Two days later, the Cos cells were treated with trypsin and plated out again on the basis of 0.05×106 cells/well on a flat-bottomed 12-well tissue culture plates, 24 hours later. 51Cr-labelled Daudi cells (5.5×106) were incubated on this monolayer of Cos cells (final vol.: 1 ml) for 1 hour. The target B cells were then aspirated off and the wells washed 5 to 7 times, gently adding 1 ml of medium dropwise. The edges of the wells were washed by suction using a Pasteur pipette. The remaining cells were lysed with 1 ml of PBS, 1% Triton for 15 minutes at 37°C C. The lysates were centrifuged at 3000 rpm for 10 minutes, and 100 μl of the resulting supernatant were counted.
LAG-3 D1-D4 Ig was used to inhibit LAG-3/MHC Class II and CD4/MHC Class II interaction in the 51Cr binding assay. Human CD8 Ig and IgG1 were tested in parallel and used as negative controls.
A significant inhibition of LAG-3/Class II interaction by LAG-3 D1-D4 Ig was detected (FIG. 5A). However, the LAG-3/MHC Class II interaction can be partially and non-specifically inhibited by human CD8 Ig and IgG1. Moreover, LAG-3 Ig proved to be a potential inhibitor of CD4/Class II interaction (
Functional tests were performed using the proliferation tests described above for the biological activity of the anti-LAG-3 monoclonal antibodies.
3 days and 5 days (D3 and D5) after antigenic stimulation, LAG-3 D1-D4 Ig showed a strong inhibition of the proliferation of clone 28, while human CD8 Ig and IgG had no effect (FIG. 6). Similar experiments were carried out with clone 154 (FIG. 7), and showed a partial inhibition in the presence of LAG-3 Ig. A control carried out with anti-LAG-3 monoclonal antibodies had the reverse effects, as observed previously.
A significant inhibition of the cell proliferation of cells incubated in the presence of LAG-3 D1-D4 Ig was also observed for clone 28.
These observations show that LAG-3 D1-D4 Ig is a potential immunosuppressant of the proliferation of T lymphocytes stimulated by an antigen, and indicate that LAG-3 might act as an "extinguisher" of the secondary immune response induced by activated CD4+ T helper lymphocytes.
To demonstrate that a soluble form of LAG-3, mimicking the functions of the membrane molecule, could inhibit the activation of CD4+ T clones stimulated by an antigen, the following tests were carried out on clone T154: the T cells are incubated beforehand with a saturating amount of LAG-3Ig (100 nM). The cells are then washed twice with cold RPMI and incubated with 10 μg/ml of goat antibodies directed against human immunoglobulins (Tago) at 4°C C. for 30 minutes.
After two more washes, the cells are resuspended in RPMI containing 10% of foetal calf serum and incubated for 2 hours at 37°C C. before adding the signal. To couple ("cross-link") the monoclonal antibodies, a goat anti-mouse antibody at a concentration of 10 μg/ml (Tago) is used.
The possible effects of bound ("cross-linked") anti-Class II monoclonal antibodies in relate to the proliferation of T cells were compared to those of LAG-3Ig. A weak inhibition (less than 50%) is observed with antibody 949 and antibody D1.12 (anti-DR) bound to a goat anti-mouse polyclonal serum (FIG. 12). The inhibition of proliferation is hence epitope-dependent, the largest effect being obtained with the epitope of LAG-3 specific for the binding to Classes Class II.
The effects of LAG-3 Ig on the proliferation of T cells were also studied using different signals on another CD4+ T clone, clone TDEL specific for peptide 34-53 of the basic myelin protein.
An inhibition of proliferation is observed (n=2) when TDEL is stimulated with the antigen (not shown), with immobilized OKT3 (FIG. 13A), with lectins (PHA+PMA) (
In conclusion, these results collectively show that LAG-3 and MHC Class II molecules, which are each T cell-activating antigens, may be likened to effector molecules involved in the phase of inactivation of T cell responses. Moreover, these results illustrate the importance of interactions between T cells in the control of the cellular immune response.
The role of LAG-3Ig in relation to cell cytotoxicity is studied on two types of effector cells:
freshly drawn human peripheral blood lymphocytes (PBL),
S1B5 line cells (clone of human NK cells).
The cytotoxic activity of these cells is measured by counting the 51Cr released into the medium by previously labelled target cells, in the presence or absence of LAG-3Ig in the medium.
Measurements are carried out after 4 hours of coculture for effector/target (S1B5/LAZ 388) cell ratios of 3:1 (clear columns) or 1:1 (shaded columns).
The negative controls consist of medium alone (MED), the immunoadhesin CD8Ig and the monoclonal antibody 17.B4 (anti-LAG-3).
The positive controls consist of three different monoclonal antibodies:
antibody L243 directed against Class II DR antigens,
antibody 9.49 directed against Class II DR, DP, DQ antigens,
antibody W632 directed against human major histocompatibility complex Class I antigens.
Anti-HLA Class I (W632) or Class II (L243) antibodies increase the lysis of the target cells (and not the 17B4 control). The immunoadhesin LAG-3Ig increases the lysis. The CD8Ig control has no effect.
No change is observed with an antibody directed against major histocompatibility complex Class I antigens (W632).
The data from these two series of measurements shown that, compared to negative controls, LAG-3Ig activates the cytotoxicity of NK cells. This effect is similar to the one observed with antibodies directed against MHC Class II molecules.
1. TRIEBEL T. et al., 1990, J. Exp. Med. 171, 1393-1405
2. BAIXERAS E. et al., 1992, J. Exp. Med. 176, 327-337
3. COSGROVE D. et al., 1991, Cell 66, 1051-1066
4. RAHEMTULLA A. et al., 1991, Nature 353, 180-184
5. TRAUNECKER A. et al., 1988, Nature 351, 84-86
6. BENEDICT A. A. et al., 1967, Methods in Immunology 1, 197-306 (1967)
7. YELTON D. E. et al., Ann. Rev. of Biochem. 50, 657-680 (1981)
8. HUARD B. et al., Immunogenetics 39: 213
9. MANIATIS T. et al. (1982), Molecular cloning: A laboratory manual--Cold Spring Harbor Laboratory, New-York.
10. SEED B., 1987, Nature 329, 840-842
11. COLE S. C. et al., Biotechnology 11, 1014-1024, 1993
12. COLE S. C. et al., Biotechnology 11, 1014-1024, 1993.
| TABLE NO. 1 | |||||||
| residue | atom type, | ||||||
| Atom | name and | charge and | |||||
| name | x | y | z | no. | no. | ||
| N | 25.172370911 | 27.259836197 | 67.855064392 | AP-n | 40 n3 | -0.5000 | 1 |
| NN2 | 25.667764664 | 26.471963882 | 67.420585632 | AP-n | 40 hn | 0.1300 | 2 |
| CA | 24.625223160 | 26.867494583 | 69.180244446 | AP-n | 40 ca | 0.1200 | 3 |
| NN1 | 24.393711090 | 27.474891663 | 67.220008850 | AP-n | 42 hn | 0.1300 | 4 |
| MA | 23.936895370 | 27.680395126 | 69.464080811 | AP-n | 40 h | 0.0700 | 5 |
| C | 25.662780726 | 26.773513794 | 70.350120544 | AP-n | 40 c' | 0.3800 | 6 |
| O | 25.295415878 | 27.090747833 | 71.482070923 | AP-n | 40 o' | -0.4100 | 7 |
| CB | 23.766021729 | 25.587018967 | 68.990669250 | AP-n | 40 c2 | -0.2600 | 8 |
| MB1 | 23.060285568 | 25.72443695 | 68.152351379 | AP-n | 40 h | 0.0700 | 9 |
| MB2 | 24.413969040 | 24.744903564 | 68.686981201 | AP-n | 40 h | 0.0700 | 10 |
| CG | 22.921775818 | 25.153419495 | 70.196960449 | AP-n | 40 c- | 0.3400 | 11 |
| DD1 | 22.069602966 | 25.929233551 | 70.676017761 | AP-n | 40 o- | -0.5700 | 12 |
| DD2 | 23.115716934 | 24.009321213 | 70.667663574 | AP-n | 40 o- | -0.5700 | 13 |
| M | 26.906179428 | 26.304588318 | 70.124969482 | SER | 41 n | -0.5000 | 14 |
| CA | 27.860145569 | 25.912786484 | 71.207519531 | SER | 41 ca | 0.1200 | 15 |
| HN | 27.120641708 | 26.221813202 | 69.126319885 | SER | 41 hn | 0.2800 | 16 |
| MA | 27.374551773 | 25.088045120 | 71.766326904 | SER | 41 h | 0.1000 | 17 |
| C | 28.252065659 | 27.005065918 | 72.271789551 | SER | 41 c' | -0.3800 | 18 |
| O | 27.987834930 | 28.200620651 | 72.115295410 | SER | 41 o' | -0.3800 | 19 |
| CB | 29.083601227 | 25.298025131 | 70.494880676 | SER | 41 c2 | -0.1700 | 20 |
| MB1 | 28.786190033 | 24.599395752 | 69.690521240 | SER | 41 h | 0.1000 | 21 |
| MB2 | 29.691858292 | 26.092912674 | 70.004081726 | SER | 41 h | 0.1000 | 22 |
| OG | 29.905221939 | 24.578149796 | 71.424118042 | SER | 41 oh | -0.3800 | 23 |
| HG | 30.662555695 | 24.231645584 | 70.939277649 | SER | 41 ho | 0.3500 | 24 |
| N | 28.857526779 | 26.558052063 | 73.387054443 | GLY | 42 n | -0.5000 | 25 |
| CA | 29.199718475 | 27.440891266 | 74.535232544 | GLY | 42 cg | 0.0200 | 26 |
| MN | 29.251720428 | 25.616510391 | 73.267890930 | GLY | 42 hn | 0.2800 | 27 |
| MA1 | 28.520187378 | 28.312047958 | 74.591857910 | GLY | 42 h | 0.1000 | 28 |
| MA2 | 28.983697891 | 26.890144348 | 75.468444824 | GLY | 42 h | 0.1000 | 29 |
| C | 30.691051483 | 27.875793457 | 74.601707458 | GLY | 42 c' | 0.3800 | 30 |
| O | 31.504199982 | 27.026502609 | 74.980445862 | GLY | 42 o' | -0.3800 | 31 |
| N | 31.113182068 | 29.132183075 | 74.266487122 | PRO | 43 n | -0.4200 | 32 |
| CA | 32.858349609 | 29.476200104 | 74.126792908 | PRO | 43 ca | 0.0600 | 33 |
| HA | 33.096603394 | 28.605407715 | 73.708091736 | PRO | 43 h | 0.1000 | 34 |
| CD | 30.24075089 | 30.174203873 | 73.722633362 | PRO | 43 c2 | 0.0600 | 35 |
| MD1 | 29.467987061 | 30.516298294 | 74.466743469 | PRO | 43 h | 0.1000 | 36 |
| MD2 | 29.664882660 | 29.799777985 | 72.838768005 | PRO | 43 h | 0.1000 | 37 |
| C | 33.318023682 | 29.988374710 | 75.414916992 | PRO | 43 c' | 0.3800 | 38 |
| O | 32.682361603 | 30.557033539 | 76.312332153 | PRO | 43 o' | -0.3800 | 39 |
| CB | 32.483139038 | 30.574260712 | 73.043136597 | PRO | 43 c2 | -0.2000 | 40 |
| MB1 | 33.350620270 | 31.263189316 | 73.049049377 | PRO | 43 h | 0.1000 | 41 |
| MB2 | 32.463790894 | 30.110534668 | 72.036743164 | PRO | 43 h | 0.1000 | 42 |
| CG | 31.160949707 | 31.299722672 | 73.307487488 | PRO | 43 c2 | -0.2000 | 43 |
| MG1 | 31.279897690 | 32.024162292 | 74.137779236 | PRO | 43 h | 0.1000 | 44 |
| MG2 | 30.794561386 | 31.862808228 | 72.428352356 | PRO | 43 h | 0.1000 | 45 |
| K | 34.683673859 | 29.902477264 | 75.503486633 | PRO | 44 n | -0.4200 | 46 |
| CA | 35.485736847 | 30.679145813 | 76.490524292 | PRO | 44 ca | 0.0600 | 47 |
| KA | 35.018527985 | 30.645456314 | 77.491592407 | PRO | 44 h | 0.1000 | 48 |
| CD | 35.509281158 | 29.014368057 | 74.655700684 | PRO | 44 c2 | 0.0600 | 49 |
| MD1 | 35.411357880 | 29.247959137 | 73.577461243 | PRO | 44 h | 0.1000 | 50 |
| MD2 | 35.214973450 | 27.955932617 | 74.801994324 | PRO | 44 h | 0.1000 | 51 |
| C | 35.700843811 | 32.172924042 | 76.063224792 | PRO | 44 c' | 0.3800 | 52 |
| O | 36.448230743 | 32.477428436 | 75.126922607 | PRO | 44 o' | -0.3800 | 53 |
| CB | 36.779544830 | 29.842718124 | 76.547348022 | PRO | 44 c2 | -0.2000 | 54 |
| HB1 | 37.662769315 | 30.430650711 | 75.863670149 | PRO | 44 h | 0.1000 | 55 |
| HB2 | 36.667564392 | 29.027103424 | 77.288825989 | PRO | 44 h | 0.1000 | 56 |
| CG | 36.940769196 | 29.250995636 | 75.143180867 | PRO | 44 c2 | -0.2000 | 57 |
| MG1 | 37.446662903 | 29.982709885 | 74.483322144 | PRO | 44 h | 0.1000 | 58 |
| MG2 | 37.553295135 | 26.329860667 | 75.134750366 | PRO | 44 h | 0.1000 | 59 |
| N | 35.026676178 | 33.104183197 | 76.753837585 | ALA | 45 h | -0.5000 | 60 |
| CA | 35.034278870 | 34.544979095 | 76.400695801 | ALA | 45 ca | 0.1200 | 61 |
| MN | 34.452354431 | 32.747509003 | 77.536170959 | ALA | 45 hn | 0.2800 | 62 |
| MA | 35.105010986 | 34.659946442 | 75.298950195 | ALA | 45 h | 0.1000 | 63 |
| C | 36.209384918 | 35.322113037 | 77.076705833 | ALA | 45 c' | 0.3800 | 64 |
| O | 36.163528442 | 35.637268066 | 78.268325806 | ALA | 45 o' | -0.3800 | 65 |
| CB | 33.646369934 | 35.083190918 | 76.800727844 | ALA | 45 c3 | -0.3000 | 66 |
| MB1 | 33.534698486 | 36.150661469 | 76.535202026 | ALA | 45 h | 0.1000 | 67 |
| MB2 | 32.828392029 | 34.539138794 | 76.290328979 | ALA | 45 h | 0.1000 | 68 |
| MB3 | 33.465579987 | 35.001335144 | 77.890525818 | ALA | 45 h | 0.1000 | 69 |
| N | 37.266757965 | 35.613758087 | 76.297294617 | ALA | 46 n | -0.5000 | 70 |
| MN | 37.216701508 | 35.231555939 | 75.346885681 | ALA | 46 hn | 0.2800 | 71 |
| CA | 38.489383698 | 36.310386658 | 76.786270142 | ALA | 46 ca | 0.1200 | 72 |
| MA | 38.262126923 | 36.871456146 | 77.716934204 | ALA | 46 h | 0.1000 | 73 |
| C | 39.058414459 | 37.311935425 | 75.727844238 | ALA | 46 c' | 0.3800 | 74 |
| O | 38.922710419 | 37.100418091 | 74.516731262 | ALA | 46 o' | -0.3800 | 75 |
| CB | 39.526046753 | 35.215301514 | 77.108406067 | ALA | 46 c3 | -0.3000 | 76 |
| MB1 | 40.446556091 | 35.633434296 | 77.555480957 | ALA | 46 h | 0.1000 | 77 |
| MB2 | 39.131206512 | 34.469978333 | 77.822120667 | ALA | 46 h | 0.1000 | 78 |
| MB3 | 39.821903229 | 34.663463593 | 76.197715759 | ALA | 46 h | 0.1000 | 79 |
| N | 39.737388611 | 38.384365082 | 76.180320740 | ALA | 47 n | -0.5000 | 80 |
| CA | 40.295833588 | 39.429889679 | 75.275863647 | ALA | 47 ca | 0.1200 | 81 |
| MN | 39.717037201 | 38.512592316 | 77.196357727 | ALA | 47 hn | 0.2800 | 82 |
| MA | 39.901103973 | 39.219335938 | 74.245994568 | ALA | 47 h | 0.1000 | 83 |
| C | 41.869789124 | 39.413467407 | 75.170806885 | ALA | 47 c' | 0.3800 | 84 |
| O | 42.518333435 | 40.166862488 | 75.906578044 | ALA | 47 o' | -0.3800 | 85 |
| CB | 39.722030640 | 40.769996643 | 75.786285400 | ALA | 47 c3 | -0.3000 | 86 |
| MB1 | 40.045078278 | 41.611721039 | 75.145561218 | ALA | 47 h | 0.1000 | 87 |
| MB2 | 38.615306854 | 40.778987885 | 75.787467957 | ALA | 47 h | 0.1000 | 88 |
| MB3 | 40.059757233 | 41.007873535 | 76.813346863 | ALA | 47 h | 0.1000 | 89 |
| N | 42.537422180 | 38.621597290 | 74.274406433 | PRO | 48 n | -0.4200 | 90 |
| CA | 44.009857178 | 38.718185425 | 74.045745850 | PRO | 48 ca | 0.0600 | 91 |
| MA | 44.539390564 | 38.855972290 | 75.008773804 | PRO | 48 h | 0.1000 | 92 |
| CD | 41.903011322 | 37.522361755 | 73.516281128 | PRO | 48 c2 | 0.0600 | 93 |
| MD1 | 41.081176758 | 37.871139526 | 72.860626221 | PRO | 48 h | 0.1000 | 94 |
| MD2 | 41.490711312 | 36.761222839 | 74.206848145 | PRO | 48 h | 0.1000 | 95 |
| C | 44.448683322 | 39.844142914 | 73.044319153 | PRO | 48 c' | 0.3800 | 96 |
| O | 43.693031311 | 40.225761414 | 72.144134521 | PRO | 48 o' | -0.3800 | 97 |
| CB | 44.302902771 | 37.304885864 | 73.500595093 | PRO | 48 c2 | -0.2000 | 98 |
| MB1 | 45.227554321 | 37.245840894 | 72.897834778 | PRO | 48 h | 0.1000 | 99 |
| MB2 | 44.442562103 | 36.597515106 | 74.341529846 | PRO | 48 h | 0.1000 | 100 |
| CG | 43.051033020 | 36.925685883 | 72.702011108 | PRO | 48 c2 | -0.2000 | 101 |
| MG1 | 43.084365845 | 37.389282227 | 71.696128845 | PRO | 48 h | 0.1000 | 102 |
| MG2 | 42.948661804 | 35.835418701 | 72.555740356 | PRO | 48 h | 0.1000 | 103 |
| N | 45.700798035 | 40.324272156 | 73.165817261 | GLY | 49 n | -0.5000 | 104 |
| CA | 46.289730072 | 41.291931152 | 72.184875488 | GLY | 49 cg | 0.0200 | 105 |
| MN | 46.207077026 | 39.986907959 | 73.991729736 | GLY | 49 hn | 0.2800 | 106 |
| MA1 | 45.620616913 | 41.460151672 | 71.317451477 | GLY | 49 h | 0.1000 | 107 |
| MA2 | 46.357063293 | 42.283206940 | 72.672386169 | GLY | 49 h | 0.1000 | 108 |
| C | 47.682319641 | 40.950855255 | 71.600997925 | GLY | 49 c' | 0.3800 | 109 |
| O | 48.560806274 | 41.811416626 | 71.601501465 | GLY | 49 o' | -0.3800 | 110 |
| N | 47.842975616 | 39.718383789 | 71.091018677 | HIS | 50 n | -0.5000 | 111 |
| MN | 46.947166443 | 39.222202301 | 71.052452087 | HIS | 50 hn | 0.2800 | 112 |
| CA | 49.020114899 | 39.216835022 | 70.306198120 | HIS | 50 ca | 0.1200 | 113 |
| MA | 49.324539185 | 38.296181652 | 70.836235046 | HIS | 50 h | 0.1000 | 114 |
| C | 50.400863647 | 39.993576050 | 70.182159941 | HIS | 50 c' | 0.3800 | 115 |
| O | 50.733478546 | 40.446022034 | 69.081466675 | HIS | 50 o' | -0.3800 | 116 |
| CB | 48.455345154 | 38.673969269 | 68.953773499 | HIS | 50 c2 | -0.2000 | 117 |
| HB1 | 49.238502502 | 38.051708221 | 68.481765747 | HIS | 50 h | 0.1000 | 118 |
| HB2 | 47.639427185 | 37.951225281 | 69.144165039 | HIS | 50 h | 0.1000 | 119 |
| CG | 47.954322815 | 39.695293427 | 67.919425964 | HIS | 50 c5 | 0.1000 | 120 |
| MD1 | 46.759342194 | 40.404747009 | 68.035293579 | HIS | 50 np | -0.4200 | 121 |
| CE1 | 46.825572968 | 41.133701324 | 66.873245239 | HIS | 50 c5 | 0.2700 | 122 |
| NE2 | 47.887611389 | 40.964004517 | 66.014495850 | HIS | 50 np | -0.5000 | 123 |
| CD2 | 48.617565155 | 40.019775391 | 66.717041016 | HIS | 50 c5 | 0.0100 | 124 |
| ME1 | 46.043247223 | 41.852840424 | 66.655242920 | HIS | 50 h | 0.1300 | 125 |
| ME2 | 48.092224121 | 41.403381348 | 65.108955383 | HIS | 50 hn | 0.2800 | 126 |
| MD2 | 49.566501617 | 39.599807739 | 66.396347046 | HIS | 50 h | 0.1300 | 127 |
| N | 51.278770447 | 40.105480194 | 71.226615906 | PRO | 51 n | -0.4200 | 128 |
| CA | 52.667034149 | 40.618915558 | 71.077911377 | PRO | 51 ca | 0.0600 | 129 |
| MA | 52.723186493 | 41.393623352 | 70.287094116 | PRO | 51 h | 0.1000 | 130 |
| CD | 50.956447601 | 39.767082214 | 72.624496469 | PRO | 51 c2 | 0.0600 | 131 |
| MD1 | 50.920970917 | 38.670558929 | 72.747383118 | PRO | 51 h | 0.1000 | 132 |
| MD2 | 49.988422394 | 40.190521240 | 72.947166443 | PRO | 51 h | 0.1000 | 133 |
| C | 53.707103729 | 39.478122711 | 70.804489136 | PRO | 51 c' | 0.3800 | 134 |
| O | 53.623699188 | 38.391666412 | 71.391418457 | PRO | 51 o' | -0.3800 | 135 |
| CB | 52.846694946 | 41.283794403 | 72.455955505 | PRO | 51 c2 | -0.2000 | 136 |
| MB1 | 53.907955170 | 41.442169189 | 72.729286194 | PRO | 51 h | 0.1000 | 137 |
| MB2 | 52.373264313 | 42.285846710 | 72.449127197 | PRO | 51 h | 0.1000 | 138 |
| CG | 52.105823517 | 40.370025635 | 73.440398170 | PRO | 51 c2 | -0.2000 | 139 |
| MG1 | 52.782051086 | 39.565395355 | 73.789718628 | PRO | 51 h | 0.1000 | 140 |
| MG2 | 51.753723145 | 40.912036896 | 74.337333679 | PRO | 51 h | 0.1000 | 141 |
| N | 54.704883575 | 39.729522705 | 69.933471680 | LEU | 52 n | -0.5000 | 142 |
| CA | 55.791530609 | 35.746330261 | 69.603820801 | LEU | 52 ca | 0.1200 | 143 |
| MN | 54.653743744 | 40.652229308 | 69.490356445 | LEU | 52 hn | 0.2800 | 144 |
| MA | 56.479202271 | 39.288208008 | 68.927917480 | LEU | 52 h | 0.1000 | 145 |
| C | 35.301837921 | 37.525024414 | 68.745040894 | LEU | 52 c' | 0.3800 | 146 |
| O | 55.637695313 | 37.425930023 | 67.562049866 | LEU | 52 o' | -0.3800 | 147 |
| CB | 56.671585083 | 38.316761017 | 70.829437256 | LEU | 52 c2 | -0.2000 | 148 |
| MB1 | 56.036743164 | 37.710464478 | 71.502593994 | LEU | 52 h | 0.1000 | 149 |
| MB2 | 57.445541382 | 37.602729797 | 70.487434387 | LEU | 52 h | 0.1000 | 150 |
| CG | 57.363307953 | 39.420749664 | 71.675102234 | LEU | 52 c1 | -0.1000 | 151 |
| MG | 56.617557526 | 40.200679779 | 71.926834106 | LEU | 52 h | 0.1000 | 152 |
| CD1 | 57.875057220 | 38.833915710 | 73.004547119 | LEU | 52 c3 | -0.3000 | 153 |
| MD11 | 58.353130341 | 39.601875305 | 73.642135620 | LEU | 52 h | 0.1000 | 154 |
| MD12 | 57.048751831 | 38.403957367 | 73.601577759 | LEU | 52 h | 0.1000 | 155 |
| MD13 | 58.618564606 | 38.028480530 | 72.852462769 | LEU | 52 h | 0.1000 | 156 |
| CD2 | 58.531608582 | 40.085853577 | 70.927200317 | LEU | 52 c3 | -0.3000 | 157 |
| MD21 | 59.028976440 | 40.857166290 | 71.545303345 | LEU | 52 h | 0.1000 | 158 |
| MD22 | 59.309509277 | 39.355545044 | 70.634819031 | LEU | 52 h | 0.1000 | 159 |
| MD23 | 58.192760468 | 40.592193604 | 70.005569458 | LEU | 52 h | 0.1000 | 160 |
| N | 54.534648895 | 36.601863861 | 69.354270935 | ALA | 53 h | -0.5000 | 161 |
| CA | 53.940563202 | 35.420303345 | 68.673507690 | ALA | 53 ca | 0.1200 | 162 |
| MN | 54.159572601 | 36.958141327 | 70.246543884 | ALA | 53 hn | 0.2800 | 163 |
| HA | 53.600482941 | 35.753322601 | 67.671340942 | ALA | 53 h | 0.1000 | 164 |
| C | 52.639778137 | 34.883575439 | 69.383995056 | ALA | 53 c' | 0.3800 | 165 |
| O | 51.628326416 | 34.818698883 | 68.677047729 | ALA | 53 o' | -0.3800 | 166 |
| CB | 55.008785248 | 34.330768585 | 68.423698425 | ALA | 53 c3 | -0.3000 | 167 |
| MB1 | 54.582756042 | 33.460170746 | 67.892036438 | ALA | 53 h | 0.1000 | 168 |
| MB2 | 55.828662872 | 34.711517334 | 67.787284851 | ALA | 53 h | 0.1000 | 169 |
| MB3 | 55.479701896 | 33.961406708 | 69.351325989 | ALA | 53 h | 0.1000 | 170 |
| N | 52.555103302 | 34.484893799 | 70.698265076 | PRO | 54 n | -0.4200 | 171 |
| CA | 51.304950714 | 33.917499542 | 71.286506653 | PRO | 54 ca | 0.0600 | 172 |
| MA | 50.878768921 | 33.172523499 | 71.584587097 | PRO | 54 h | 0.1000 | 173 |
| CD | 53.705833435 | 34.435420990 | 71.626182556 | PRO | 54 c2 | 0.0600 | 174 |
| MD1 | 54.215991974 | 35.409980774 | 71.739936829 | PRO | 54 h | 0.1000 | 175 |
| MD2 | 54.453365326 | 33.693523407 | 71.288909912 | PRO | 54 h | 0.1000 | 176 |
| C | 50.177021027 | 34.945980072 | 71.642837524 | PRO | 54 c' | 0.3800 | 177 |
| O | 50.377983093 | 36.164409637 | 71.677795410 | PRO | 54 o' | -0.3800 | 178 |
| CB | 51.867893219 | 33.173828125 | 72.519187927 | PRO | 54 c2 | -0.2000 | 179 |
| MB1 | 51.135505676 | 33.051830292 | 73.340660095 | PRO | 54 h | 0.1000 | 180 |
| MB2 | 52.181377411 | 32.150829315 | 72.232276917 | PRO | 54 h | 0.1000 | 181 |
| CG | 53.087123871 | 33.989192963 | 72.949317932 | PRO | 54 c2 | -0.2000 | 182 |
| MG1 | 52.768703461 | 34.871643066 | 73.538475037 | PRO | 54 h | 0.1000 | 183 |
| MG2 | 53.791828156 | 33.414070129 | 73.579086304 | PRO | 54 h | 0.1000 | 184 |
| N | 48.977436066 | 34.414421082 | 71.936706543 | GLY | 55 n | 0.5000 | 185 |
| CA | 47.822620392 | 35.225021362 | 72.404747009 | GLY | 55 cg | 0.0200 | 186 |
| MN | 48.958133698 | 33.389709473 | 71.929512024 | GLY | 55 hn | 0.2800 | 187 |
| MA1 | 47.830284119 | 36.238574982 | 71.983676453 | GLY | 55 h | 0.1000 | 188 |
| MA2 | 46.896526337 | 34.772380829 | 72.004432678 | GLY | 55 h | 0.1000 | 189 |
| C | 47.670829773 | 35.263648987 | 73.950416565 | GLY | 55 c' | 0.3800 | 190 |
| O | 47.247509003 | 34.242198944 | 74.498336792 | GLY | 55 o' | -0.3800 | 191 |
| N | 47.956153870 | 36.372848511 | 74.696281433 | PRO | 56 n | -0.4200 | 192 |
| CA | 47.830066681 | 36.396587372 | 76.179130554 | PRO | 56 ca | 0.0600 | 193 |
| MA | 48.225147247 | 35.457695007 | 76.619560242 | PRO | 56 h | 0.1000 | 194 |
| CD | 48.653686523 | 37.556163788 | 74.163940430 | PRO | 56 c2 | 0.0600 | 195 |
| MD1 | 48.108860016 | 38.040233612 | 73.332565308 | PRO | 56 h | 0.1000 | 196 |
| MD2 | 49.652721405 | 37.256084442 | 73.799308777 | PRO | 56 h | 0.1000 | 197 |
| C | 46.361907959 | 36.804877472 | 76.668052673 | PRO | 56 c' | 0.3800 | 198 |
| O | 45.890090942 | 37.732730865 | 76.845039368 | PRO | 56 o' | -0.3800 | 199 |
| CB | 48.804897308 | 37.531764984 | 76.560951233 | PRO | 56 c2 | -0.2000 | 200 |
| MB1 | 48.542221069 | 38.034294128 | 77.511970520 | PRO | 56 h | 0.1000 | 201 |
| MB2 | 49.825592041 | 37.124942236 | 76.697402954 | PRO | 56 h | 0.1000 | 202 |
| CG | 48.782566071 | 38.488700867 | 75.368530273 | PRO | 56 c2 | -0.2000 | 203 |
| MG1 | 47.903289795 | 39.158111572 | 75.434867859 | PRO | 56 h | 0.1000 | 204 |
| MG2 | 49.679012299 | 39.133480072 | 75.321792603 | PRO | 56 h | 0.1000 | 205 |
| N | 45.650573730 | 35.488880157 | 76.896896362 | HIS | 57 n | -0.5000 | 206 |
| MN | 46.046119690 | 34.657379150 | 76.439048767 | HIS | 57 hn | 0.2800 | 207 |
| CA | 44.244419098 | 35.504474640 | 77.387596130 | HIS | 57 ca | 0.1200 | 208 |
| MA | 43.667560577 | 36.207649231 | 76.759368896 | HIS | 57 h | 0.1000 | 209 |
| C | 44.173530579 | 35.943927765 | 78.901000977 | HIS | 57 c' | 0.3800 | 210 |
| O | 44.750030518 | 35.234142303 | 79.736030579 | HIS | 57 o' | -0.3800 | 211 |
| CB | 43.610416412 | 34.095542908 | 77.185058594 | HIS | 57 c2 | -0.2000 | 212 |
| MB1 | 44.270858765 | 33.323795319 | 77.623748779 | HIS | 57 h | 0.1000 | 213 |
| MB2 | 42.689029694 | 34.034877777 | 77.796188354 | HIS | 57 h | 0.1000 | 214 |
| CB | 43.250400543 | 33.671833038 | 75.751731873 | HIS | 57 c5 | 0.1000 | 215 |
| MD1 | 44.116428375 | 33.723646257 | 74.666069031 | HIS | 57 np | -0.4200 | 216 |
| CE1 | 43.325973511 | 33.139041901 | 73.713264465 | HIS | 57 c5 | 0.2700 | 217 |
| ME2 | 42.066158295 | 32.716590881 | 74.036811829 | HIS | 57 np | -0.5000 | 218 |
| CD2 | 42.045005798 | 33.048488617 | 75.379264832 | HIS | 57 c5 | 0.0100 | 219 |
| ME1 | 43.722070465 | 33.001682281 | 72.711807251 | HIS | 57 h | 0.1300 | 220 |
| ME2 | 41.370864868 | 32.229383759 | 73.464263916 | HIS | 57 hn | 0.3800 | 221 |
| MD2 | 41.236827850 | 32.815635681 | 76.058380127 | HIS | 57 h | 0.1300 | 222 |
| N | 43.513858795 | 37.068405151 | 79.318038940 | PRO | 58 n | -0.4200 | 223 |
| CA | 43.593978882 | 37.569736481 | 80.719970703 | PRO | 58 ca | 0.0600 | 224 |
| MA | 44.657642365 | 37.630668640 | 81.026939392 | PRO | 58 h | 0.1000 | 225 |
| CD | 42.833599091 | 38.010932922 | 78.407653809 | PRO | 58 c2 | 0.0600 | 226 |
| MD1 | 42.093353271 | 37.516807556 | 77.751007080 | PRO | 58 h | 0.1000 | 227 |
| MD2 | 43.569110870 | 38.527889252 | 77.758674622 | PRO | 58 h | 0.1000 | 228 |
| C | 42.805988312 | 36.695770264 | 81.747009277 | PRO | 58 c' | 0.3800 | 229 |
| O | 41.569808960 | 36.693984985 | 81.769706726 | PRO | 58 o' | -0.3800 | 230 |
| CB | 43.072513580 | 39.016571045 | 80.579101563 | PRO | 58 c2 | -0.2000 | 231 |
| MB1 | 42.559799194 | 39.392253876 | 81.485702515 | PRO | 58 h | 0.1000 | 232 |
| MB2 | 43.920654297 | 39.706352234 | 80.398040771 | PRO | 58 h | 0.1000 | 233 |
| CG | 42.156440735 | 38.999496460 | 79.353399631 | PRO | 58 c2 | -0.2000 | 234 |
| MG1 | 41.151851654 | 38.629653931 | 79.634307861 | PRO | 58 h | 0.1000 | 235 |
| MG2 | 42.023620605 | 39.998752594 | 78.896965027 | PRO | 58 h | 0.1000 | 236 |
| N | 43.540618896 | 35.961261749 | 82.605430603 | ALA | 59 n | -0.5000 | 237 |
| MN | 44.537330627 | 35.932937622 | 82.365699768 | ALA | 59 hn | 0.2800 | 238 |
| CA | 42.949653625 | 34.946208954 | 83.526855469 | ALA | 59 ca | 0.1200 | 239 |
| MA | 42.197692871 | 34.355514526 | 82.965911865 | ALA | 59 h | 0.1000 | 240 |
| C | 42.208984375 | 35.488883972 | 84.803985596 | ALA | 59 c' | 0.3800 | 241 |
| O | 42.496433258 | 35.127353668 | 85.948333740 | ALA | 59 o' | -0.3800 | 242 |
| CB | 44.107444763 | 33.975612640 | 83.839767456 | ALA | 59 c3 | -0.3000 | 243 |
| MB1 | 43.761249542 | 33.130538940 | 84.463287354 | ALA | 59 h | 0.1000 | 244 |
| MB2 | 44.544620514 | 33.531585693 | 82.924507141 | ALA | 59 h | 0.1000 | 245 |
| MB3 | 44.925910950 | 34.467308044 | 84.399597168 | ALA | 59 h | 0.1000 | 246 |
| N | 41.192062378 | 36.323741913 | 84.559051514 | ALA | 60 n | -0.5000 | 247 |
| MN | 41.124549866 | 36.554992676 | 83.555343628 | ALA | 60 hn | 0.2800 | 248 |
| CA | 40.203086853 | 36.790748596 | 85.562988281 | ALA | 60 ca | 0.1200 | 249 |
| MA | 40.023948669 | 35.965785980 | 86.283721924 | ALA | 60 h | 0.1000 | 250 |
| C | 38.823528290 | 37.027305602 | 84.846977234 | ALA | 60 c' | 0.3800 | 251 |
| O | 37.897804260 | 36.283885956 | 85.186340332 | ALA | 60 o' | -0.3800 | 252 |
| CB | 40.756233215 | 37.971691132 | 86.389617920 | ALA | 60 c3 | -0.3000 | 253 |
| MB1 | 40.004146578 | 38.357006073 | 87.102043152 | ALA | 60 h | 0.1000 | 254 |
| MB2 | 41.631908417 | 37.656120300 | 86.987319946 | ALA | 60 h | 0.1000 | 255 |
| MB3 | 41.090072632 | 38.818138123 | 85.765472412 | ALA | 60 h | 0.1000 | 256 |
| N | 38.616340637 | 37.921970367 | 83.823921204 | PRO | 61 n | -0.4200 | 257 |
| CA | 37.403762817 | 37.874496460 | 82.948486328 | PRO | 61 ca | 0.0600 | 258 |
| MA | 36.491020223 | 37.824863434 | 83.573593140 | PRO | 61 h | 0.1000 | 259 |
| CD | 39.556003571 | 39.003845215 | 83.459777832 | PRO | 61 c2 | 0.0600 | 260 |
| MD1 | 40.594814301 | 38.658158052 | 83.304046631 | PRO | 61 h | 0.1000 | 261 |
| MD2 | 39.571029663 | 39.778694153 | 84.250648498 | PRO | 61 h | 0.1000 | 262 |
| C | 37.275394440 | 36.712963104 | 81.892074585 | PRO | 61 c' | 0.3800 | 263 |
| O | 36.366387939 | 36.670307159 | 81.183484568 | PRO | 61 o' | -0.3800 | 264 |
| CB | 37.473857880 | 39.266963959 | 82.286987305 | PRO | 61 c2 | -0.2000 | 265 |
| MB1 | 36.949714661 | 39.321308136 | 81.312759399 | PRO | 61 h | 0.1000 | 266 |
| MB2 | 36.985511780 | 40.017913818 | 82.938987732 | PRO | 61 h | 0.1000 | 267 |
| CG | 38.968631744 | 39.571613312 | 82.168632507 | PRO | 61 c2 | -0.2000 | 268 |
| HG1 | 39.397396088 | 39.046298981 | 81.292793274 | PRO | 61 h | 0.1000 | 269 |
| HG2 | 39.180202484 | 40.649600983 | 82.039207458 | PRO | 61 h | 0.1000 | 270 |
| N | 38.242324829 | 35.777751923 | 81.785034180 | SER | 62 n | -0.5000 | 271 |
| CA | 38.186004639 | 34.624855042 | 80.844123840 | SER | 62 ca | 0.1200 | 272 |
| MN | 39.035541534 | 35.827360535 | 82.416992185 | SER | 62 hn | 0.2800 | 273 |
| MA | 37.921787262 | 35.006183624 | 79.841125488 | SER | 62 h | 0.1000 | 274 |
| C | 37.145660400 | 33.532897949 | 81.261909485 | SER | 62 c' | 0.3800 | 275 |
| O | 37.466091156 | 32.626064301 | 82.041137695 | SER | 62 o' | -0.3800 | 276 |
| CB | 39.620265961 | 34.048240662 | 80.725196835 | SER | 62 c2 | -0.1700 | 277 |
| MB1 | 39.660293579 | 33.306644440 | 79.904281616 | SER | 62 h | 0.1000 | 278 |
| MB2 | 40.349685669 | 34.832687378 | 80.442802429 | SER | 62 h | 0.1000 | 279 |
| OG | 40.032703400 | 33.414188385 | 81.938880920 | SER | 62 oh | -0.3800 | 280 |
| MG | 39.252223969 | 32.931293488 | 82.256263733 | SER | 62 ho | 0.3500 | 281 |
| N | 35.902244568 | 33.647918701 | 80.764541626 | SER | 63 n | -0.5000 | 282 |
| CA | 34.747528076 | 32.874965942 | 81.297317505 | SER | 63 cg | 0.1200 | 283 |
| MN | 35.768447876 | 34.503852844 | 80.205200195 | SER | 63 hn | 0.2800 | 284 |
| MA | 35.064254761 | 32.265518188 | 82.170570374 | SER | 63 h | 0.1000 | 285 |
| C | 34.106758118 | 31.936998367 | 80.231674194 | SER | 63 c' | 0.3800 | 286 |
| O | 33.716896657 | 32.367130280 | 79.142120361 | SER | 63 o' | -0.3800 | 287 |
| CB | 33.716815948 | 33.889484406 | 81.843544006 | SER | 63 c2 | -0.1700 | 288 |
| MB1 | 34.199871063 | 34.571354430 | 82.572105408 | SER | 63 h | 0.1000 | 289 |
| MB2 | 33.22880719 | 34.543502808 | 81.036796570 | SER | 63 h | 0.1000 | 290 |
| OG | 33.634590149 | 33.222091675 | 82.496467590 | SER | 63 oh | -0.3800 | 291 |
| MG | 32.159793854 | 32.710407257 | 81.832328796 | SER | 63 ho | 0.3500 | 292 |
| N | 33.914913177 | 30.658897400 | 80.588378906 | TRP | 64 n | -0.5000 | 293 |
| CA | 33.112319946 | 29.694124222 | 79.783546448 | TRP | 64 ca | 0.1200 | 294 |
| MN | 34.221500397 | 30.422899246 | 81.538955658 | TRP | 64 hn | 0.2800 | 295 |
| MA | 33.404731750 | 29.812168121 | 78.721931458 | TRP | 64 h | 0.1000 | 296 |
| C | 31.573041916 | 29.961977005 | 79.883049011 | TRP | 64 c' | 0.3800 | 297 |
| O | 30.996980667 | 29.940891266 | 80.975959778 | TRP | 64 o' | -0.3800 | 298 |
| CB | 33.525466919 | 26.235471725 | 80.142707825 | TRP | 64 c2 | -0.2000 | 299 |
| MB1 | 32.950366974 | 27.534402847 | 79.508041382 | TRP | 64 h | 0.1000 | 300 |
| MB2 | 34.571674347 | 28.078489304 | 79.816658020 | TRP | 64 h | 0.1000 | 301 |
| CG | 33.405326843 | 27.783784866 | 81.611763000 | TRP | 64 c5 | 0.0000 | 302 |
| CD1 | 32.267101288 | 27.214570999 | 82.221214294 | TRP | 64 c5 | 0.1000 | 303 |
| NE1 | 32.481933594 | 26.953943253 | 83.590408325 | TRP | 64 np | -0.5000 | 304 |
| CE2 | 33.781952422 | 27.378627777 | 83.812339783 | TRP | 64 c5 | 0.1100 | 305 |
| CD2 | 34.355152230 | 27.881061554 | 82.617965698 | TRP | 64 c5 | 0.0000 | 306 |
| MD1 | 31.322025528 | 27.036033630 | 81.708480835 | TRP | 64 h | 0.1000 | 307 |
| ME1 | 31.820940018 | 26.578481674 | 84.279945374 | TRP | 64 hn | 0.2800 | 308 |
| CE3 | 35.681034088 | 28.394184113 | 82.615905762 | TRP | 64 cp | -0.1000 | 309 |
| ME3 | 36.128986359 | 28.784986496 | 81.714393616 | TRP | 64 h | 0.1000 | 310 |
| CE3 | 36.396430969 | 28.387191772 | 83.815704346 | TRP | 64 cp | -0.1000 | 311 |
| ME3 | 37.405311584 | 28.776082993 | 83.832160950 | TRP | 64 h | -0.1000 | 312 |
| CM2 | 35.830604553 | 27.888952255 | 84.994210925 | TRP | 64 cp | 0.1000 | 313 |
| MM2 | 36.410472870 | 27.896844844 | 85.506951904 | TRP | 64 h | 0.1000 | 314 |
| CZ2 | 34.527233124 | 27.382776260 | 85.014289856 | TRP | 64 cp | 0.1000 | 315 |
| MZ2 | 34.097515106 | 27.006088257 | 85.929389954 | TRP | 64 h | 0.1000 | 316 |
| N | 30.921349498 | 30.232547760 | 78.740600586 | GLY | 65 n | 0.5000 | 317 |
| CA | 29.460748672 | 30.504768372 | 78.692192078 | GLY | 65 cg | 0.0200 | 318 |
| MN | 31.520374298 | 30.302478790 | 77.901519775 | GLY | 65 hn | 0.2800 | 319 |
| MA1 | 29.073087692 | 30.896234512 | 79.650825500 | GLY | 65 h | 0.1000 | 320 |
| MA2 | 29.288171768 | 31.333106995 | 77.981094360 | GLY | 65 h | 0.1000 | 321 |
| C | 28.633579254 | 29.293350220 | 78.197364807 | GLY | 65 c' | 0.3800 | 322 |
| O | 25.866907883 | 29.137302399 | 76.975486755 | GLY | 65 o' | -0.3800 | 323 |
| N | 27.969013672 | 28.429246902 | 79.038352966 | PRO | 66 n | 0.0200 | 324 |
| CA | 27.282257080 | 27.212890625 | 78.846752930 | PRO | 66 ca | 0.0600 | 325 |
| MA | 27.989650726 | 26.634012222 | 77.917152405 | PRO | 66 h | 0.1000 | 326 |
| CD | 28.016592026 | 28.832529831 | 80.511337280 | PRO | 66 c2 | 0.0600 | 327 |
| MD1 | 27.731332779 | 29.836006927 | 80.880874634 | PRO | 66 h | 0.1000 | 328 |
| MD2 | 29.027824402 | 28.301166534 | 80.897590637 | PRO | 66 b | 0.1000 | 329 |
| C | 25.977466583 | 27.479314804 | 77.725341797 | PRO | 66 c' | 0.3800 | 330 |
| O | 25.217950821 | 25.417282104 | 77.982574463 | PRO | 66 o' | -0.3800 | 331 |
| CB | 27.045602798 | 26.422634125 | 79.851196258 | PRO | 66 c2 | -0.2000 | 332 |
| MB1 | 26.132562637 | 25.797079086 | 79.827728271 | PRO | 66 h | 0.1000 | 333 |
| MB2 | 27.890687943 | 25.729280472 | 80.029365540 | PRO | 66 h | -0.1000 | 334 |
| CG | 27.003501892 | 27.477243423 | 80.958015442 | PRO | 66 c2 | -0.2000 | 335 |
| MG1 | 25.990892410 | 27.921483994 | 81.014678955 | PRO | 66 h | 0.1000 | 336 |
| MH2 | 27.232566833 | 27.061700821 | 81.956459045 | PRO | 66 h | 0.1000 | 337 |
| N | 25.734319687 | 26.626403809 | 76.719802856 | ARG+ | 67 n | -0.5000 | 335 |
| CA | 24.603988647 | 26.793025970 | 75.767257690 | ARG+ | 67 ca | 0.1200 | 339 |
| MN | 26.386735916 | 25.841371536 | 76.649803162 | ARG+ | 67 hn | 0.2800 | 340 |
| MA | 24.496238708 | 27.874828339 | 75.561668396 | ARG+ | 67 h | 0.1000 | 341 |
| C | 23.227464676 | 26.224872589 | 76.267372131 | ARG+ | 67 c' | 0.2800 | 342 |
| O | 23.178310394 | 25.034952164 | 76.603759766 | ARG+ | 67 o' | -0.3800 | 343 |
| CB | 24.990055899 | 26.165229797 | 74.398826599 | ARG+ | 67 c2 | -0.2000 | 344 |
| MB1 | 24.135663986 | 26.318639755 | 73.709175110 | ARG+ | 67 h | 0.1100 | 345 |
| MB2 | 25.787433624 | 26.779323578 | 73.940032959 | ARG+ | 67 h | 0.1100 | 346 |
| CG | 25.439929962 | 24.676465988 | 74.361564636 | ARG+ | 67 c2 | -0.2000 | 347 |
| MG1 | 26.546255112 | 24.646316528 | 74.415458679 | ARG+ | 67 h | 0.1300 | 348 |
| MG2 | 25.092346191 | 24.131168365 | 75.261718750 | ARG+ | 67 h | 0.1300 | 349 |
| CD | 24.934387207 | 23.941221237 | 73.112297058 | ARG+ | 67 c2 | -0.0900 | 350 |
| MD | 23.838283539 | 23.774566650 | 73.188652039 | ARG+ | 67 h | 0.1300 | 351 |
| MD2 | 25.070211411 | 24.585262299 | 72.220893860 | ARG+ | 67 h | 0.1300 | 352 |
| ME | 25.665744781 | 22.657058716 | 72.968780518 | ARG+ | 67 n1 | -0.5000 | 353 |
| ME | 26.251846313 | 22.313375473 | 73.731925964 | ARG+ | 67 hn | 0.3600 | 354 |
| CZ | 25.689014435 | 21.902687073 | 71.871635437 | ARG+ | 67 cr | 0.4500 | 355 |
| MM1 | 26.493299484 | 20.879484177 | 71.859733582 | ARG+ | 67 n2 | -0.5000 | 356 |
| M11 | 27.072875705 | 20.740955353 | 72.690315247 | ARG+ | 67 hn | 0.3600 | 357 |
| MM12 | 26.520929337 | 20.119580078 | 71.006805420 | ARG+ | 67 hn | 0.3600 | 358 |
| MM2 | 24.956668854 | 22.117029190 | 70.805320740 | ARG+ | 67 n2 | -0.5000 | 359 |
| MM21 | 25.030595779 | 21.456792831 | 70.033142090 | ARG+ | 67 hn | 0.3600 | 360 |
| MM22 | 24.266489029 | 22.916227341 | 70.550784302 | ARG+ | 67 hn | 0.3600 | 361 |
| N | 22.080270767 | 26.971176147 | 76.244255066 | ARG+ | 68 n | -0.4200 | 362 |
| CA | 20.743734360 | 24.358839035 | 76.485237122 | PRO | 68 ca | 0.0600 | 363 |
| MA | 20.817556381 | 25.605155945 | 77.294357300 | PRO | 68 h | 0.1000 | 364 |
| CD | 22.076143265 | 28.448001862 | 76.342918396 | PRO | 68 c2 | 0.0600 | 365 |
| MD1 | 22.539228439 | 25.949869I56 | 75.469612122 | PRO | 68 h | 0.1000 | 366 |
| MD2 | 22.632146835 | 25.776126862 | 77.244499207 | PRO | 68 h | 0.1000 | 367 |
| C | 20.182382584 | 25.586324692 | 75.240180969 | PRO | 68 c' | 0.3800 | 368 |
| O | 20.420539856 | 24.381649017 | 75.139877319 | PRO | 68 o' | -0.3800 | 369 |
| CB | 19.948141098 | 27.549791336 | 77.062515259 | PRO | 68 c2 | -0.2000 | 370 |
| MB1 | 18.858430862 | 27.490163803 | 76.877128601 | PRO | 68 h | 0.1000 | 371 |
| MB2 | 20.066789627 | 27.567596436 | 78.163002014 | PRO | 68 h | 0.1000 | 372 |
| CG | 20.592071533 | 28.804227829 | 76.667755179 | PRO | 68 c2 | -0.2000 | 373 |
| MG1 | 20.158363342 | 29.031393051 | 75.478172302 | PRO | 68 h | 0.1000 | 374 |
| MG2 | 20.428398132 | 29.704229355 | 77.092338562 | PRO | 68 h | 0.1000 | 375 |
| N | 19.458055496 | 26.229068756 | 74.300010681 | ARG+ | 69 n | -0.5000 | 376 |
| CA | 18.893756866 | 25.542047501 | 73.096710205 | ARG+ | 69 ca | 0.1200 | 377 |
| MN | 19.221296310 | 27.198928833 | 74.529014587 | ARG+ | 69 hn | 0.2800 | 378 |
| MA | 19.667610168 | 24.872461319 | 72.660797119 | ARG+ | 69 h | 0.1000 | 379 |
| C | 18.514461517 | 26.608341217 | 72.012504375 | ARG+ | 69 c' | 0.3800 | 380 |
| O | 17.383218765 | 27.099323273 | 72.036094666 | ARG+ | 69 o' | -0.3800 | 381 |
| CB | 17.681777954 | 24.654710770 | 73.539657593 | ARG+ | 69 c2 | -0.2000 | 352 |
| MB1 | 18.011884689 | 23.935596466 | 74.315147400 | ARG+ | 69 h | 0.1100 | 383 |
| MB2 | 16.954420090 | 25.310214996 | 74.061965942 | ARG+ | 69 h | 0.100 | 384 |
| CG | 16.946891785 | 23.862810135 | 72.427490234 | ARG+ | 69 c2 | -0.2000 | 385 |
| MG1 | 16.649517059 | 24.851628113 | 71.612152100 | ARG+ | 69 h | 0.1300 | 386 |
| MG2 | 17.638776779 | 23.127803802 | 71.968805054 | ARG+ | 69 h | 0.1300 | 387 |
| CD | 15.688191414 | 23.166488647 | 72.975959775 | ARG+ | 69 c2 | -0.9000 | 388 |
| MD1 | 15.980383873 | 22.365550995 | 73.686569214 | ARG+ | 69 h | 0.1300 | 389 |
| MD2 | 15.090404510 | 23.898859024 | 73.554351807 | ARG+ | 69 h | 0.1300 | 390 |
| ME | 14.889810562 | 22.612804413 | 71.848815915 | ARG+ | 69 n1 | -0.5000 | 391 |
| ME | 15.272388458 | 22.616128922 | 70.898582458 | ARG+ | 69 hn | 0.3600 | 392 |
| CZ | 13.644455910 | 22.143890381 | 71.942466736 | ARG+ | 69 cr | 0.4500 | 393 |
| MM1 | 13.048615456 | 21.755460739 | 70.850708005 | ARG+ | 69 n2 | -0.5000 | 394 |
| MM11 | 13.576630592 | 21.832328796 | 69.979103058 | ARG+ | 69 hn | 0.3600 | 395 |
| MM12 | 12.090744019 | 21.411947250 | 70.936050933 | ARG+ | 69 hn | 0.3600 | 396 |
| MM2 | 12.989639282 | 22.056533813 | 73.074552507 | ARG+ | 69 n2 | -0.5000 | 397 |
| CZ | 13.644455910 | 22.143590381 | 71.942466736 | ARG+ | 69 cr | 0.4500 | 393 |
| MM1 | 13.048615456 | 21.755460739 | 70.850705008 | ARG+ | 69 n2 | -0.500 | 394 |
| MM11 | 13.576630592 | 21.822325796 | 69.979103088 | ARG+ | 69 hn | 0.3600 | 395 |
| MM12 | 12.090744019 | 21.411947250 | 70.936080933 | ARG+ | 69 hn | 0.3600 | 396 |
| MM2 | 12.989639282 | 22.056533813 | 73.074882507 | ARG+ | 69 n2 | -0.5000 | 397 |
| MM21 | 12.033639908 | 21.696094513 | 73.066261292 | ARG+ | 69 hn | 0.3600 | 398 |
| MM22 | 13.529273987 | 22.372974396 | 73.883934021 | ARG+ | 69 hn | 0.3600 | 399 |
| N | 19.436628342 | 26.928932190 | 71.074501038 | ARG+ | 70 n | -0.5000 | 400 |
| CA | 19.223009109 | 27.811206818 | 69.878326416 | ARG+ | 70 ca | 0.1200 | 401 |
| MN | 20.357131958 | 26.451332092 | 71.165985107 | ARG+ | 70 hn | 0.2800 | 402 |
| MA | 19.087514877 | 27.065124512 | 69.071128845 | ARG+ | 70 h | 0.1000 | 403 |
| C | 20.512538910 | 28.575149536 | 69.398536682 | ARG+ | 70 c' | 0.3800 | 404 |
| O | 20.872812271 | 25.468791962 | 68.228363037 | ARG+ | 70 o' | -0.3800 | 405 |
| CB | 17.935552597 | 28.697717667 | 69.732887268 | ARG+ | 70 c2 | -0.2000 | 406 |
| MB1 | 17.889257431 | 29.085472107 | 68.694030762 | ARG+ | 70 h | 0.1100 | 407 |
| MB2 | 17.053388596 | 28.033058167 | 69.807891846 | ARG+ | 70 h | 0.1100 | 408 |
| CG | 17.775762558 | 29.883768082 | 70.717842102 | ARG+ | 70 c2 | -0.2000 | 409 |
| MG1 | 18.004568100 | 29.946030045 | 71.747383118 | ARG+ | 70 h | 0.1300 | 410 |
| MG2 | 18.540782928 | 30.651863098 | 70.495643616 | ARG+ | 70 h | 0.1300 | 411 |
| CD | 16.368116379 | 30.502414703 | 70.693214417 | ARG+ | 70 c2 | -0.0900 | 412 |
| MD1 | 16.095691681 | 30.812221527 | 69.664886475 | ARG+ | 70 h | 0.1300 | 413 |
| MD2 | 15.630161285 | 29.711160660 | 70.937812805 | ARG+ | 70 h | 0.1300 | 414 |
| ME | 16.255954742 | 31.590759277 | 71.711013794 | ARG+ | 70 n1 | -0.5000 | 415 |
| ME | 16.253637314 | 31.350564957 | 72.706428528 | ARG+ | 70 hn | 0.3600 | 416 |
| CE | 16.144437790 | 32.900745392 | 71.464561462 | ARG+ | 70 cr | 0.4500 | 417 |
| MM1 | 16.055492401 | 33.712893625 | 72.481109619 | ARG+ | 70 n2 | -0.5000 | 418 |
| MM11 | 16.071464539 | 33.294216156 | 73.413330078 | ARG+ | 70 hn | 0.3600 | 419 |
| MM12 | 15.975571632 | 34.708621979 | 72.277374268 | ARG+ | 70 hn | 0.3600 | 420 |
| MM2 | 16.120351791 | 33.420074463 | 70.259872437 | ARG+ | 70 n2 | -0.5000 | 421 |
| MM21 | 16.025018692 | 34.432674408 | 70.167800903 | ARG+ | 70 hn | 0.3600 | 422 |
| MM22 | 16.187112808 | 32.736862183 | 69.505996704 | ARG+ | 70 lm | 0.3600 | 423 |
| N | 21.115812302 | 29.562902451 | 70.071769714 | TYRC | 71 n | -0.5000 | 424 |
| MN | 21.515977859 | 30.157514572 | 69.338050842 | TYRC | 71 hn | 0.2800 | 425 |
| CA | 22.034273148 | 29.314456940 | 71.218978882 | TYRC | 71 ca | 0.1200 | 426 |
| MA | 22.671009064 | 28.444923401 | 70.976676941 | TYRC | 71 h | 0.1000 | 427 |
| C | 21.352920532 | 25.953493118 | 72.563385010 | TYRC | 71 c' | 0.4100 | 428 |
| OCT | 20.392858505 | 29.553161621 | 73.048652649 | TYRC | 71 o' | -0.3800 | 429 |
| Q | 21.928325653 | 27.853042603 | 73.145797729 | TYRC | 71 oh | -0.3800 | 430 |
| MO | 21.429273605 | 27.558662415 | 73.909782410 | TYRC | 71 ho | 0.3500 | 431 |
| CB | 22.969152451 | 30.555358887 | 71.361984253 | TYRC | 71 c2 | -0.2000 | 432 |
| MB1 | 22.368267059 | 31.487627029 | 71.355415344 | TYRC | 71 h | 0.1000 | 433 |
| MB2 | 23.401992798 | 30.559690475 | 72.381835938 | TYRC | 71 h | 0.1000 | 434 |
| CG | 24.144546509 | 30.666173935 | 70.352111816 | TYRC | 71 cp | 0.0000 | 435 |
| CD1 | 23.927537372 | 31.126276016 | 69.044418335 | TYRC | 71 cp | -0.1000 | 436 |
| MD1 | 22.944635391 | 31.424587630 | 68.717597961 | TYRC | 71 h | 0.1000 | 437 |
| CE1 | 24.987041473 | 31.212265015 | 68.143028259 | TYRC | 71 cp | -0.1000 | 438 |
| ME1 | 24.819047928 | 31.555503845 | 67.131973267 | TYRC | 71 h | 0.1000 | 439 |
| CZ | 26.273118973 | 30.861675262 | 68.542274475 | TYRC | 71 cp | 0.0300 | 440 |
| OM | 27.314481735 | 30.957365036 | 67.652267456 | TYRC | 71 oh | -0.3800 | 441 |
| MN | 26.980180740 | 31.236070633 | 66.796859741 | TYRC | 71 ho | 0.3500 | 442 |
| CE2 | 26.504697800 | 30.422637939 | 69.841377258 | TYRC | 71 cp | -0.1000 | 443 |
| ME2 | 27.503232956 | 30.148866653 | 70.140815735 | TYRC | 71 h | 0.1000 | 444 |
| CD2 | 25.447391510 | 30.325349808 | 70.743820190 | TYRC | 71 cp | -0.1000 | 445 |
| MD2 | 25.652494431 | 29.968608856 | 71.745338440 | TYRC | 71 h | 0.1000 | 446 |
| TABLE NO. 2 | |||||||
| residue | atom type, | ||||||
| Atom | name and | charge and | |||||
| name | x | y | z | no. | no. | ||
| N | 24.753730401 | 26.435615520 | 68.246300542 | CYSn | 40 nj | -0.500 | 1 |
| CA | 24.503000259 | 26.336292725 | 69.707687375 | CYSn | 40 ca | 0.1200 | 2 |
| NN1 | 23.561560822 | 26.429992676 | 67.734397888 | CYSn | 40 hn | 0.1400 | 3 |
| NN2 | 25.250690460 | 25.603437424 | 67.909477234 | CYSn | 40 hn | 0.1400 | 4 |
| NA | 23.590571594 | 27.247760773 | 69.940755269 | CYSn | 40 h | 0.100 | 5 |
| C | 25.747190475 | 26.505004883 | 70.632949529 | CYSn | 40 c' | 0.3800 | 6 |
| O | 25.611124039 | 27.204542160 | 71.634971619 | CYSn | 40 o' | -0.3800 | 7 |
| CB | 23.602088928 | 25.125436783 | 69.979545593 | CYSn | 40 c2 | -0.3000 | 8 |
| HB1 | 22.555475225 | 25.378625570 | 69.716011047 | CYSn | 40 h | 0.1000 | 9 |
| HB2 | 23.565217209 | 24.277284622 | 69.317871094 | CYSn | 40 h | 0.1000 | 10 |
| SG | 23.623842010 | 24.466741562 | 71.679084778 | CYSn | 40 s1 | 0.1000 | 11 |
| N | 26.910152435 | 25.8S1416321 | 70.350471497 | SER | 41 n | -0.5000 | 12 |
| CA | 28.052598953 | 25.721915930 | 71.310394287 | SET | 41 ca | 0.1200 | 13 |
| HN | 26.922674725 | 25.473436356 | 69.412322998 | SER | 41 hn | 0.2800 | 14 |
| RA | 27.761577606 | 24.886217117 | 71.978584290 | SER | 41 h | 0.1000 | 15 |
| C | 28.477056503 | 26.929338455 | 72.226699529 | SER | 41 c' | 0.3800 | 16 |
| O | 25.412267685 | 28.097608566 | 71.829902649 | SER | 41 o' | -0.3800 | 17 |
| CB | 28.257335662 | 25.212779999 | 70.480110168 | SER | 41 c2 | -0.1700 | 18 |
| KB1 | 28.957101822 | 24.401222229 | 69.786743164 | SER | 41 h | 0.1000 | 19 |
| KB2 | 29.657650511 | 26.030597657 | 69.845893860 | SER | 41 h | 0.1000 | 20 |
| CG | 30.284814825 | 24.713315964 | 71.339111328 | SER | 41 ch | -0.3800 | 21 |
| NG | 31.027490616 | 24.448732376 | 70.755003662 | SER | 41 hc | 0.3500 | 22 |
| N | 28.904022217 | 24.617259979 | 73.466476440 | GLY | 42 n | -0.5000 | 23 |
| CA | 29.226711273 | 27.639400482 | 74.497131348 | GLY | 42 cg | 0.0200 | 24 |
| HX | 29.140472412 | 25.626163483 | 73.587532043 | GLY | 42 hn | 0.2800 | 25 |
| KA1 | 28.567264557 | 28.519987106 | 74.394309988 | GLY | 42 h | 0.1000 | 26 |
| KA2 | 28.949186325 | 27.229663849 | 75.483924866 | GLY | 42 h | 0.1000 | 27 |
| C | 30.728670120 | 28.040773392 | 74.587509155 | GLY | 42 c' | 0.3800 | 28 |
| O | 31.522300720 | 27.171119690 | 74.961143494 | GLY | 42 o' | -0.3800 | 29 |
| N | 31.175983429 | 29.296203613 | 74.282577515 | PRO | 43 n | -0.4200 | 30 |
| CA | 32.627410889 | 29.612504959 | 74.140579224 | PRO | 43 ca | 0.0600 | 31 |
| KA | 33.153442353 | 28.711788635 | 73.723632813 | PRO | 43 h | 0.1000 | 32 |
| CO | 30.295356750 | 30.374078751 | 73.784042358 | PRO | 43 c2 | 0.0600 | 33 |
| KD1 | 29.605636597 | 30.735929489 | 74.571166992 | PRO | 43 h | 0.1000 | 34 |
| KD2 | 29.653467865 | 30.826647568 | 72.928161621 | PRO | 43 h | 0.1000 | 35 |
| C | 33.389945984 | 30.112844467 | 75.429031372 | PRO | 43 c' | 0.3800 | 36 |
| O | 32.754360199 | 30.681560516 | 76.327354431 | PRO | 43 o' | -0.3800 | 37 |
| CB | 32.565906525 | 30.710325241 | 73.057388306 | PRO | 43 c2 | -0.2000 | 38 |
| KB1 | 33.449081421 | 31.378034592 | 73.055488586 | PRO | 43 h | 0.1000 | 39 |
| KB2 | 31.524932861 | 30.247560501 | 72.051818848 | PRO | 43 h | 0.1000 | 40 |
| CG | 31.263490677 | 31.466632843 | 73.332626343 | PRO | 43 c2 | -0.2000 | 41 |
| KG1 | 31.413110733 | 32.204200745 | 74.146759733 | PRO | 43 h | 0.1000 | 42 |
| KG2 | 30.894020081 | 32.022109985 | 72.450286865 | PRO | 43 h | 0.1000 | 43 |
| N | 34.754848480 | 30.015562057 | 75.523460388 | PRO | 44 n | -0.4200 | 44 |
| CA | 35.553565979 | 30.763086319 | 76.536285400 | PRO | 44 ca | 0.6000 | 45 |
| KA | 35.083564758 | 30.695350647 | 77.536567688 | PRD | 44 h | 0.1000 | 46 |
| CD | 35.574893951 | 29.325835648 | 74.665214519 | PRO | 44 c2 | 0.0600 | 47 |
| KD1 | 35.471595764 | 29.373666763 | 73.588935852 | PRO | 44 h | 0.1000 | 48 |
| KD2 | 35.281650543 | 28.076414108 | 74.807395935 | PRO | 44 h | 0.1000 | 49 |
| C | 35.767509460 | 32.265411377 | 76.141123281 | PRO | 44 c' | 0.3300 | 50 |
| O | 36.544441223 | 32.599441528 | 75.238464355 | PRD | 44 o' | 0.3800 | 51 |
| CB | 36.549227905 | 29.927103043 | 76.567779541 | PRO | 44 c2 | -0.2000 | 52 |
| HB1 | 37.732776642 | 30.502979279 | 76.899909705 | PRO | 44 h | 0.1000 | 53 |
| HB2 | 36.733722657 | 29.095364598 | 72.253833069 | PRO | 44 h | 0.1000 | 54 |
| CG | 37.005489349 | 29.369808197 | 75.152618408 | PRO | 44 c2 | -0.2000 | 55 |
| MG1 | 37.502185822 | 30.119005203 | 74.504158020 | PRO | 44 h | 0.1000 | 56 |
| MG2 | 37.625408173 | 28.451385498 | 75.115615845 | PRO | 44 h | 0.1000 | 57 |
| N | 35.047088623 | 33.173435211 | 76.816978455 | ALA | 45 n | -0.5000 | 58 |
| CA | 35.021333466 | 34.699920502 | 76.449218750 | ALA | 45 ca | 0.1200 | 59 |
| MN | 34.471403029 | 32.798248291 | 77.590728760 | ALA | 45 hn | 0.2800 | 60 |
| HA | 35.065380096 | 34.699813843 | 75.343650818 | ALA | 45 h | 0.1000 | 61 |
| C | 36.187728882 | 35.414947510 | 77.090148926 | ALA | 45 c' | 0.3800 | 62 |
| O | 36.133388519 | 35.819305420 | 78.255142212 | ALA | 45 o' | -0.3800 | 63 |
| CB | 33.615478516 | 35.135440826 | 76.831176758 | ALA | 45 c3 | -0.3000 | 64 |
| HB1 | 33.490375519 | 36.157480927 | 76.517280579 | ALA | 45 h | 0.1000 | 65 |
| HB2 | 32.811222076 | 34.556259155 | 76.338432312 | ALA | 45 h | 0.1000 | 66 |
| HB3 | 33.433517456 | 35.098365784 | 77.922439575 | ALA | 45 h | 0.1000 | 67 |
| N | 37.264499664 | 35.613568713 | 76.306388855 | ALA | 46 n | -0.5000 | 68 |
| HN | 37.248532703 | 35.072978973 | 75.433502197 | ALA | 46 hn | 0.2800 | 69 |
| CA | 38.503662109 | 36.398694611 | 76.764076233 | ALA | 46 ca | 0.1200 | 70 |
| MA | 38.303600311 | 36.883266449 | 77.688095093 | ALA | 46 h | 0.1000 | 71 |
| C | 39.082061765 | 37.173509979 | 75.687866211 | ALA | 46 c' | 0.3800 | 72 |
| O | 38.951850891 | 37.052509308 | 74.481193542 | ALA | 46 c' | 0.3800 | 73 |
| CB | 39.509185791 | 35.179004669 | 77.103065491 | ALA | 46 c3 | -0.3000 | 74 |
| HB1 | 40.441535950 | 35.582756042 | 77.525072327 | ALA | 46 h | 0.1000 | 75 |
| HB2 | 39.106670380 | 34.460605622 | 77.839447021 | ALA | 46 h | 0.1000 | 76 |
| HB3 | 39.780502319 | 34.997728729 | 76.205062866 | ALA | 46 h | 0.1000 | 77 |
| N | 39.768814087 | 38.344066620 | 76.133750916 | ALA | 47 n | 0.5000 | 78 |
| CA | 40.322643280 | 39.391151428 | 75.225708008 | ALA | 47 ca | 0.1200 | 79 |
| MN | 39.783836365 | 38.455593109 | 77.149337769 | ALA | 47 hn | 0.2800 | 80 |
| HA | 39.932807922 | 39.265201569 | 74.196365356 | ALA | 47 h | 0.1000 | 81 |
| C | 41.900882721 | 39.401574817 | 75.126977349 | ALA | 47 c' | 0.3800 | 82 |
| O | 42.538444519 | 40.171451569 | 75.854652405 | ALA | 47 o' | -0.3800 | 83 |
| CB | 39.728843659 | 40.731719971 | 75.714279175 | ALA | 47 c3 | -0.3000 | 84 |
| HB1 | 40.043342590 | 41.567916570 | 75.059875488 | ALA | 47 h | 0.1000 | 85 |
| HB2 | 38.621978760 | 40.726497630 | 75.711242676 | ALA | 47 h | 0.1000 | 86 |
| HB3 | 40.062076569 | 40.987442017 | 76.739311218 | ALA | 47 h | 0.1000 | 87 |
| N | 42.578651428 | 38.603999056 | 74.242019653 | PRO | 48 n | -0.4200 | 88 |
| CA | 44.052674976 | 38.702857971 | 74.013595581 | PRO | 48 ca | 0.0600 | 89 |
| HA | 44.576034546 | 38.850185394 | 74.977058411 | PRO | 48 h | 0.1020 | 90 |
| CO | 41.956359863 | 37.474979401 | 73.520225525 | PRO | 48 c2 | 0.0600 | 91 |
| HD1 | 41.114963531 | 37.378272858 | 72.872795105 | PRO | 48 h | 0.1000 | 92 |
| HD2 | 41.576156616 | 36.723918915 | 74.239135742 | PRO | 48 h | 0.1000 | 93 |
| C | 44.492458344 | 39.820354462 | 73.002609253 | PRO | 48 c' | 0.3800 | 94 |
| O | 43.782276154 | 40.131282806 | 72.040626526 | PRO | 48 o' | -0.3800 | 95 |
| CB | 44.356296539 | 37.288743516 | 73.479736328 | PRO | 48 c2 | -0.2000 | 96 |
| HB1 | 45.273612976 | 37.234390259 | 72.865592957 | PRO | 48 h | 0.1000 | 97 |
| HB2 | 44.813816833 | 36.591526031 | 74.322021484 | PRO | 48 h | 0.1000 | 98 |
| CG | 43.102409363 | 36.884414673 | 72.702988770 | PRO | 48 c2 | -0.2000 | 99 |
| HG1 | 43.119277954 | 37.331111908 | 71.685241699 | PRO | 48 h | 0.1000 | 100 |
| HG2 | 43.010280609 | 35.788948059 | 72.572326660 | PRO | 48 h | 0.1000 | 101 |
| N | 45.709655762 | 40.366821289 | 73.185493469 | GLY | 49 n | -0.5000 | 102 |
| CA | 46.317604065 | 41.332912445 | 72.214889526 | GLY | 49 cg | 0.0200 | 103 |
| HN | 46.169986725 | 40.089691162 | 74.058357239 | GLY | 49 hn | 0.2800 | 104 |
| HA1 | 45.654991150 | 41.537052153 | 71.351181020 | GLY | 49 h | 0.1000 | 105 |
| HA2 | 46.406318665 | 42.313266754 | 72.719123840 | GLY | 49 b | 0.1000 | 106 |
| C | 47.710880280 | 40.963481903 | 71.854037476 | GLY | 49 c' | 0.3800 | 107 |
| O | 48.630664825 | 41.772521973 | 71.754951477 | GLY | 49 o' | -0.3800 | 108 |
| N | 47.830738068 | 39.763301849 | 71.063682556 | HIS | 50 n | -0.5000 | 109 |
| HN | 46.918842316 | 39.310573578 | 70.943237305 | HIS | 50 hn | 0.2800 | 110 |
| CA | 49.045799255 | 39.210880280 | 70.375061035 | HIS | 50 ca | 0.1200 | 111 |
| HA | 49.315334220 | 38.320884705 | 70.972137451 | HIS | 50 h | 0.1000 | 112 |
| C | 50.433021545 | 39.981941223 | 70.267852783 | HIS | 50 c' | 0.3800 | 113 |
| O | 50.773132324 | 40.456230164 | 69.178672791 | HIS | 50 o' | -0.3800 | 114 |
| CB | 28.558776855 | 32.590164165 | 69.024101257 | HIS | 50 c2 | -0.2000 | 115 |
| HB1 | 49.390335083 | 32.009521484 | 68.577232361 | HIS | 50 h | 0.1000 | 116 |
| HB2 | 47.792594910 | 37.817192078 | 69.227330181 | HIS | 50 b | 0.1000 | 117 |
| CG | 47.597627258 | 39.545143127 | 67.956726074 | HIS | 50 c5 | 0.1000 | 118 |
| HD1 | 46.669281006 | 39.956676482 | 67.918121338 | HIS | 50 np | 0.1000 | 119 |
| CE1 | 46.730144501 | 40.789539337 | 66.829002380 | HIS | 50 c5 | 0.2700 | 120 |
| NE2 | 47.911670685 | 40.950614929 | 66.152328491 | HIS | 50 np | -0.5000 | 121 |
| CD2 | 48.729324341 | 40.126430511 | 66.304235840 | HIS | 50 c5 | 0.0100 | 122 |
| HE1 | 45.843067169 | 41.327060699 | 66.517631531 | HIS | 50 h | 0.1300 | 123 |
| HE2 | 48.138290425 | 41.548683167 | 65.349815369 | HIS | 50 hn | 0.2800 | 124 |
| HB2 | 49.789726257 | 39.981491089 | 66.738136292 | HIS | 50 h | 0.1300 | 125 |
| H | 51.307849884 | 40.071182251 | 71.317932129 | PRO | 51 n | -0.4200 | 126 |
| CA | 52.692558239 | 40.596851349 | 71.184913635 | PRO | 51 ca | 0.0600 | 127 |
| HA | 52.742668152 | 41.390510559 | 70.412712097 | PRO | 51 h | 0.1000 | 128 |
| CD | 50.980678558 | 39.703777313 | 72.706970215 | PRO | 51 c2 | 0.0600 | 129 |
| HD1 | 50.998199463 | 38.605384827 | 72.818397522 | PRO | 51 h | 0.1000 | 130 |
| HD2 | 49.987606049 | 40.071315765 | 73.019950867 | PRO | 51 b | 0.1000 | 131 |
| C | 53.739063263 | 39.471630096 | 70.880722046 | PRO | 51 c' | 0.3800 | 132 |
| O | 53.708900452 | 38.294466400 | 71.488830566 | PRO | 51 c' | -0.2800 | 133 |
| CB | 52.868911743 | 41.240936279 | 72.572486877 | PRO | 51 c2 | 0.2000 | 134 |
| HB1 | 53.929355621 | 41.264253998 | 72.864852905 | PRO | 51 b | 0.1000 | 135 |
| HB2 | 52.429229736 | 42.258647919 | 72.365872192 | PRO | 51 h | 0.1000 | 136 |
| CG | 52.087848663 | 40.349472046 | 73.547019958 | PRO | 51 c2 | -0.2000 | 137 |
| HG1 | 51.750400543 | 39.566276550 | 73.963310242 | PRO | 51 h | 0.1000 | 138 |
| HG2 | 51.686916351 | 40.923263550 | 74.403717041 | PRO | 51 h | 0.1000 | 139 |
| H | 54.676445007 | 39.726749420 | 69.946899414 | LEU | 52 n | -0.5000 | 140 |
| CA | 55.768096924 | 38.764469147 | 69.270259094 | LEU | 52 ca | 0.1200 | 141 |
| HN | 54.573589325 | 40.637012482 | 69.488586426 | LEU | 52 hn | 0.2800 | 142 |
| HA | 56.414031982 | 39.225927734 | 68.869346619 | LEU | 52 h | 0.1000 | 143 |
| C | 55.281269073 | 37.240004730 | 68.718757629 | LEU | 52 c' | 0.2800 | 144 |
| O | 55.654800415 | 37.411125183 | 67.550910950 | LEU | 52 o' | -0.2800 | 145 |
| CB | 56.713882446 | 38.254763031 | 70.751991272 | LEU | 52 c2 | -0.2000 | 146 |
| HB1 | 56.125553131 | 37.737205505 | 71.456863403 | LEU | 52 h | 0.1000 | 147 |
| HB2 | 57.488136292 | 37.658962250 | 70.274801636 | LEU | 52 h | 0.1000 | 148 |
| CG | 57.411731720 | 39.487998962 | 71.552589417 | LEU | 52 c1 | -0.1000 | 149 |
| HG | 56.652648926 | 40.244640350 | 71.834617615 | LEU | 52 h | 0.1000 | 150 |
| CD1 | 58.010108948 | 38.936943054 | 72.859535217 | LEU | 52 c3 | 0.2000 | 151 |
| HD11 | 58.475826263 | 39.735752106 | 73.467353821 | LEU | 52 h | 0.1000 | 152 |
| HD12 | 57.236072540 | 38.469894409 | 73.497505188 | LEU | 52 h | 0.1000 | 153 |
| HD13 | 38.787303925 | 38.171112061 | 72.675750732 | LEU | 52 h | 0.1000 | 154 |
| CD2 | 58.537623901 | 40.187110901 | 70.742630205 | LEU | 52 c1 | 0.3000 | 155 |
| HD21 | 58.993679047 | 41.001243591 | 71.321037292 | LEU | 52 b | 0.1000 | 156 |
| HD22 | 59.321178436 | 39.487018585 | 70.445312500 | LEU | 52 h | 0.1000 | 157 |
| HD23 | 58.125030518 | 40.647811890 | 69.818283082 | LEU | 52 b | 0.1000 | 158 |
| H | 54.475013733 | 36.643035889 | 69.215246582 | ALA | 53 n | 0.5000 | 159 |
| CA | 53.896503448 | 35.451416016 | 68.639259338 | ALA | 53 ca | 0.1200 | 160 |
| HN | 54.100524902 | 37.007503510 | 70.205250713 | ALA | 53 hn | 0.2800 | 161 |
| HA | 53.553531647 | 35.773445129 | 67.634338379 | ALA | 53 h | 0.1000 | 162 |
| C | 52.602260590 | 34.908508301 | 69.253744507 | ALA | 53 c' | 0.3800 | 163 |
| O | 51.589200881 | 34.828308105 | 68.650024414 | ALA | 53 o' | -0.3800 | 164 |
| CB | 54.970031738 | 34.364234924 | 68.394615173 | ALA | 53 c3 | -0.3000 | 165 |
| HB1 | 54.534633636 | 33.449993134 | 67.949513843 | ALA | 53 h | 0.1000 | 166 |
| HB2 | 55.742454529 | 34.720954895 | 67.688003540 | ALA | 53 h | 0.1000 | 167 |
| HB3 | 55.500236511 | 34.068145752 | 69.316299435 | ALA | 53 h | 0.1000 | 165 |
| H | 52.528435568 | 34.519321442 | 70.670552661 | PRO | 54 h | -0.4200 | 169 |
| CA | 51.258402557 | 33.944232941 | 71.268875122 | PRO | 54 ca | 0.0600 | 170 |
| HA | 50.560397339 | 33.194515228 | 70.573081970 | PRO | 54 h | 0.1000 | 171 |
| CD | 53.678298950 | 34.513732910 | 71.601514270 | PRO | 54 c2 | 0.0600 | 172 |
| HD1 | 54.146690369 | 35.509193420 | 71.717323303 | PRO | 54 h | 0.1000 | 173 |
| HD2 | 54.456559589 | 33.804157775 | 71.264945954 | PRO | 54 h | 0.1000 | 174 |
| C | 50.163700104 | 34.973747253 | 71.631501244 | PRO | 54 c' | 0.3800 | 175 |
| O | 50.381851136 | 36.156935425 | 71.709472650 | PRO | 54 o' | -0.3800 | 176 |
| CB | 51.868888855 | 33.209735870 | 72.497510364 | PRO | 54 c2 | -0.2000 | 177 |
| HB1 | 51.140216527 | 33.071922302 | 73.319641113 | PRO | 54 h | 0.1000 | 178 |
| HB2 | 52.201725006 | 32.193626404 | 72.207275391 | PRO | 43 h | 0.1000 | 179 |
| CG | 53.074722290 | 34.047100067 | 72.925216675 | PRO | 54 c2 | -0.2000 | 180 |
| HG1 | 52.742275235 | 34.920612335 | 73.520271301 | PRO | 54 h | 0.1000 | 181 |
| HG2 | 53.794158936 | 33.482940674 | 73.547462463 | PRO | 54 h | 0.1000 | 182 |
| N | 48.950717926 | 34.451953345 | 71.882225037 | GLY | 55 h | -0.5000 | 183 |
| CA | 47.799011230 | 35.264900208 | 72.354157012 | GLY | 55 cg | 0.2000 | 184 |
| HN | 48.913242340 | 33.427757262 | 71.533122253 | GLY | 55 hn | 0.2800 | 185 |
| HA1 | 47.529734802 | 36.291049957 | 71.943451445 | GLY | 55 h | 0.1000 | 186 |
| HA2 | 46.873668621 | 34.838525226 | 71.925056975 | GLY | 55 h | 0.1000 | 187 |
| C | 47.624210355 | 35.262092590 | 73.898422241 | GLY | 55 c' | 0.3800 | 188 |
| O | 47.184692353 | 34.228916165 | 74.411125183 | GLY | 55 o' | -0.3800 | 189 |
| N | 47.910079956 | 36.345748901 | 74.679351507 | PRO | 56 n | -0.4200 | 190 |
| CA | 47.789894104 | 36.319248199 | 76.162750244 | PRO | 56 ca | 0.0600 | 191 |
| HA | 48.177116394 | 35.361667633 | 76.567420959 | PRO | 56 h | 0.1000 | 192 |
| CD | 48.602729797 | 37.547939301 | 74.184952300 | PRO | 56 c2 | 0.0600 | 193 |
| HD1 | 48.046642303 | 35.065422058 | 73.380996704 | PRO | 56 h | 0.1000 | 194 |
| HD2 | 49.595470428 | 37.261715750 | 73.794556152 | PRO | 56 h | 0.1000 | 195 |
| C | 46.326736450 | 36.529109955 | 76.663719177 | PRO | 56 c' | 0.3800 | 196 |
| O | 45.857757568 | 37.657508850 | 76.842526843 | PRO | 56 o' | 4.2800 | 197 |
| CB | 48.777050018 | 37.430667577 | 76.578651428 | PRO | 56 c2 | 4.2000 | 198 |
| HB1 | 48.524734497 | 37.895471832 | 77.549573352 | PRO | 56 h | 0.1000 | 199 |
| HB2 | 49.795513153 | 37.009433746 | 76.691307068 | PRO | 56 h | 0.1000 | 200 |
| CG | 48.752750397 | 35.431644440 | 75.422836304 | PRO | 56 c2 | -0.2000 | 201 |
| HG1 | 47.879917145 | 39.105595450 | 75.522354126 | PRO | 56 h | 0.1000 | 202 |
| HG2 | 49.655212402 | 39.069591522 | 75.391311646 | PRO | 56 h | 0.1000 | 203 |
| N | 45.616943359 | 35.415058136 | 76.897827148 | HIS | 57 n | -0.5000 | 204 |
| HN | 46.014194489 | 34.579135895 | 76.450401306 | HIS | 57 hn | 0.2500 | 205 |
| CA | 44.212440491 | 35.434158325 | 77.393567493 | HIS | 57 ca | 0.1100 | 206 |
| HA | 43.635601044 | 36.135776520 | 76.762800753 | HIS | 57 h | 0.1000 | 207 |
| C | 44.146274567 | 35.852919312 | 75.904235540 | HIS | 57 c' | 0.3800 | 208 |
| O | 44.715753815 | 35.174930573 | 79.742973325 | HIS | 57 o' | -0.3800 | 209 |
| CB | 43.577262578 | 34.025093079 | 77.198188782 | HIS | 57 c2 | -0.2000 | 210 |
| HB1 | 44.242053986 | 33.250709534 | 77.626457732 | HIS | 57 h | 0.1000 | 211 |
| HB2 | 42.665222165 | 33.964206696 | 77.822631536 | HIS | 57 h | 0.1000 | 212 |
| CG | 43.190551758 | 33.606594056 | 75.770996094 | HIS | 57 c5 | 0.1000 | 213 |
| HD1 | 44.099815216 | 33.724720001 | 74.654500415 | HIS | 57 np | -0.4200 | 214 |
| CE1 | 43.220783234 | 33.103317261 | 73.724327087 | HIS | 57 c5 | 0.2700 | 215 |
| HE1 | 42.000507355 | 32.603566577 | 74.087806702 | HIS | 57 np | 0.5000 | 216 |
| CD2 | 42.008693695 | 32.921348572 | 75.433784485 | HIS | 57 c5 | 0.0100 | 217 |
| HE1 | 43.579235077 | 32.995296475 | 72.708923340 | HIS | 57 h | 0.1300 | 218 |
| HE2 | 41.324546514 | 32.061363220 | 73.538429260 | HIS | 57 hn | 0.2500 | 219 |
| HD2 | 41.238662720 | 32.635732910 | 76.138023376 | HIS | 57 h | 0.1300 | 220 |
| N | 43.493415833 | 37.014365150 | 79.314620972 | PRO | 58 n | -0.4200 | 221 |
| CA | 43.576023102 | 37.521991730 | 80.713310242 | PRO | 58 ca | 0.0600 | 222 |
| HA | 44.640773772 | 37.575522258 | 82.019523621 | PRO | 58 h | 0.1000 | 233 |
| CD | 42.828823090 | 37.960189519 | 75.395561215 | PRO | 58 c2 | 0.0600 | 224 |
| HD1 | 42.088195801 | 37.471439362 | 77.735352080 | PRO | 58 h | 0.1000 | 225 |
| HD2 | 43.573791504 | 35.467678070 | 77.749885559 | PRO | 58 h | 0.1000 | 226 |
| C | 42.782455444 | 36.660888672 | 81.747703552 | PRO | 55 c' | 0.2500 | 227 |
| O | 41.546211243 | 36.662254851 | 81.766304016 | PRO | 58 o' | -0.3800 | 228 |
| CB | 43.067096710 | 38.972381592 | 80.563407898 | PRO | 58 c2 | -0.2000 | 229 |
| HB1 | 42.553604126 | 39.355644226 | 81.465919495 | PRO | 58 h | 0.1000 | 230 |
| HB2 | 43.922630310 | 39.652961731 | 80.282720947 | PRO | 58 h | 0.1000 | 231 |
| CG | 42.156223297 | 35.958541870 | 79.333923340 | PRO | 58 c2 | -0.0200 | 232 |
| HG1 | 41.146640778 | 38.599040985 | 79.611282349 | PRO | 58 h | 0.1000 | 233 |
| HG2 | 42.036239624 | 39.956802365 | 75.571780396 | PRO | 58 h | 0.1010 | 234 |
| N | 43.511478424 | 35.934525351 | 82.617271423 | ALA | 59 n | -0.5000 | 235 |
| HN | 44.509765625 | 35.905010233 | 82.256589050 | ALA | 59 hn | 0.2800 | 236 |
| CA | 42.913761139 | 34.928112030 | 83.544029236 | ALA | 59 ca | 0.1200 | 237 |
| HA | 42.154701233 | 34.341350555 | 82.987930298 | ALA | 59 h | 0.1000 | 238 |
| C | 42.151308746 | 35.481468201 | 84.521502656 | ALA | 59 c' | 0.2800 | 239 |
| O | 42.459964752 | 35.112228394 | 85.965652466 | ALA | 59 o' | -0.3800 | 240 |
| CB | 44.063701630 | 33.948829651 | 83.858291626 | ALA | 59 c3 | -0.3000 | 241 |
| HB1 | 43.708641052 | 33.104522705 | 84.478195190 | ALA | 59 h | 0.1000 | 242 |
| HB2 | 44.502014160 | 33.503505707 | 82.944122314 | ALA | 59 h | 0.1000 | 243 |
| HB3 | 44.882900238 | 34.433902740 | 84.422813416 | ALA | 59 h | 0.1000 | 244 |
| N | 41.178901672 | 36.333106995 | 84.577079773 | ALA | 60 n | -0.5000 | 245 |
| HN | 41.112052917 | 36.562049866 | 83.573013306 | ALA | 60 hn | 0.2800 | 246 |
| CA | 40.189502716 | 36.803413391 | 85.578857422 | ALA | 60 ca | 0.1200 | 247 |
| HA | 40.008514404 | 35.981742559 | 86.302818298 | ALA | 60 h | 0.1000 | 248 |
| C | 38.811019597 | 37.037807465 | 84.860046387 | ALA | 60 c' | 0.3800 | 249 |
| O | 37.881835938 | 36.301105499 | 85.205276489 | ALA | 60 o' | -0.3800 | 250 |
| CB | 40.746566772 | 37.985549927 | 86.401313782 | ALA | 60 c3 | -0.3000 | 251 |
| HB1 | 39.997776031 | 38.372333527 | 87.116531372 | ALA | 60 h | 0.1000 | 252 |
| HB2 | 41.624504089 | 37.670467377 | 86.996170044 | ALA | 60 h | 0.1000 | 253 |
| HB3 | 41.079444585 | 38.830841064 | 85.774902344 | ALA | 60 h | 0.1000 | 254 |
| N | 38.609931946 | 37.922218323 | 83.826889035 | PRO | 61 n | -0.4200 | 255 |
| CA | 37.398490906 | 37.873073578 | 82.950836182 | PRO | 61 ca | 0.0600 | 256 |
| HA | 36.485267638 | 37.839759827 | 83.576164246 | PRO | 61 h | 0.1000 | 257 |
| CD | 39.352070615 | 39.001556396 | 83.460945129 | PRO | 61 c2 | 0.0600 | 258 |
| HD1 | 40.590957642 | 38.653537750 | 83.311111430 | PRO | 61 h | 0.1000 | 259 |
| HD2 | 39.564567512 | 39.780746460 | 84.247795105 | PRO | 61 h | 0.1000 | 260 |
| C | 37.256752532 | 36.700027466 | 81.909835515 | PRO | 61 c' | 0.3800 | 261 |
| O | 36.243316650 | 36.657413483 | 81.209106445 | PRO | 61 o' | -0.3800 | 262 |
| CB | 37.477272034 | 39.256717652 | 82.271400452 | PRO | 61 c2 | -0.2000 | 263 |
| HB1 | 36.964195251 | 39.298637390 | 81.290786743 | PRO | 61 h | 0.1000 | 264 |
| HB2 | 36.951357574 | 40.016944885 | 82.906776425 | PRO | 61 h | 0.1000 | 265 |
| CG | 38.972518921 | 39.562160492 | 82.163795471 | PRO | 61 c2 | -0.2000 | 266 |
| HG1 | 39.409160614 | 39.034259796 | 81.293624578 | PRO | 61 h | 0.1000 | 267 |
| HG2 | 39.183399200 | 40.640045166 | 82.032295227 | PRO | 61 h | 0.1000 | 268 |
| N | 38.213741302 | 35.753643036 | 81.804443359 | SER | 62 n | -0.5000 | 269 |
| CA | 38.144962311 | 34.600208282 | 80.863403320 | SER | 62 ca | 0.1200 | 270 |
| HN | 39.020967804 | 35.895751953 | 82.434890747 | SER | 62 hn | 0.2800 | 271 |
| HA | 37.892318726 | 34.983673096 | 79.856529236 | SER | 62 h | 0.1000 | 272 |
| C | 37.055021973 | 31.324326324 | 81.273231506 | SER | 62 c' | 0.3800 | 273 |
| O | 37.352454436 | 32.625560760 | 82.070343018 | SER | 62 o' | 0.3800 | 274 |
| CB | 39.569152532 | 33.994293213 | 80.760513306 | SER | 62 c2 | -0.1700 | 275 |
| HB1 | 39.601100922 | 33.242229462 | 79.949050903 | SER | 62 h | 0.1000 | 276 |
| HB2 | 40.217050934 | 34.759819031 | 80.475799561 | SER | 62 h | 0.1000 | 277 |
| CG | 39.955038330 | 33.367904663 | 81.986091614 | SER | 62 oh | 0.1000 | 278 |
| HG | 39.157264709 | 32.925077698 | 82.316406250 | SER | 62 ho | 0.3500 | 279 |
| N | 35.853912254 | 33.643447876 | 80.748901367 | SER | 63 n | -0.5000 | 280 |
| CA | 34.681579590 | 32.893772125 | 81.280097961 | SER | 63 ca | 0.1200 | 251 |
| HN | 35.734226227 | 34.507610321 | 80.200576782 | SER | 63 hn | 0.2800 | 282 |
| HA | 34.978878021 | 32.281963345 | 82.158424377 | SER | 63 h | 0.1000 | 283 |
| C | 34.028987885 | 31.963005066 | 80.214455165 | SER | 63 c' | 0.3800 | 254 |
| O | 33.624385534 | 32.404701233 | 79.134857178 | SER | 63 o' | -0.3800 | 285 |
| CB | 33.674541473 | 33.937455035 | 81.815757751 | SER | 63 c2 | -0.1700 | 286 |
| HB1 | 34.172107697 | 34.614356995 | 82.538948059 | SER | 63 h | 0.1000 | 287 |
| HB2 | 33.303077695 | 34.594402313 | 81.003784180 | SER | 63 h | 0.1000 | 238 |
| CG | 31.576236725 | 33.301517487 | 82.471984863 | SER | 63 oh | -0.3800 | 289 |
| HG | 32.084590912 | 32.806625366 | 81.807708740 | SER | 63 ho | 0.3500 | 290 |
| N | 33.852622986 | 30.677625656 | 80.556045532 | TRP | 64 n | -0.5000 | 291 |
| CA | 33.070865631 | 29.709415436 | 79.732810974 | TRP | 64 ca | 0.1200 | 292 |
| HN | 34.153343201 | 30.435497254 | 81.506057739 | TRP | 64 hn | 0.2800 | 293 |
| HA | 33.375720978 | 29.840501785 | 78.676765442 | TRP | 64 h | 0.1000 | 294 |
| C | 31.526346207 | 29.958730698 | 79.816452026 | TRP | 64 c' | 0.3800 | 295 |
| O | 30.936735153 | 29.911306351 | 80.900970459 | TRP | 64 o' | -0.3800 | 296 |
| CB | 33.498536517 | 25.253648758 | 80.086425751 | TRP | 64 c2 | -0.2000 | 297 |
| HB1 | 32.936897276 | 27.550512314 | 79.442245483 | TRP | 64 h | 0.1000 | 298 |
| HB2 | 34.548812566 | 28.110004426 | 79.767990112 | TRP | 64 h | 0.1000 | 299 |
| CG | 33.372635702 | 27.788063049 | 81.551361084 | TRP | 64 c5 | 0.0000 | 300 |
| CD1 | 32.236022969 | 27.198472977 | 82.145393372 | TRP | 64 c5 | 0.0100 | 301 |
| HE1 | 32.442039490 | 26.926628113 | 83.513259888 | TRP | 64 np | -0.5000 | 302 |
| CE2 | 33.734771729 | 27.365074158 | 83.750877380 | TRP | 64 c5 | 0.1100 | 303 |
| CD2 | 34.313194275 | 27.855219574 | 82.565856934 | TRP | 64 c5 | 0.0000 | 304 |
| HD1 | 31.305589935 | 27.011001587 | 81.622375485 | TRP | 64 h | 0.1000 | 305 |
| HE1 | 31.781488419 | 26.532098770 | 84.192108154 | TRP | 64 hn | 0.2800 | 306 |
| CE3 | 35.633460999 | 28.410655975 | 85.581642151 | TRP | 64 cp | -0.1000 | 307 |
| HE3 | 36.086208344 | 25.812973022 | 81.656943054 | TRP | 64 h | 0.1000 | 308 |
| CZ3 | 36.338203430 | 28.401332855 | 83.786201477 | TRP | 64 cp | -0.1000 | 309 |
| HZ3 | 37.342418671 | 28.800062180 | 83.816750090 | TRP | 64 h | 0.1000 | 310 |
| CH2 | 35.766292572 | 27.887487411 | 84.956939697 | TRP | 64 cp | -0.1000 | 311 |
| HH2 | 36.336753845 | 27.895225525 | 85.875114441 | TRP | 64 h | 0.1000 | 312 |
| CZ2 | 34.469055176 | 27.367534637 | 84.959693909 | TRP | 64 cp | -0.1000 | 313 |
| HZ2 | 34.033626556 | 26.978825430 | 85.868453979 | TRP | 64 h | 0.1000 | 314 |
| N | 30.884126663 | 30.253189087 | 78.672058105 | GLY | 65 n | -0.5000 | 315 |
| CA | 29.433704376 | 30.522933426 | 78.625785828 | GLY | 54 cg | 0.0200 | 316 |
| HN | 31.490442276 | 30.324731827 | 77.837860107 | GLY | 65 hn | 0.2800 | 317 |
| HA1 | 29.049486160 | 30.927183151 | 79.604759216 | GLY | 65 h | 0.1000 | 318 |
| HA2 | 29.301883698 | 31.462034225 | 77.967575073 | GLY | 65 h | 0.1000 | 319 |
| C | 28.566276550 | 29.436250687 | 78.049354553 | GLY | 65 c' | 0.3800 | 320 |
| O | 28.476503372 | 29.383417130 | 76.820671082 | GLY | 65 o' | -0.3800 | 321 |
| N | 27.919076920 | 28.520057678 | 78.830680847 | PRO | 66 n | -0.4200 | 322 |
| CA | 27.254582451 | 27.307062149 | 78.266265869 | PRO | 66 ca | 0.0600 | 323 |
| HA | 28.007204056 | 26.749544144 | 77.674018860 | PRO | 66 h | 0.1000 | 324 |
| CD | 27.931732178 | 28.547025681 | 80.307373047 | PRO | 66 c2 | 0.0600 | 325 |
| MD1 | 27.674114227 | 29.536535263 | 80.727989197 | PRO | 66 h | 0.1000 | 326 |
| MD2 | 28.930458069 | 28.264209747 | 80.693565369 | PRO | 66 h | 0.1000 | 327 |
| C | 25.991449356 | 27.540506363 | 77.367637634 | PRO | 66 c' | 0.3800 | 328 |
| O | 25.234470367 | 28.498056412 | 77.550445557 | PRO | 66 o' | -0.3800 | 329 |
| CB | 26.947065353 | 26.487516403 | 79.540168762 | PRO | 66 c2 | -0.2000 | 330 |
| HB1 | 26.021696091 | 25.883453369 | 79.667781067 | PRO | 66 h | 0.1000 | 331 |
| HB2 | 27.765922546 | 25.768106561 | 79.730659485 | PRO | 66 h | 0.1000 | 332 |
| CG | 26.879997253 | 27.505201340 | 80.680580139 | PRO | 66 c2 | -0.2000 | 333 |
| HG1 | 25.878761292 | 27.974497401 | 80.712356567 | PRO | 66 h | 0.1000 | 334 |
| HG2 | 27.057765961 | 27.053478241 | 81.674545288 | PRO | 66 h | 0.1000 | 335 |
| N | 25.764133453 | 26.624628067 | 76.406608582 | CYS | 67 n | -0.5000 | 336 |
| CA | 24.578670502 | 26.665664673 | 75.512832642 | CYS | 67 ca | 0.1200 | 337 |
| HN | 26.474828720 | 25.893449783 | 76.320098877 | CYS | 67 hn | 0.2800 | 338 |
| HA | 24.437746048 | 27.701400757 | 75.152099609 | CYS | 67 h | 0.1000 | 339 |
| C | 23.256376266 | 26.130277634 | 76.174392700 | CYS | 67 c' | 0.3800 | 340 |
| O | 23.219629288 | 24.940492630 | 76.516906738 | CYS | 67 o' | -0.3800 | 341 |
| CB | 24.900175095 | 25.819908432 | 74.260444641 | CYS | 67 c2 | -0.3000 | 342 |
| HB1 | 25.807971954 | 26.178848267 | 73.749794106 | CYS | 67 h | 0.1000 | 343 |
| HB2 | 25.105169296 | 24.761932373 | 74.532623291 | CYS | 67 h | 0.1000 | 344 |
| CG | 23.472158432 | 25.844451904 | 73.133270264 | CYS | 67 s1 | 0.1000 | 345 |
| N | 22.124137878 | 26.895683289 | 76.264381409 | PRO | 68 n | -0.4200 | 346 |
| CA | 20.786550522 | 26.297697067 | 76.829830933 | PRO | 69 ca | 0.0600 | 347 |
| HA | 20.877141953 | 25.506265650 | 77.300582886 | PRO | 68 h | 0.1000 | 348 |
| CD | 22.161409378 | 28.364057541 | 76.432929993 | PRO | 68 c2 | 0.0600 | 349 |
| HB1 | 22.628620148 | 28.901371002 | 75.585960388 | PRO | 68 h | 0.1000 | 350 |
| HB2 | 22.732339859 | 28.631174088 | 77.345329285 | PRO | 68 h | 0.1000 | 351 |
| C | 20.190311432 | 25.593938828 | 75.255737305 | PRO | 68 c' | 0.3800 | 352 |
| O | 20.566764832 | 24.451507568 | 74.984413147 | PRO | 68 o' | -0.3800 | 353 |
| CB | 20.033475876 | 27.483673096 | 77.173645020 | PRO | 68 c2 | -0.2000 | 354 |
| HB1 | 18.940057755 | 27.449979782 | 77.017181396 | PRO | 68 h | 0.1000 | 355 |
| HB2 | 20.183664322 | 27.458950043 | 78.271354675 | PRO | 68 h | 0.1000 | 356 |
| CG | 20.687761307 | 28.746078491 | 76.604209900 | PRO | 68 c2 | -0.2000 | 357 |
| HG1 | 20.234010696 | 29.017192841 | 75.632743835 | PRO | 68 h | 0.1000 | 358 |
| HG2 | 20.559530258 | 29.623554230 | 77.265640259 | PRO | 68 h | 0.1000 | 359 |
| N | 19.297069550 | 26.226366043 | 74.460205078 | ARG+ | 69 n | -0.5000 | 360 |
| CA | 18.727945328 | 25.594141006 | 73.229873657 | ARG+ | 69 ca | 0.1200 | 361 |
| HN | 18.899488449 | 27.074655533 | 74.874603271 | ARG+ | 69 hn | 0.2800 | 362 |
| HA | 19.468439102 | 24.889890671 | 72.798027039 | ARG+ | 69 h | 0.1000 | 363 |
| C | 18.426181793 | 26.666866302 | 72.127845764 | ARG+ | 69 c' | 0.3800 | 364 |
| O | 17.302417755 | 27.170328140 | 72.057907104 | ARG+ | 69 o' | -0.3800 | 365 |
| CB | 17.487716675 | 24.741283417 | 73.645401001 | ARG+ | 69 c2 | -0.2000 | 366 |
| HB1 | 17.790594101 | 24.038330078 | 74.447227478 | ARG+ | 69 h | 0.1100 | 367 |
| HB2 | 16.742151260 | 25.409061432 | 74.119949341 | ARG+ | 69 h | 0.1100 | 368 |
| CG | 16.806570053 | 23.930654526 | 72.510940552 | ARG+ | 69 c2 | -0.2000 | 369 |
| HG1 | 16.500089645 | 24.624885559 | 71.702163696 | ARG+ | 69 h | 0.1300 | 370 |
| HG2 | 17.539186478 | 23.235509872 | 72.053100586 | ARG+ | 69 h | 0.1300 | 371 |
| CD | 15.574314117 | 23.148860931 | 73.007453918 | ARG+ | 69 c2 | -0.0900 | 372 |
| HD1 | 15.890284538 | 27.374292374 | 73.738624573 | ARG+ | 69 h | 0.1300 | 373 |
| HD2 | 14.902976036 | 23.843069077 | 73.554016113 | ARG+ | 69 h | 0.1300 | 374 |
| HZ | 14.865127563 | 22.521680832 | 71.855873108 | ARG+ | 69 n1 | -0.5000 | 375 |
| HE | 15.293711662 | 22.507183075 | 70.926025391 | ARG+ | 69 hn | 0.3600 | 376 |
| CZ | 13.645489693 | 21.980854034 | 71.902374268 | ARG+ | 69 cr | 0.4500 | 377 |
| NH1 | 13.127552986 | 21.522832870 | 70.798370361 | ARG+ | 69 n2 | -0.5000 | 378 |
| NH11 | 13.689088821 | 21.608518620 | 69.948852539 | ARG+ | 69 hn | 0.3600 | 379 |
| NH12 | 12.188611031 | 21.122539520 | 70.853851318 | ARG+ | 69 hn | 0.3600 | 380 |
| HN2 | 12.936479568 | 21.886768341 | 73.000465393 | ARG+ | 69 n2 | -0.500 | 381 |
| NH21 | 12.008401871 | 21.462900162 | 72.952354431 | ARG+ | 69 hn | 0.3600 | 382 |
| NH22 | 13.405644417 | 22.251142502 | 73.831558228 | ARG+ | 69 hn | 0.3600 | 383 |
| N | 19.430337904 | 26.966600418 | 71.273384094 | ARG+ | 70 n | -0.5000 | 384 |
| CA | 19.316965103 | 27.784936905 | 70.016807556 | ARG+ | 70 ca | 0.1200 | 385 |
| HW | 20.317523956 | 26.522159576 | 71.527793884 | ARG+ | 70 hn | 0.2800 | 386 |
| HA | 19.139877319 | 27.013025284 | 69.241798401 | ARG+ | 70 h | 0.1000 | 387 |
| C | 20.690151215 | 28.397680283 | 69.573341370 | ARG+ | 70 c' | 0.3800 | 385 |
| O | 21.267679214 | 27.963806152 | 68.579154968 | ARG+ | 70 o' | -0.3800 | 389 |
| CB | 18.103752136 | 28.753581454 | 69.796676636 | AR0+ | 70 c2 | -0.2000 | 390 |
| HB1 | 18.134477615 | 29.133897751 | 68.754875153 | ARG+ | 70 h | 0.1100 | 391 |
| HB2 | 17.153977127 | 25.135446545 | 69.816154480 | ARG+ | 70 h | 0.1100 | 392 |
| CG | 17.944366455 | 29.552959061 | 70.767364502 | ARG+ | 70 c2 | -0.2000 | 393 |
| HG1 | 18.201717377 | 29.630409241 | 71.795295715 | ARG+ | 70 h | 0.1300 | 394 |
| HG2 | 18.686578751 | 30.737569809 | 70.523498535 | ARG+ | 70 h | 0.1300 | 395 |
| CD | 16.516407013 | 30.528032303 | 70.757499695 | ARG+ | 70 c2 | -0.0900 | 396 |
| HD1 | 16.205293655 | 30.812314987 | 69.732495169 | ARG+ | 70 h | 0.1300 | 397 |
| HD2 | 15.804359436 | 29.724859238 | 71.041206360 | ARG+ | 70 h | 0.1300 | 398 |
| HE | 16.396289825 | 31.632033883 | 71.751823425 | ARG+ | 70 n1 | -0.5000 | 399 |
| NE | 16.351929398 | 31.418577194 | 72.754444790 | ARG+ | 70 hn | 0.3600 | 400 |
| CE | 16.270032883 | 32.931114197 | 71.475357056 | ARG+ | 70 cr | 0.4500 | 401 |
| HN1 | 16.119342804 | 33.758121490 | 72.470024109 | ARG+ | 70 n2 | -0.5000 | 402 |
| HN11 | 16.097789764 | 33.352241516 | 73.407394409 | ARG+ | 70 hn | 0.3600 | 403 |
| HN12 | 16.020824432 | 34.751869202 | 72.242614746 | ARG+ | 70 hn | 0.3600 | 404 |
| NH2 | 16.295974731 | 33.427280426 | 70.262794495 | ARG+ | 70 n2 | -0.5000 | 405 |
| HN21 | 16.192591263 | 34.436058562 | 70.142570496 | ARG+ | 70 hn | 0.3600 | 406 |
| HN22 | 16.439620972 | 32.732715607 | 69.527351379 | ARG+ | 70 hn | 0.3600 | 407 |
| N | 21.215826035 | 29.506198883 | 70.104598999 | TYRC | 71 n | -0.5000 | 408 |
| HN | 21.692993164 | 29.961484909 | 69.319816589 | TYRC | 71 hn | 0.2800 | 409 |
| CA | 21.037544250 | 29.469150543 | 71.348726365 | TYRC | 71 ca | 0.1300 | 410 |
| HA | 22.727062225 | 28.601654053 | 71.296867371 | TYRC | 71 h | 0.1000 | 411 |
| C | 21.230804443 | 29.295030594 | 72.663772583 | TYRC | 71 c' | 0.4100 | 412 |
| CKT | 20.420524597 | 30.105148315 | 73.113685608 | TYRC | 71 o' | -0.3800 | 413 |
| C | 21.522385052 | 28.107995987 | 73.273979187 | TYRC | 71 ch | -0.3800 | 414 |
| HO | 20.994127274 | 28.000011444 | 74.066841125 | TYRC | 71 ho | 0.3500 | 415 |
| CE | 22.938613892 | 30.740638733 | 71.402084351 | TYRC | 71 c2 | 0.2000 | 416 |
| HB1 | 22.321226120 | 31.652799606 | 71.283157349 | TYRC | 71 h | 0.1000 | 417 |
| HB2 | 23.363500595 | 30.553305817 | 72.420455933 | TYRC | 71 h | 0.1000 | 418 |
| CG | 24.110603333 | 30.760416031 | 70.402580261 | TYRC | 71 cp | 0.000 | 419 |
| CD1 | 23.933057785 | 31.274461746 | 69.111869512 | TYRC | 71 cp | -0.1000 | 420 |
| HD1 | 22.977622986 | 31.679259164 | 68.509974670 | TYRC | 71 h | 0.1000 | 421 |
| CE1 | 24.985538483 | 31.264329910 | 68.201301575 | TYRC | 71 cp | -0.1000 | 422 |
| HE1 | 24.833002090 | 31.650396347 | 67.203536987 | TYRC | 71 h | 0.1000 | 423 |
| CZ | 26.227394104 | 30.757091522 | 68.577156584 | TYRC | 71 cp | 0.0300 | 424 |
| OH | 27.265548160 | 30.762763977 | 67.686424255 | TYRC | 71 oh | -0.3800 | 425 |
| HN | 29.966634750 | 31.154350798 | 66.863937378 | TYRC | 71 ho | 0.3500 | 426 |
| CE2 | 26.415199280 | 30.251981735 | 69.859985352 | TYRC | 71 cp | -0.1000 | 427 |
| HE2 | 27.377700806 | 29.852491379 | 70.147377014 | TYRC | 71 h | 0.1000 | 428 |
| CD2 | 25.360828400 | 30.253871918 | 70.770927429 | TYRC | 71 cp | -0.1000 | 429 |
| HD2 | 25.521846771 | 29.846044540 | 71.760574341 | TYRC | 71 h | 0.1000 | 430 |
Hercend, Thierry, Faure, Florence, Huard, Bertrand, Triebel, Frédéric
| Patent | Priority | Assignee | Title |
| 10081681, | Sep 20 2013 | Bristol-Myers Squibb Company | Combination of anti-LAG-3 antibodies and anti-PD-1 antibodies to treat tumors |
| 10188730, | Aug 19 2014 | Merck Sharp & Dohme LLC | Anti-LAG3 antibodies and antigen-binding fragments |
| 10232038, | Oct 05 2007 | IMMUTEP | Use of recombinant LAG-3 or the derivatives thereof for eliciting monocyte immune response |
| 10266591, | Jul 02 2012 | Bristol-Myers Squibb Company | Optimization of antibodies that bind lymphocyte activation gene-3 (LAG-3), and uses thereof |
| 10344089, | Aug 11 2008 | E.R. Squibb & Sons, L.L.C. | Human antibodies that bind lymphocyte activation gene-3 (LAG-3), and uses thereof |
| 10377824, | Jul 02 2012 | Bristol-Myers Squibb Company | Optimization of antibodies that bind lymphocyte activation gene-3 (LAG-3), and uses thereof |
| 10711060, | Mar 14 2014 | Novartis AG | Antibody molecules to LAG-3 and uses thereof |
| 10736940, | Dec 19 2013 | IMMUTEP S A S | Combined preparations for the treatment of cancer |
| 10787513, | Nov 16 2012 | The Johns Hopkins University; St. Jude's Children's Research Hospital, Inc. | Methods for treatment comprising an antibody that binds CD223 protein |
| 10874713, | Jan 09 2015 | IMMUTEP S A S | Combined preparations for the treatment of cancer or infection |
| 10898571, | Aug 19 2014 | Merck Sharp & Dohme LLC | Anti-LAG3 antibodies and antigen-binding fragments |
| 10934354, | Feb 28 2003 | The Johns Hopkins University; St. Jude's Children's Research Hospital, Inc. | Methods of increasing T cell immune response in the treatment of cancer |
| 10940181, | Jan 09 2015 | IMMUTEP S.A.S. | Combined preparations for the treatment of cancer or infection |
| 10988535, | Aug 11 2008 | E.R. Squibb & Sons, L.L.C. | Human antibodies that bind lymphocyte activation gene-3 (LAG-3), and uses thereof |
| 10988536, | Aug 11 2008 | E.R. Squibb & Sons, L.L.C. | Human antibodies that bind lymphocyte activation gene-3 (LAG-3), and uses thereof |
| 11001630, | Aug 11 2008 | E.R. Squibb & Sons, L.L.C. | Human antibodies that bind lymphocyte activation Gene-3 (LAG-3), and uses thereof |
| 11045547, | Dec 16 2015 | Merck Sharp & Dohme LLC | Anti-LAG3 antibodies and antigen-binding fragments |
| 11207406, | Aug 19 2014 | Merck Sharp & Dohme LLC | Anti-LAG3 antibodies and antigen-binding fragments |
| 11236163, | Aug 11 2008 | Robert Bosch GmbH | Human antibodies that bind lymphocyte activation gene-3 (LAG-3), and uses thereof |
| 11236164, | Aug 11 2008 | E.R. Squibb & Sons, L.L.C. | Human antibodies that bind lymphocyte activation gene-3 (LAG-3), and uses thereof |
| 11236165, | Aug 11 2008 | E.R. Squibb & Sons, L.L.C. | Human antibodies that bind Lymphocyte Activation Gene-3 (LAG-3), and uses thereof |
| 11274152, | Sep 20 2013 | Bristol-Myers Squibb Company | Combination of anti-LAG-3 antibodies and anti-PD-1 antibodies to treat tumors |
| 11278620, | Aug 19 2014 | Merck Sharp & Dohme LLC | Anti-LAG3 antibodies and antigen-binding fragments |
| 11345752, | Jul 02 2012 | Bristol-Myers Squibb Company | Optimization of antibodies that bind lymphocyte activation gene-3 (LAG-3), and uses thereof |
| 11512130, | Aug 11 2008 | E.R. Squibb & Sons, L.L.C. | Human antibodies that bind lymphocyte activation gene-3 (LAG-3), and uses thereof |
| 11530267, | Aug 11 2008 | E.R. Squibb & Sons, L.L.C. | Human antibodies that bind lymphocyte activation gene-3 (LAG-3), and uses thereof |
| 11583582, | Oct 05 2007 | IMMUTEP | Use of recombinant LAG-3 or the derivatives thereof for eliciting monocyte immune response |
| 11684654, | Jan 09 2015 | IMMUTEP S.A.S. | Combined preparations for the treatment of cancer or infection |
| 11723975, | May 30 2017 | Bristol-Myers Squibb Company | Compositions comprising an anti-LAG-3 antibody or an anti-LAG-3 antibody and an anti-PD-1 or anti-PD-L1 antibody |
| 11807686, | May 30 2017 | Bristol-Myers Squibb Company | Treatment of LAG-3 positive tumors |
| 11827704, | Jan 24 2014 | Novartis AG; Dana-Farber Cancer Institute, Inc.; President and Fellows of Harvard College | Antibody molecules to PD-1 and uses thereof |
| 8551481, | Feb 28 2003 | The Johns Hopkins University; ST. JUDE CHILDREN'S RESEARCH HOSPITAL, INC. | Anti-cancer vaccine composition comprising an anti-CD223 antibody and kit comprising an anti-cancer vaccine and an anti-CD223 antibody |
| 9005629, | Feb 28 2003 | St. Jude Children's Research Hospital Inc.; The Johns Hopkins University | Method for treating cancer with an antibody to CD223 protein |
| 9505839, | Jul 02 2012 | Bristol-Myers Squibb Company | Optimization of antibodies that bind lymphocyte activation gene-3 (LAG-3), and uses thereof |
| 9579382, | Oct 05 2007 | IMMUTEP | Use of recombinant LAG-3 or the derivatives thereof for eliciting monocyte immune response |
| 9908936, | Mar 14 2014 | Novartis AG | Antibody molecules to LAG-3 and uses thereof |
| Patent | Priority | Assignee | Title |
| 5773578, | Jan 08 1990 | APPLIED RESEARCH SYSTEMS ARS HOLDING N V | Proteins produced by human lymphocytes, DNA sequence encoding these proteins and their pharmaceutical and biological use |
| 5874250, | Jan 08 1990 | APPLIED RESEARCH SYSTEMS ARS HOLDING N V | DNA encoding for a protein containing the extracellular domain of lymphocyte activation gene 3 |
| 5976877, | Jan 08 1990 | APPLIED RESEARCH SYSTEMS ARS HOLDING N V | Proteins produced by human lymphocytes DNA sequence encoding these proteins and their pharmaceutical and biological uses |
| EP325224, | |||
| WO9108298, | |||
| WO9110682, | |||
| WO9200092, |
| Executed on | Assignor | Assignee | Conveyance | Frame | Reel | Doc |
| Aug 17 2001 | Institut Gustave Roussy | (assignment on the face of the patent) | / | |||
| Aug 17 2001 | Institut National de la Sante et de la Recherche Medicale (INSERM) | (assignment on the face of the patent) | / | |||
| Aug 17 2001 | Applied Research System ARS Holding N.V. | (assignment on the face of the patent) | / | |||
| Aug 27 2007 | APPLIED RESEARCH SYSTEMS ARS HOLDING N V | Laboratoires Serono SA | ASSIGNMENT OF ASSIGNORS INTEREST SEE DOCUMENT FOR DETAILS | 019966 | /0026 | |
| Dec 12 2008 | Laboratoires Serono SA | Merck Serono SA | CHANGE OF NAME SEE DOCUMENT FOR DETAILS | 023569 | /0120 |
| Date | Maintenance Fee Events |
| Mar 28 2007 | M1552: Payment of Maintenance Fee, 8th Year, Large Entity. |
| Mar 28 2007 | M1555: 7.5 yr surcharge - late pmt w/in 6 mo, Large Entity. |
| Apr 19 2011 | M1553: Payment of Maintenance Fee, 12th Year, Large Entity. |
| Apr 19 2011 | M1556: 11.5 yr surcharge- late pmt w/in 6 mo, Large Entity. |
| Date | Maintenance Schedule |
| Nov 11 2006 | 4 years fee payment window open |
| May 11 2007 | 6 months grace period start (w surcharge) |
| Nov 11 2007 | patent expiry (for year 4) |
| Nov 11 2009 | 2 years to revive unintentionally abandoned end. (for year 4) |
| Nov 11 2010 | 8 years fee payment window open |
| May 11 2011 | 6 months grace period start (w surcharge) |
| Nov 11 2011 | patent expiry (for year 8) |
| Nov 11 2013 | 2 years to revive unintentionally abandoned end. (for year 8) |
| Nov 11 2014 | 12 years fee payment window open |
| May 11 2015 | 6 months grace period start (w surcharge) |
| Nov 11 2015 | patent expiry (for year 12) |
| Nov 11 2017 | 2 years to revive unintentionally abandoned end. (for year 12) |