A source of viral induced obesity has been discovered. A virus known as AD-36P adenovirus type 36 has been found to be associated with obesity in both animals and humans. Diagnostic DNA sequences are presented so that DNA based tests for the presence of the obesity associated virus can be conducted.
|
0. 4. A method for predicting a predisposition to virally-induced obesity in a subject comprising the steps of:
obtaining a sample from the subject;
screening for the presence of the nucleic acid sequences specific to adenovirus type 36 in the sample; and
determining the presence of nucleic acid sequences specific to adenovirus type 36 in the subject such that the presence Ad-36 nucleic acid sequences in the subject correlate with a predisposition of virally-induced obesity.
0. 1. A method of determining whether an obese person is suffering from viral obesity caused by adenovirus type 36p, the method comprising the steps of isolating from the person a sample selected from the group consisting of a body fluid, feces, a sample of tissue and a sample of an organ from the person, obtaining an antibody specific to an adenovirus type 36p, and; assaying the sample using the antibody to test for the presence of the adenovirus type 36p thus testing whether the person has been or is infected with adenovirus type 36p, which causes obesity and reduces cholesterol level in humans.
0. 2. The method according to
0. 3. A method for the detection of virally caused obesity in an obese subject comprising the steps of
isolating a sample of biological tissue or fluid from the subject;
providing an antibody specific to adenovirus type 36p;
testing the sample, using the antibody diagnostic for adenovirus type 36p; and
detecting the presence of adenovirus type 36p to determine if the subject has viral induced obesity.
0. 5. The method of
0. 6. The method of
0. 7. The method of
0. 8. The method of
0. 9. The method of
0. 10. The method of
0. 11. The method of
0. 12. The method of
0. 13. The method of
0. 14. The method of
|
|||||||||||||||||||||||||||||||
Ad-36 virus was obtained from the ATCC (American Type Culture Collection), Accession No. VR-913. The virus was grown in A549 bronchial human carcinoma cells (Wisconsin State Laboratory of Hygiene, University of Wisconsin, Madison, Wis., USA). Plaques were grown, and a single plaque was removed and used to reinfect a fresh batch of A549 cells. Plaques of this second passage were grown and again a single plaque was picked and used to reinfect another fresh batch of A549 cells. The resulting virus is Ad-36P.
In virus neutralization assays of 5 human sera known to have antibodies to Ad-36 (ATCC VR-913), Ad-36p showed a 2-to 4-fold greater titer for neutralizing antibodies than did Ad-36. This demonstrates the greater sensitivity of Ad-36p, as compared to Ad-36, in assaying serum for antibody against obesity-causing adenoviruses.
Minimum Essential Media Eagle (MEM)(Sigma Chemical Co. Cat. No. M-0643) with non-essential amino acids, Earle's salts, 1-glutamine, 10% fetal bovine serum and 2.9% sodium bicarbonate (v/v), pH 7.4, is used for growing A549 cells. 5 to 10 microliters of virus stock solution is mixed with 8 ml of the medium and the mixture is pipetted into flasks with growing cells. The flasks are incubated for 1 h at 37 deg. C. while shaking gently every 15 min. After 1 h, the medium is removed and replaced with fresh medium, The flasks are then incubated at 37 deg. C. The cells are grown over 7 to 8 days, until 90% of the cells show CPE. The cell material and medium are then centrifuged at 1000 rpm for 15 min to eliminate cell debris. The supernatant with virus (e.g., Ad-36 or Ad-36P), is again centrifuged at 1000 rpm for 10 min and then aliquoted into 2 ml cryovials for storage at −70 deg. C. until use.
Fiber protein is isolated from virus in a two step procedure. First, virus is purified from supernatant (see Example 3) using CsCl gradient centrifugation, following the procedure described by Graham and Ludvik in Chapter 11 of Methods in Molecular Biology, Vol. 7: Gene transfer and Expression Protocols, E. J. Murray, ed., The Humana Press, Inc., Clifton, N.J. (1991). Then the fiber protein is isolated from the virus electrophoretically following Oostrum and Burnett, J. Virology, 56,439448 (1985) and Maizel et aL, Virology, 36, 115-125 (1968).
The electrophoretic band of fiber protein (approx. mol. wt. 60,000 daltons) is cut from the gel and the fiber protein can be isolated from the band by standard techniques.
A virus neutralization assay (serum neutralization assay) is used to assay serum for antibody reactive with adenovirus in serum of test subjects.
Serum is thawed and heat-inactivated for 30 min. at 56 deg. C.
The assay is carried out in standard 96-well microtiter plates. Serial two fold dilutions (1:2 to 1:1024) are made with the medium that is the A549 growth medium described in Example 3 but lacks the fetal calf serum and sodium bicarbonate. 50 microliters of each dilution is added in duplicate to the wells of the plate. 50 microliters of virus suspension (100 TCID50)is then added to each well. (TCID50 is calculated by serially diluting viral stock solution and inoculating A549 cells with the dilutions to determine the reciprocal of the highest dilution of virus which causes CPE in 50% of the material inoculated.) The plates are then incubated at 37 deg. C. for 1 hr. Then 100 microliters of A549 cell suspension, containing approximately 20,000 cells, is added to each well and the plate is further incubated at 37 deg. C. for 12 days. Crystal violet-ethanol is then added to each of the wells to fix and stain the cells and the plates are examined macroscopically for CPE;. The highest serum dilution with no CPE is the titer. Controls used in the procedure are wells with no virus and wells with virus but no serum. A back titration is carried out to confirm that appropriate virus dilutions were used. Positive control is antisera to chicken adenovirus and human adenovirus. Presence of CPE with the virus and no CPE in the presence of serum is considered an indication of effective neutralization of the virus with antibody in serum, such that the serum is considered to have antibody against the virus. A titer of 1:8 or greater is considered positive.
The foregoing assay was carried out on serum samples from 155 obese patients and 45 non-obese volunteers. 15-20% of the obese patients were positive for antibody. All of these had TG, CHOL, and LDL-CHOL within the normal ranges for non-obese people. The remaining obese people (antibody-negative) had, on the average, TG, CHOL and LDL-CHOL levels above the normal ranges for non-obese people. None of the non-obese volunteers was positive for antibody. The non-obese volunteers had, on the average, TG, CHOL and LDL-CHOL levels that were in the normal ranges for non-obese people.
Ad-36P virus is killed by adding 42 microliters of 37% formalin to 150 microliters of virus stock, then incubating the resulting composition at room temperature for 72 hours, and finally adding 15 microliters of 35% sodium bisulfite. Confirmation that the virus was killed is carried out by inoculating a culture of A549 cells with the final solution and determining that virus does not grow in the culture.
Nucleic acid from adenovirus Ad-36p was isolated and sequenced by a standard sequencing method.
The cDNA sequence encoding the fiber protein is as follows (SEQ ID NO:1): 5′-ATGTCAAAGAGGCTCCGGGTGGAAGATGACTT CAACCCCGTCT ACCCCTATGGCTACGCGCGGAATCAGAATATCCCCTTCCTCACT CCCCCCTTTGTCTCCTCCGATGGATTCCAAAACTTCCCCCCTGG GGTCCTGTCACTCAAACTGGCTGATCCATGTCTCACTC AAGGTG GGAGGGGGACTCACTGTAGAACAACAGTCTGGAAAACTGAGTG TGGATACTAAGGCACCCTTGCAAGTTGCAAATGACAACAAATT GGAGCTATCTTATGATGATCCATTTAAGGTAGAGAATAA CAAA CTTGGAATTAAAGCTGGCCATGGTTTAGCAGTTGTAACTAAAGA AAACACAAGTCTTCCTAGTCTAGTTGGAACACTTGTAGTTTTAA CTGGAAAAGGAATAGGTACTGGATCAAGTGCACATG GAGGAAC TATTGATGTAAGACTTGGTGAAGGAGGTGGGTATCATTTGATG AAAAAGGAGACTTAGTAGCTTGGGACAAAAAAAATGATACACG CACCCTTTGGACAACACCTGATCCTTCTCCAAATTGC AAGTTG AAACAGCAAGAGACTCAAAGCTAACCTTAGCACTTACAAAATG TGGTAGTCAAATTTTGGCCACTGTATCTTTACTTGTTGTTACGGG CAAATATGCTATTATAAGTGACACAGTCAACCCAAAGCAGTTCT CTATTAAGTTACTGTTTAATG ACAAGGGTGTTTTGTTAAGTGAC TCAAATCTTGATGGGACATATTGGAACTATAGAAGCAACAATA ACAACATAGGCACTCCTTATAAAGAGGCTGTTGGTTTTATGCCA AGCACAACAGCTTATCCTAAGCCAACCAACAACACCAGCACAG ATCCGGATAAAAAAGTGAGTCAAGGTAAAAATAAAAT TGTAAG CAATATATCTTGGAGGAGAGGTATATCAACCAGGATTTATTG TTGTTAAATTTAATCAGGAAACTGATGCCAATTGTGCATACTCT ATTACATTTGATTTGGATGGGGTAAGGTGTATAAGGA TCCTAT ACCATATGATACCTCTTCTACTTTCTCATATATCGCTCAAGA ATGA
The cDNA sequence of the Ad-36p genome was screened against all known cDNA sequences and two 25-base sequences and one 28-base sequence were found, all lying in the fiber-encoding sequence provided above in Example 7, that were unique to Ad-36p. These three sequences are as follows:
SEQ ID NO:2: 5′-AGTTGAAACAGCAAGAGACTCA AAG
SEQ ID NO:3: 5′-GGTACTGGATCAAGTGCACATGG AG
SEQ ID NO:4: 5 ′-TTGAAACAGCAAGAGACTCAAA GCTAAC
Sequence 3 above was employed a a probe for AD-36p in a conventional nuclei acid probe hybridization assay of DNA isolated from four chickens, two of which had been infected with the virus and became obese and two of which had not been infected and were not obese. DNA hybridizing to the probe was observed with only the DNA from the two infected chickens. The assay involved direct detection and was by capillary electrophoresis using laser-induced fluorescence for detection. More particularly, a replaceable polyacrylamide matrix was employed in the electrophoretic separation and detection employed a dual system with 5′-labeling of the oligo and thiazole orange intercalator in the buffer system. See Kolestar et al., J. Chromatography B, 697, 189-194 (1997).
The skilled will understand that probes, and primers when amplification is also used, of between about 15 and 30 bases in length are advantageously employed to provide suitable specificity and sensitivity.
Amplification methods using PCR and variations thereof maybe employed, as well known in the art.
Dhurandhar, Nikhil V., Atkinson, Richard L.
| Patent | Priority | Assignee | Title |
| Patent | Priority | Assignee | Title |
| 6127113, | Apr 04 1997 | Obetech, LLC | Viral obesity methods and compositions |
| 6664050, | Apr 04 1997 | Obetech, LLC | Viral obesity methods and compositions |
| Executed on | Assignor | Assignee | Conveyance | Frame | Reel | Doc |
| Jun 30 2009 | Obetech, LLC | (assignment on the face of the patent) | / |
| Date | Maintenance Fee Events |
| Mar 21 2011 | ASPN: Payor Number Assigned. |
| May 18 2011 | M2552: Payment of Maintenance Fee, 8th Yr, Small Entity. |
| Jun 03 2015 | M2553: Payment of Maintenance Fee, 12th Yr, Small Entity. |
| Date | Maintenance Schedule |
| Feb 08 2014 | 4 years fee payment window open |
| Aug 08 2014 | 6 months grace period start (w surcharge) |
| Feb 08 2015 | patent expiry (for year 4) |
| Feb 08 2017 | 2 years to revive unintentionally abandoned end. (for year 4) |
| Feb 08 2018 | 8 years fee payment window open |
| Aug 08 2018 | 6 months grace period start (w surcharge) |
| Feb 08 2019 | patent expiry (for year 8) |
| Feb 08 2021 | 2 years to revive unintentionally abandoned end. (for year 8) |
| Feb 08 2022 | 12 years fee payment window open |
| Aug 08 2022 | 6 months grace period start (w surcharge) |
| Feb 08 2023 | patent expiry (for year 12) |
| Feb 08 2025 | 2 years to revive unintentionally abandoned end. (for year 12) |