Synthetic ligation reassembly in directed evolution

Abstract

Harvesting the full richness of biodiversity is instantly recognized by Diversa Corporation as a powerful means to access both novel molecules having direct commercial utility as well as molecular templates that could be retooled to acquire commercial utility. A directed evolution process for rapid and facilitated production from a progenitor polynucleotide template, of a library of mutagenized progeny polynucleotides wherein each of the 20 naturally encoded amino acids is encoded at each original codon position. This method, termed site-saturation mutagenesis, or simply saturation mutagenesis, is preferably based on the use of the degenerate N,N,G/T sequence. Also, a method of non-stochastically producing a library of chimeric nucleic acid molecules having an overall assembly order that is chosen by design. Accordingly, a set of progenitor templates, such as genes (e.g. a family of esterase genes) or genes pathways (e.g. encoding antibiotics) can be shuffled to generate a sizable library of distinct progeny polynucleotide molecules (e.g. 10¹⁰⁰) and correspondingly encoded polypeptides. Screening of these polynucleotide libraries enables the identification of a desirable molecular species that has a desirable property, such as a specific enzymatic activity serviceable for a commercial application, or a novel antibiotic. Also, a method of retooling genes and gene pathways by the introduction of regulatory sequences, such as promoters, that are operable in an intended host, thus conferring operability to a novel gene pathway when it is introduced into an intended host. For example a novel man-made gene pathway, generated based on microbially-derived progenitor templates, that is operable in a plant cell.

Description

RELATED APPLICATIONS

The present application is a continuation-in-part of U.S. application Ser. No. 09/332,835, filed on Jun. 14, 1999, now A, B, and C(SEQ ID NO: 24)(SEQ ID NO: 35)
Reverse Primer=9511TopR (AGCTAAGGGTCAAGGCCGCACCCGAGG) (SEQ ID NO: 36)

The resulting PCR product (ca. 1000 bp) was gel purified and quantified.

A vector for expression cloning, pASK3 (Institut fuer Bioanalytik, Goettingen, Germany), was cut with Xba I and Bgl II and dephosphorylated with CIP.

0.5 pmoles Vaccina Topoisomerase I (Invitrogen, Carlsbad, Calif.) was added to 60 ng (ca. 0.1 pmole) purified PCR product for 5′ 37 C in buffer NEB I (New England Biolabs, Beverly, Mass.) in 5 μl total volume.

The topogated PCR product was cloned into the vector pASK3 (5 μl, ca. 200 ng in NEB I) for 5′ at room temperature.

This mixture was dialyzed against H₂O for 30′.

2 μl were used for electroporation of DH10B cells (Gibco BRL, Gaithersburg, Md.).

Efficiency: Based on the actual clone numbers this method can produce 2×10⁶ clones per μg vector. All tested recombinants showed esterase activity after induction with anhydrotetracycline.

EXAMPLE 7

Dehalogenase Thermal Stability

This invention provides that a desirable property to be generated by directed evolution is exemplified in a limiting fashion by an improved residual activity (e.g. an enzymatic activity, an immunoreactivity, an antibiotic acivity activity, etc.) of a molecule upon subjection to altered environment, including what may be considered a harsh enviroment environment, for a specified time. Such a harsh environment may comprise any combination of the following (iteratively or not, and in any order or permutation): an elevated temperature (including a temperature that may cause denaturation of a working enzyme), a decreased temperature, an elevated salinity, a decreased salinity, an elevated pH, a decreased pH, an elevated pressure, a decreassed decreased pressure, and an change in exposure to a radiation source (including uv radiation, visible light, as well as the entire electromagnetic spectrum).

The following example shows an application of directed evolution to evolve the ability of an enzyme to regain &/or retain activity upon exposure to an elevated temperature. Every residue (316) of a dehalogenase enzyme was converted into all 20 amino acids by site directed mutagenesis using 32-fold degenerate oligonucleotide primers. These mutations were introduced into the already rate-improved variant Dhla 20F 12. Approximately 200 clones of each position were grown in liquid media (384 well microtiter plates) to be screened. The screening procedure was as follows:

• 1. Overnight cultures in 384-well plates were centrifuged and the media removed. To each well was added 0.06 mL 1 mM Tris/SO₄²⁻ pH 7.8.
• 2. The robot made 2 assay plates from each parent growth plate consisting of 0.02 mL cell suspension.
• 3. One assay plate was placed at room temperature and the other at elevated temperature (initial screen used 55° C.) for a period of time (initially 30 minutes).
• 4. After the prescribed time 0.08 mL room temperature substrate (TCP saturated 1 mM Tris/SO₄²⁻ pH 7.8 with 1.5 mM NaN₃ and 0.1 mM bromothymol blue) was added to each well. TCP=trichloropropane.
• 5. Measurements at 620 nm were taken at various time points to generate a progress curve for each well.
• 6. Data were analyzed and the kinetics of the cells heated to those not heated were compared. Each plate contained 1-2 columns (24 wells) of un-mutated 20F12 controls.
• 7. Wells that appeared to have improved stability were regrown and tested under the same conditions.

Following this procedure nine single site mutations appeared to confer increased thermal stability on Dhla-20F12. Sequence analysis showed that the following changes were beneficial:

• • D89G
  • F91S
  • T159L
  • G189Q, G189V
  • 1220L
  • N238T
  • W251Y
  • P302A, P302L, P302S, P302K
  • P302R/S306R

Only two sites (189 and 302) had more than one substitution. The first 5 on the list were combined (using G189Q) into a single gene (this mutant is referred to as “Dhla5”). All changes but S306R were incorporated into another variant referred to as Dhla8.

Thermal stability was assessed by incubating the enzyme at the elevated temperature (55° C. and 80° C.) for some period of time and activity assay at 30° C. Initial rates were plotted vs. time at the higher temperature. The enzyme was in 50 mM Tris/SO₄ pH 7.8 for both the incubation and the assay. Product (Cl⁻) was detected by a standard method using Fe(NO₃)₃ and HgSCN. Dhla 20F12 was used as the defacto wild type. The apparent half-life (T_1/2) was calculated by fitting the data to an exponential decay function.

According to another aspect of this invention, ligation reassembly can be performed using a solid support. The following example 8 (corresponding to FIG. 17) is illustrative but non-limiting.

EXAMPLE 8

Solid Phase Gene Family Reassembly Protocol

The objective can be, e.g., to reassemble/shuffle molecules of DNA to generate gene libraries of specific genes, libraries of gene families, and libraries of unrelated genes. The synthesis of the full-length molecules is carried out on a solid support. As solid support we use paramagnetic beads coated with Streptavidin. The principle is based on the strong interaction between Biotin and Streptavidin and the ability to stepwise or simulataneously simultaneously ligate DNA fragments generated from the annealing of nucleic acid building blocks (such as ssDNA building blocks). The use of a solid support facilitates the reassembly of nucleic acid building blocks in a sequential manner and thus allows one to use not only unique couplings, but also redundant or repeated couplings throughout the length of a nucleic acid molecule that is to be generated by ligation reassembly.

A “capture oligonucleotide” is biotinylated at the 5′ end for binding to the beads. The “capture oligo” is annealed to a complementary sequence (no biotinylated). The double stranded capture fragment contains two restriction sites at the 5′-end which allows release of the assembled molecules from the solid support.

Ligation reassembly is performed by step-wise ligation of annealed oligonucleotides of 20-100 bases. The first fragment of the assembly contains a 5′-end compatible with the 3′-end of the capture biotinylated fragment. Consecutive ligation of double stranded fragments containing complementary ends allows the generation of full-length molecules. Half way synthesis (midpoint) molecules are released from the solid support. A final ligation step between molecules generated from both ends results in the generation a full-length reassembled DNA.

Materials and Methods:

• • Streptavidin coated magnetic beads M280 (Dynal corp.)
  • Magnetic stand or magnetic particle concentrator (MPC stand)
    • Biotinylated capture oligos containing a 7 or 15 atom-spacer and two restriction sites not internally found in the sequences being reassembled. Ensure that the biotinylated capture oligo does not contain free biotin.
  • Design capture oligos to allow reassembly from both ends of the sequences being reassembled.
  • Design internal oligos according to the sequence (s) being reassembled
  • STE buffer
  • Washing/Binding buffer (1M NaCl, 10 mM Tris-HCl pH 7.5, 1 mM EDTA) PBS, pH 7.4 buffer containing 0.1% BSA.
  • Annealing/ligation buffer
  • Spin columns for DNA purification
• 1) Anneal equimolar amounts of complementary oligos by heating at 90° C. and slowly cooling down to room temperature in STE buffer. Dilute annealed oligos to 5 pmole/ul.
• 2) Aliquot 300-ug of 10 mg/ml bead suspension in a 500 ul Eppendorf tube.
• 3) Wash the beads with 300-ul of PBS buffer using a magnetic stand. Repeat 3 times.
• 4) Wash the beads with 300-ul of 1×Washing/Binding buffer using a magnetic stand. Repeat once.
• 5) Immobilize the pre-annealed biotinylated capture fragments to the beads (55 pmole of 500-bp dsDNA binds to 1 mg of beads). The binding capacity of the beads is fragment length dependent. Mix beads and capture fragment in binding buffer. Incubate at room temperature for 12 h in a 360 degree rotator
• 6) Wash the beads with 300-ul of 60° C. pre-heated 1×Washing/binding buffer using. Repeat 3 times.
• 7) Wash the beads with 300-ul of freshly thawed 1×ligation buffer.
• 8) For a reassembly of “n” (5′ to 3′ and 3′ to 5′)fragments:

	Mix:	Fragment #1 (or “n”) (5 pmole)	10 ul
		5 × ligase buffer	60 ul
		1 U/ul T4 Ligase	15 ul
		dH2O	215 ul
			300 ul

• 9) Incubate with rotation at RT for 30 min.
• 10) Wash the beads with 300-ul of 60° C. pre-heated 1×Washing/Binding buffer. Repeat 3 times.
• 11) Wash the beads with 300-ul of freshly thawed 1×ligation buffer.

	Add:	Fragment #2 (n − 1)(5 pmole)	10 ul
		5 × ligase buffer	60 ul
		1 U/ul T4 Ligase	15 ul
		dH2O	215 ul
			300 ul

• 13) Incubate with rotation at RT for 30 min.
• 14) Wash the beads with 300-ul of 60° C. pre-heated 1×Washing/binding buffer. Repeat 3 times.
• 15) Wash the beads with 300-ul of freshly thawed 1×ligation buffer.
• 16) Repeat the procedure until n/2 fragments have been added from each end of the synthesis
• 17) Elute the partially assembled products from the solid support by cutting with the corresponding restriction enzyme

	Beads with immobilized reassembled gene	x	ul
	10 × enzyme buffer	30	ul
	1 U/ul restriction enzyme	5	ul
	dH2O	to 300	ul

• 18) Replace restriction buffer of eluted DNA for ligation buffer using a spin column. Elute from spin column with H₂O
• 19) Ligate both partially assembled products to generate reassembled full-length molecules

partial synthesis product (5′ to 3′) 60 ul
partial synthesis product (3′ to 5′) 60 ul
5 × ligase buffer                20 ul
1 U/ul T4 ligase                 10 ul
dH2O                             50 ul
                                 200 ul

• 20) Clone full-length genes in corresponding vector.
• 21) Sequence a few clones and screen for different kinetic parameters of the expressed enzymes.

LITERATURE CITED

Unless otherwise indicated, all references cited herein (supra and infra) are incorporated by reference in their entirety.

• Barret A J, et al., eds.: Enzyme Nomenclature: Recommendations of the Nomenclature Committee of the International Union of Biochemistry and Molecular Biology. San Diego: Academic Press, Inc., 1992.
• Boyce C O L, ed.: Novo's Handbook of Practical Biotechnology. 2^nd ed. Bagsvaerd, Denmark, 1986.
• Drauz K, Waldman H, eds.: Enzyme Catalysis in Organic Synthesis: A Comprehensive Handbook. Vol. 1. New York: VCH Publishers, 1995.
• Drauz K, Waldman H, eds.: Enzyme Catalysis in Organic Synthesis: A Comprehensive Handbook. Vol. 2. New York: VCH Publishers, 1995.
• Foster G D, Taylor S C, eds.: Plant Virology Protocols: From Virus Isolation to Transgenic Resistance. Methods in Molecular Biology, Vol. 81. New Jersey: Humana Press Inc., 1998.
• Franks F, ed.: Protein Biotechnology: Isolation, Characterization, and Stabilization. New Jersey: Humana Press Inc., 1993.
• Godfrey T, West S, eds.: Industrial Enzymology. 2^nd ed. London: Macmillan Press Ltd, 1996.
• Gottschalk G: Bacterial Metabolism. 2^nd ed. New York: Springer-Verlag Inc., 1986.
• Gresshoff P M, ed.: Technology Transfer of Plant Biotechnology. Current Topics in Plant Molecular Biology. Boca Raton: CRC Press, 1997.
• Griffin H G, Griffin A M, eds.: PCR Technology: Currrent Innovations. Boca Raton: CRC Press, Inc., 1994.
• Hansen G, Chilton M D: Lessons in gene transfer to plants by a gifted microbe. Curr Top Microbiol Immunol 240:21-57, 1999.
• Hartmann H T, et al.: Plant Propagation: Principles and Practices. 6^th ed. New Jersey: Prentice Hall, Inc., 1997.
• Perun T J, Propst C L, eds.: Computer-Aided Drug Design: Methods and Applications. New York: Marcel Dekker, Inc., 1989.
• Owen M R L, Pen J: Transgenic Plants: A Production System for Industrial and Pharmaceutical Proteins. Chichester: John Wiley & Sons, 1996.
• Segel I H: Enzyme Kinetics: Behavior and Analysis of Rapid Equilibrium and Steady-State Enzyme Systems. New York: John Wiley & Sons, Inc., 1993.
• White J S, White D C: Source Book of Enzymes. Boca Raton: CRC Press, 1997.

Wong C H, Whitesides G M: Enzymes in Synthetic Organic Chemistry. Vol. 12. New York: Elsevier Science Publications, 1995.

• WO 97/35966; Filed Mar. 20, 1997, Published Oct. 2, 1997. Minshull J, Stemmer W P: Mehtods and Compositions for Cellular and Metabolic Engineering.
• WO 98/31837; Filed Jan. 16, 1998, Published Jul. 23, 1998. Delcardayre S B, Tobin M B, Stemmer W P, Minshull, J: Evolution of Whole Cells and Organisms by Recursive Sequence Recombination.
• WO 98/37223; Filed Feb. 18 1998, Published Aug. 27, 1998. Pang S Z, Gonsalves D, Jan F J: DNA Construct to Confer Multiple Traits on Plants.
• Alting-Mecs M A and Short J M: Polycos vectors: a system for packaging filamentous phage and phagemid vectors using lambda phage packaging extracts. Gene 137:1, 93-100, 1993.
• Arkin A P and Youvan D C: An algorithm for protein engineering: simulations of recursive ensemble mutagenesis. Proc Natl Acad Sci USA 89(16):7811-7815, (Aug. 15) 1992.
• Arnold F H: Protein engineering for unusual environments. Current Opinion in Biotechnology 4(4):450-455, 1993.
• Ausubel F M, et al Editors. Current Protocols in Molecular Biology, Vols. 1 and 2 and supplements. (a.k.a. “The Red Book”) Greene Publishing Assoc., Brooklyn, N.Y., ©1987.
• Ausubel F M, et al Editors. Current Protocols in Molecular Biology, Vols. 1 and 2 and supplements. (a.k.a. “The Red Book”) Greene Publishing Assoc., Brooklyn, N.Y. ©1989.
• Ausubel F M, et al Editors. Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology. Greene Publishing Assoc., Brooklyn, N.Y., ©1989.
• Ausubel F M, et al Editors. Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, 2^nd Edition. Greene Publishing Assoc., Brooklyn, N.Y., ©1992.
• Barbas C F 3d, Bain J D, Hoekstra D M, Lemer R A: Semisynthetic combinatorial antibody libraries: a chemical solution to the diversity problem. Proc Natl Acad Sci USA 89(10):4457-4461, 1992.
• Bardwell A J, Bardwell L, Johnson D K, Friedberg E C: Yeast DNA recombination and repair proteins Rad1 and Rad10 constitute a complex in vivo mediated by localized ydrophobic domains. Mol Microbiol 8(6):1177-1188, 1993.
• Bartel P, Chien C T, Stemglanz R, Fields S: Elimination of false positives that arise in using the two-hybrid system. Biotechniques 14(6):920-924, 1993.
• Beaudry A A and Joyce G F: Directed evolution of an RNA enzyme. Science 257(5070):635-641, 1992.
• Berger and Kimmel, Methods in Enzymology, Volume 152, Guide to Molecular Cloning Techniques. Academic Press, Inc., San Diego, Calif., ©1987. (Cumulative Subject Index: Volumes 135-139, 141-167, 1990, 272 pp.)
• Bevan M: Binary Agrobacterium vectors for plant transformation. Nucleic Acids Research 12(22):8711-21, 1984.
• Biocca S, Pierandrei-Amaldi P, Cattaneo A: Intracellular expression ofanti-p21ras single chain Fv fragments inhibits meiotic maturation of xenopus oocytes. Biochem Biophys Res Commun 197(2):422-427, 1993.
• Bird et al. Plant Mol Biol 11:651, 1988.
• Bogerd H P, Fridell R A, Blair W S, Cullen B R: Genetic evidence that the Tat proteins of human immunodeficiency virus types 1 and 2 can multimerize in the eukaryotic cell nucleus. J Virol 67(8):5030-5034, 1993.
• Brederode F T, Koper-Zawrthoff E C, Bol J F: Complete nucleotide sequence of alfalfa mosaic virus RNA 4. Nucleic Acids Research 8(10):2213-23, 1980.
• Breitling F, Dubel S, Seehaus T, Klewinghaus I, Little M: A surface expression vector for antibody screening. Gene 104(2): 147-153, 1991.
• Brown N L, Smith M: Cleavage specificity of the restriction endonuclease isolated from Haemophilus gallinarum (Hga I). Proc Natl Acad Sci USA 74(8):3213-6, (August) 1977.
• Burton D R, Barbas C F 3d, Persson M A, Koenig S, Chanock R M, Lerner R A: A large array of human monoclonal antibodies to type 1 human immunodeficiency virus from combinatorial libraries of asymptomatic seropositive individuals. Proc Natl Acad Sci USA 88(22):10134-7, (Nov. 15) 1991.
• Caldwell R C and Joyce G F: Randomization of genes by PCR mutagenesis. PCR Methods Appl 2(10):28-33, 1992.
• Caton A J and Koprowski H: Influenze virus hemagglutinin-specific antibodies isolatedf froma combinatorial expression library are closely related to the immune response of the donor. Proc NatlAcad Sci USA 87(16):6450-6454, 1990.
• Chakraborty T, Martin J F, Olson E N: Analysis of the oligomerization of myogenin and E2A products in vivo using a two-hybrid assay system. J Biol Chem 267(25): 17498-501, 1992.
• Chang C N, Landolfi N F, Queen C: Expression of antibody Fab domains on bacteriophage surfaces. Potential use for antibody selection. J Immunol 147(10):3610-4, (Nov. 15) 1991.
• Chaudhary V K, Batra J K, Gallo M G, Willingham M C, FitzGerald D J, Pastan I: A rapid method of cloning functional variable-region antibody genes in Escherichia coli as single-chain immunotoxins. Proc Natl Acad Sci USA 87(3):1066-1070, 1990.
• Chien C T, Bartel P L, Stemglanz R, Fields S: The two-hybrid system: a method to identify and clone genes for proteins that interact with a protein of interest. Proc Natl A cad Sci USA 88(21):9578-9582, 1991.
• Chiswell D J, McCafferty J: Phage antibodies: will new ‘coliclonal’ antibodies replace monoclonal antibodies? Trends Biotechnol 10(3):80-84, 1992.
• Chothia C and Lesk A M: Canonical structures for the hypervariable regions of immunoglobulins. J Mol Biol 196)4):901-917, 1987.
• Chothia C, Lesk A M, Tramontano A, Levitt M, Smith-Gill S J, Air G, Sheriff S, Padlan E A, Davies D, Tulip W R, et al: Conformations of immunoglobulin hypervariable regions. Nature 342(6252):877-883, 1989.
• Clackson T, Hoogenboom H R, Griffiths A D, Winter G: Making antibody fragments using phage display libraries. Nature 352(6336):624-628, 1991.
• Conrad M, Topal M D: DNA and spermidine provide a switch mechanism to regulate the activity of restriction enzyme Nae I. Proc Natl Acad Sci USA 86(24):9707- 11, (December) 1989.
• Coruzzi G, Broglie R. Edwards C, Chua N H: Tissue-specific and light-regulated expression of a pea nuclear gene encoding the small subunit of ribulose- 1,5-bisphosphate carboxylase. EMBO J 3(8): 1671-9, 1984.
• Dasmahapatra B, DiDomenico B, Dwyer S, Ma J, Sadowski I, Schwartz J: A genetic system for studying the activity of a proteolytic enzyme. Proc Natl Acad Sci USA 89(9): 4159-4162, 1992.
• Davis L G, Dibner M D, Battey J F. Basic Methods in Molecular Biology. Elsevier, New York, N.Y., ©1986.
• Delegrave S and Youvan D C. Biotechnology Research 11:1548-1552,1993.
• DeLong E F, Wu K Y, Prezelin B B, Jovine R V: High abundance of Archaea in Antarctic marine picoplankton. Nature 371(6499):695-697, 1994.
• Deng S J, MacKenzie C R, Sadowska J, Michniewicz J, Young N M, Bundle Dr, Narang S A: Selection of antibody single-chain variable fragments with improved carbohydrate binding by phage display. J Biol Chem 269(13):9533-9538, 1994.
• Duan L, Bagasra O, Laughlin M A, Oakes J W, Pomerantz R J: Potent inhibition of human immunodeficiency virus type 1 replication by an intracellular anti-Rev single-chain antibody. Proc NatlAcadSci USA 91(11):5075-5079, 1994.
• Durfee T, Becherer K, Chen P L, Yeh S H, Yang Y, Kilburn A E, Lee W H, Elledge S J: The retinoblastoma protein associates with the protein phosphatase type 1 catalytic subunit. Genes Dev 7(4):555-569, 1993.
• Ellington A D and Szostak J W: In vitro selection of RNA molecules that bind specific ligands. Nature 346(6287): 818-822, 1990.
• Fields S and Song O: A novel genetic system to detect protein-protein interactions. Nature 340(6230):245-246, 1989.
• Firek S, Draper J, Owen M R, Gandecha A, Cockburn B, Whitelam G C: Secretion of a functional single-chain Fv protein in transgenic tobacco plants and cell suspension cultures. Plant Mol Biol 23(4):861-870, 1993.
• Forsblom S, Rigler R, Ehrenberg M, Philipson L: Kinetic studies on the cleavage of adenovirus DNA by restriction endonuclease Eco RI. Nucleic Acids Res 3(12):3255-69, (December) 1976.
• Germino F J, Wang Z X, Weissman S M: Screening for in vivo protein-protein interactions. Proc Natl Acad Sci USA 90(3):933-937, 1993.
• Gingeras T R, Brooks J E: Cloned restriction/modification system from Pseudomonas aeruginosa. Proc Natl Acad Sci USA 80(2):402-6, January 1983.
• Gluzman Y: SV40-transformed simian cells support the replication of early SV40 mutants. Cell 23(1):175-182, 1981.
• Gruber M, Schodin B A, Wilson E R, Kranz D M: Efficient tumor cell lysis mediated by a bispecific single chain antibody expressed in Escherichia coli. J Immunol 152 (11):5368-5374, 1994.
• Guarente L: Strategies for the identification of interacting proteins. Proc Natl Acad Sci USA 90(5):1639-1641, 1993.
• Guilley H, Dudley R K, Jonard G, Balazs E, Richards K E: Transcription of Cauliflower mosaic virus DNA: detection of promoter sequences, and characterization of transcripts. Cell 30(3):763-73, 1982.
• Hardy C F, Sussel L, Shore D: A RAP1-interacting protein involved in transcriptional silencing and telomere length regulation. Genes Dev 6(5):801-814, 1992.
• Hawkins R E and Winter G: Cell selection strategies for making antibodies from variable gene libraries: trapping the memory pool. Eur J Immunol 22(3):867-870, 1992.
• Holvoet P, Laroche Y, Lijnen H R, Van Hoef B, Brouwers E, De Cock F, Lauwereys M, Gansemans Y, Caen D: Biochemical characterization of single-chain chimeric plasminogen activators consisting of a single-chain Fv fragment of a fibrin-specific antibody and single-chain urokinase. Eur J Biochem 210(3):945-952, 1992.
• Honjo T, Alt F W, Rabbitts T H (eds): Immunoglobulin genes. Academic Press: San Diego, Calif., pp. 361-368, ©1989.
• Hoogenboom H R, Griffiths A D, Johnson K S, Chiswell D J, Judson P, Winter G: Multi-subunit proteins on the surface of filamentous phage: methodologies for displaying antibody (Fab) heavy and light chains. Nucleic Acids Res 19(15):4133-4137, 1991.
• Huse W D, Sastry L, Iverson S A, Kang A S, Alting-Mees M, Burton D R, Benkovic S J, Lerner R A: Generation of a large combinatorial library of the immunoglobulin repertoire in phage lambda. Science 246(4935):1275-1281, 1989.
• Huston J S, Levinson D, Mudgett-Hunter M, Tai MS, Novotney J, Margolies M N, Ridge R J, Bruccoleri R E, Haber E, Crea R, et al: Protein engineering of antibody binding sites: recovery of specific activity in an antidigoxin single-chain Fv analogue produced in Escherichia coli. Proc Natl Acad Sci USA 85(16):5879-5883, 1988.
• Iwabuchi K, Li B, Bartel P, Fields S: Use of the two-hybrid system to identify the domain of p53 involved in oligomerization. Oncogene 8(6):1693-1696, 1993.
• Jackson A L, Pahl P M, Harrison K, Rosamond J, Sclafani R A: Cell cycle regulation of the yeast Cdc7 protein kinase by association with the Dbf4 protein. Mol Cell Biol 13(5):2899-2908, 1993.
• Johnson S and Bird R E: Methods Enzymol 203:88, 1991.
• Kabat et al: Sequences of Proteins of Immunological Interest, 4th Ed. U.S. Department of Health and Human Services, Bethesda, Md. (1987)
• Kang A S, Barbas C F, Janda K D, Benkovic S J, Lerner R A: Linkage of recognition and replication functions by assembling combinatorial antibody Fab libraries along phage surfaces. Proc Natl Acad Sci USA 88(10): 4363-4366, 1991.
• Kettleborough C A, Ansell K H, Allen R W, Rosell-Vives E, Gussow D H, Bendig M M: Isolation of tumor cell-specific single-chain Fv from immunized mice using phage-antibody libraries and the re-construction of whole antibodies from these antibody fragments. Eur J Immunol 24(4):952-958, 1994.
• Kruger D H, Barcak G J, Reuter M, Smith H O: EcoRII can be activated to cleave refractory DNA recognition sites. Nucleic Acids Res 16(9):3997-4008, (May 11) 1988.
• Lalo D, Caries C, Sentenac A, Thuriaux P: Interactions between three common subunits of yeast RNA polymerases I and III. Proc Natl Acad Sci USA 90(12):5524-5528, 1993.
• Laskowski M Sr: Purification and properties of venom phosphodiesterase. Methods Enzymol 65(1):276-84, 1980.
• Lefkovits I and Perris B, Editors. Immunological Methods, Vols. I and II. Academic Press, New York, N.Y. Also Vol. III published in Orlando and Vol. IV published in San Diego. ©1979.
• Ivan Lefkovits, Editor. Immunology methods manual: the comprehensive sourcebook of techniques. Academic Press, San Diego, ©1997.
• Lerner R A, Kang A S, Bain J D, Burton D R, Barbas C F 3d: Antibodies without immunization. Science 258(5086): 1313-1314, 1992.
• Leung, D. W., et al, Technique, 1:11-15, 1989.
• Li B and Fields S: Identification of mutations in p53 that affect its binding to SV40 large T antigen by using the yeast two-hybrid system. FASEB J 7(10):957-963, 1993.
• Lilley G G, Doelzal O, Hillyard C J, Bernard C, Hudson P J: Recombinant single-chain antibody peptide conjugates expressed in Escherichia coli for the rapid diagnosis of HIV. J Immunol Methods 171(2):211-226, 1994.
• Lowman H B, Bass S H, Simpson N, Wells J A: Selecting high-affinity binding proteins by monovalent phage display. Biochemistry 30(45):10832-10838, 1991.
• Luban J, Bossolt K L, Franke E K, Kalpana G V, Goff S P: Human immunodeficiency virus type 1 Gag protein binds to cyclophilins A and B. Cell 73(6):1067-1078, 1993.
• Madura K, Dohmen R J, Varshaysky A: N-recognin/Ubc2 interactions in the N-end rule pathway. J Biol Chem 268(16):12046-54, (Jun 5) 1993.
• Marks J D, Hoogenboom H R, Bonnert T P, McCafferty J, Griffiths A D, Winter G: By-passing immunization. Human antibodies from V-gene libraries displayed on phage. J Mol Biol 222(3):581-597, 1991.
• Marks J D, Griffiths A d, Malmqvist M, Clackson T P, Bye J M, Winter G: By-passing immunization: building high affinity human antibodies by chain shuffling. Biotechnology (NY) 10(7):779-783, 1992.
• Marks J D, Hoogenboom H R, Griffiths A D, Winter G: Molecular evolution of proteins on filamentous phage. Mimicking the strategy of the immune system. J Biol Chem 267(23):16007-16010, 1992.
• Maxam A M, Gilbert W: Sequencing end-labeled DNA with base-specific chemical cleavages. Methods Enzymol 65(1):499-560, 1980.
• McCafferty J, Griffiths A D, Winter G, Chiswell D J: Phage antibodies: filamentous phage displaying antibody variable domains. Nature 348(6301):552-554, 1990.
• Miller J H. A Short Course in Bacterial Genetics: A Laboratory Manual and Handbook for Escherichia coli and Related Bacteria (see inclusively p. 445). Cold Spring Harbor Laboratory Press, Plainview, N.Y., ©1992.
• Milne G T and Weaver D T: Dominant negative alleles of RAD52 reveal a DNA repair/recombination complex including Rad51 and Rad52. Genes Dev 7(9):1755-1765, 1993.
• Mullinax R L, Gross E A, Amberg J R, Hay B N, Hogrefe H H, Kubtiz M M, Greener A, Alting-Mees M, Ardourel D, Short J M, et al: Identification of human antibody fragment clones specific for tetanus toxoid in a bacteriophage lambda immunoexpression library. Proc natl Acad Sci USA 87(20):8095-9099, 1990.
• Nath K, Azzolina B A: in Gene Amplification and Analysis (ed. Chirikjian J G), vol. 1, p. 113, Elsevier North Holland, Inc., New York, N.Y., ©1981.
• Needleman S B and Wunsch C D: A general method applicable to the search for similarities in the amino acid sequence of two proteins. J Mol Biol 48(3):443-453, 1970.
• Nelson M, Christ C, Schildkraut I: Alteration of apparent restriction endonuclease recognition specificities by DNA methylases. Nucleic Acids Res 12(13):5165-73, 1984 (Jul 11).
• Nicholls P J, Johnson V G, Andrew S M, Hoogenboom H R, Raus J C, Youle R J: Characterization of single-chain antibody (sFv)-toxin fusion proteins produced in vitro in rabbit reticulocyte lysate. J Biol Chem 268(7):5302-5308, 1993.
• Oiler A R, Vanden Broek W, Conrad M, Topal M D: Ability of DNA and spermidine to affect the activity of restriction endonucleases from several bacterial species. Biochemistry 30(9):2543-9, (Mar 5) 1991.
• Owens R J and Young R J: The genetic engineering of monoclonal antibodies. J Immunol Methods 168(2):149-165, 1994.
• Pearson W R and Lipman D J: Improved tools for biological sequence comparison. Proc Natl Acad Sci USA 85(8):2444-2448, 1988.
• Pein C D, Reuter M, Meisel A, Cech D, Kruger D H: Activation of restriction endonuclease EcoRII does not depend on the cleavage of stimulator DNA. Nucleic Acids Res 19(19):5139-42, (Oct 11) 1991.
• Persson M A, Caothien R H, Burton D R: Generation of diverse high-affinity human monoclonal antibodies by repertoire cloning. Proc Natl Acad Sci USA 88(6):2432-2436, 1991.
• Queen C, Foster J, Stauber C, Stafford J: Cell-type specific regulation of a kappa immunoglobulin gene by promoter and enhance elements. Immunol Rev 89:49-68, 1986.
• Qiang B Q, McClelland M, Poddar S, Spokauskas A, Nelson M: The apparent specificity of Notl (5′-GCGGCCGC-3′) is enhanced by M.FnuDII or M.Bepl methyltransferases (5′-mCGCG-3′): cutting bacterial chromosomes into a few large pieces. Gene 88(1):101-5, (Mar. 30) 1990.
• Raleigh E A, Wilson G: Escherichia coli K-12 restricts DNA containing 5-methylcytosine. Proc Natl Acad Sci USA 83(23):9070-4, (Dec) 1986.
• Reidhaar-Olson J F and Sauer R T: Combinatorial cassette mutagenesis as a probe of the informational content of protein sequences. Science 241(4861):53-57, 1988.
• Riechmann L and Weill M: Phage display and selection of a site-directed randomized single-chain antibody Fv fragment for its affinity improvement. Biochemistry 32(34):8848-8855, 1993.
• Roberts R J, Macelis D: REBASE—restriction enzymes and methylases. Nucleic Acids Res 24(1):223-35, (Jan. 1) 1996.
• Ryan A J, Royal C L, Hutchinson J, Shaw C H: Genomic sequence of a 12S seed storage protein from oilseed rape (Brassica napus c.v. jet neuf). Nucl Acids Res 17(9):3584, 1989.
• Sambrook J, Fritsch E F, Maniatis T. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., ©1982.
• Sambrook J, Fritsch E F, Maniatis T. Molecular Cloning: A Laboratory Manual. Second Edition. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., ©1989.
• Scopes R K. Protein Purification: Principles and Practice. Springer-Verlag, New York, N.Y., ©1982.
• Silver S C and Hunt S W 3d: Techniques for cloning cDNAs encoding interactive transcriptional regulatory proteins. Mol Biol Rep 17(3):155-165, 1993.
• Smith T F, Waterman M S. Adv Appl Math 2:482-end of article, 1981.
• Smith T V, Waterman M S: Overlapping genes and information theory. J Theor Biol 91(2):379-80, (Jul. 21) 1981.
• Smith T F, Waterman M S: Identification of common molecular subsequences. J Mol Biol 147(1):195-7, (Mar. 25) 1981.
• Smith T F, Waterman M S, Fitch W M: Comparative biosequence metrics. J Mol Evol S18(1):38-46, 1981.
• Staudinger J, Perry M, Elledge S J, Olson E N: Interactions among vertebrate helix-loop-elix proteins in yeast using the two-hybrid system. J Biol Chem 268(7):4608-4611, 1993.
• Stemmer W P, Morris S K, Wilson B S: Selection of an active single chain Fv antibody from a protein linker library prepared by enzymatic inverse PCR. Biotechniques 14(2):256-265, 1993.
• Stemmer W P: DNA shuffling by random fragmentation and reassembly: in vitro recombination for molecular evolution. Proc Natl Acad Sci USA 91(22):10747-10751, 1994.
• Sun D, Hurley L H: Effect of the (+)-CC-1065-(N3-adenine) DNA adduct on in vitro DNA synthesis mediated by Escherichia coli DNA polymerase. Biochemistry 31:10, 2822-9, (Mar. 17) 1992,
• Tague B W, Dickinson C D, Chrispeels M J: A short domain of the plant vacuolar protein phytohemagglutinin targets invertase to the yeast vacuole. Plant Cell 2(6):533-46, (June) 1990.
• Takahashi N, Kobayashi I: Evidence for the double-strand break repair model of bacteriophage lambda recombination. Proc Natl Acad Sci U S A 87(7):2790-4, (April) 1990.
• Thiesen H J and Bach C: Target Detection Assay (TDA): a versatile procedure to determine DNA binding sites as demonstrated on SP1 protein. Nucleic Acids Res 18(11): 3203-3209, 1990.
• Thomas M, Davis R W: Studies on the cleavage of bacteriophage lambda DNA with EcoRI Restriction endonuclease. J Mol Biol 91(3):315-28, (Jan. 25) 1975.
• Tingey S V, Walker E L, Corruzzi G M: Glutamine synthetase genes of pea encode distinct polypeptides which are differentially expressed in leaves, roots and nodules. EMBO J 6(1):1-9, 1987.
• Topal M D, Thresher R J, Conrad M, Griffith J: Nael endonuclease binding to pBR322 DNA induces looping. Biochemistry 30(7):2006-10, (Feb. 19) 1991.
• Tramontano A, Chothia C, Lesk A M: Framework residue 71 is a major determinant of the position and conformation of the second hypervariable region in the VH domains of immunoglobulins. J Mol Biol 215(1):175-182, 1990.
• Tuerk C and Gold L: Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase. Science 249(4968):505-510, 1990.
• van de Poll M L, Lafleur M V, van Gog F, Vrieling H, Meerman J H: N-acetylated and deacetylated 4′-fluoro-4-aminobiphenyl and 4-aminobiphenyl adducts differ in their ability to inhibit DNA replication of single-stranded M13 in vitro and of single-stranded phi X174 in Escherichia coli. Carcinogenesis 13(5):751-8, (May) 1992.
• Vojtek A B, Hollenberg S M, Cooper J A: Mammalian Ras interacts directly with the serine/threonine kinase Raf. Cell 74(1):205-214, 1993.
• Wenzler H, Mignery G, Fisher L, Park W: Sucrose-regulated expression of a chimeric potato tuber gene in leaves of transgenic tobacco plants. Plant Mol Biol 13(4):347-54, 1989.
• Williams and Barclay, in Immunoglobulin Genes, The Immunoglobulin Gene Superfamily
• Winnacker E L. From Genes to Clones: Introduction to Gene Technology. VCH Publishers, New York, N.Y., ©1987.
• Winter G and Milstein C: Man-made antibodies. Nature 349(6307):293 299, 1991.
• Yang X, Hubbard E J, Carlson M: A protein kinase substrate identified by the two-hybrid system. Science 257(5070): 680-2, (Jul 31) 1992.
• U.S. Pat No. 4,683,195; Filed Feb. 7, 1986, Issued Jul. 28. 1987. Mullis K B, Erlich H A, Arnheim N, Horn G T, Saiki R K, Scharf S J: Process for Amplifying, Detecting, and/or Cloning Nucleic Acid Sequences.
• U.S. Pat. No. 4,683,202; Filed Oct. 25, 1985, Issued Jul. 28, 1987. Mullis K B: Process for Amplifying Nucleic Acid Sequences.
• U.S. Pat. No. 4,704,362; Filed Nov. 5, 1979, Issued Nov. 3, 1987. Itakura K, Riggs A D: Recombinant Cloning Vehicle Microbial Polypeptide Expression.
• WO 88/08453; Filed Apr. 14, 1988, Published Nov. 3, 1988. Alakhov J B, Baranov, V I, Ovodov S J, Ryabova L A, Spirin A S: Method of Obtaining Polypeptides in Cell-Free Translation System.
• WO 90/05785; Filed Nov. 15, 1989, Published May 31, 1990. Schultz P: Method for Site-Specifically Incorporating Unnatural Amino Acids into Proteins.
• WO 90/07003; Filed Jan. 27, 1989, Published Jun. 28, 1990. Baranov V I, Morozov I J, Spirin A S: Method for Preparative Expression of Genes in a Cell-free System of Conjugated Transcription/translation.
• WO 91/02076; Filed Jun. 14, 1990, Published Feb. 21, 1991. Baranov V I, Ryabova L A, Yarchuk O B, Spirin A S: Method for Obtaining Polypeptides in a Cell-free System.
• WO 91/05058; Filed Oct. 5, 1989, Published Apr. 18, 1991. Kawasaki G: Cell-free Synthesis and Isolation of Novel Genes and Polypeptides.
• WO 91/17271; Filed May 1, 1990, Published Nov. 14, 1991. Dower W J, Cwirla S E: Recombinant Library Screening Methods.
• WO 91/18980; Filed May 13, 1991, Published Dec. 12, 1991. Devlin J J: Compositions and Methods for Indentifying Biologically Active Molecules.
• WO 91/19818; Filed Jun. 20, 1990, Published Dec. 26, 1991. Dower W J, Cwirla S E, Barrett R W: Peptide Library and Screening Systems.
• WO 92/02536; Filed Aug. 1, 1991, Published Feb. 20, 1992. Gold L, Tuerk C: Systematic Polypeptide Evolution by Reverse Translation.
• WO 92/03918; Filed Aug. 28, 1991, Published Mar. 19, 1992. Lonberg N, Kay R M: Transgenic Non-human Animals Capable of Producing Heterologous Antibodies.
• WO 92/03918; Filed Aug. 28, 1991, Published Mar. 19, 1992. Lonberg N, Kay R M: Transgenic Non-human Animals Capable of Producing Heterologous Antibodies.
• WO 92/05258; Filed Sept. 17, 1991, Published Apr. 2, 1992. Fincher G B: Gene Encoding Barley Enzyme.
• WO 92/14843; Filed Feb. 21, 1992, Published Sept. 3, 1992. Toole J J, Griffin L C, Bock L C, Latham J A, Muenchau D D, Krawczyk S: Aptamers Specific for Biomolecules and Method of Making.
• WO 93/08278; Filed Oct. 15, 1992, Published Apr. 29, 1993. Schatz P J, Cull M G, Miller J F, Stemmer W P: Peptide Library and Screening Method.
• WO 93/12227; Filed Dec 17, 1992, Published Jun. 24, 1993. Lonberg, N; Kay R M: Transgenic Non-human Animals Capable of Producing Heterologous Antibodies.
• WO 93/12227; Filed Dec. 17, 1992, Published Jun. 24, 1993. Lonberg N, Kay R M: Transgenic Non-human Animals Capable of Producing Heterologous Antibodies.
• WO 94/25585; Filed Apr. 25, 1994, Published Nov. 10, 1994. Lonberg, N, Kay R M: Transgenic Non-human Animals Capable of Producing Heterologous Antibodies.
• WO 94/25585; Filed Apr. 25, 1994, Published Nov. 10, 1994. Lonberg N, Kay R M: Transgenic Non-human Animals Capable of Producing Heterologous Antibodies.
• Arslan T, Abraham A T, Hecht S M: Structurally altered substrates for DNA topoisomerase I. Effects of inclusion of a single 3′-deoxynucleotide within the scissile strand. Nucleosides Nucleotides 1998 January-March;17(1-3): 515-30.
• Aupeix K, Toulme J J: Binding of chemically-modified oligonucleotides to the double-stranded stem of an RNA hairpin. Nucleosides Nucleotides 1999 June-July;18 (6-7): 1647-50.

Bazzanini R, Manfredini S, Durini E, Groschel B, Cinatl J, Balzarini J, De Clercq E, Imbach J L, Perigaud C, Gosselin G: Prodrugs of Ara-CMP and Ara-AMP with a S-acyl-2-thioethyl (SATE) biolabile phosphate protecting group: synthesis and biological evaluation. Nucleosides Nucleotides 1999 April-May;18(4-5):971-2. Blackburn G M, Liu X, Rosier A, Brenner C: Two hydrolase resistant analogues of diadenosine 5′,5′″-P1, P3-triphosphate for studies with Fhit, the human fragile histidine triad protein. Nucleosides Nucleotides 1998 January-March; 17(1-3): 301-8. Bridson P K, Lin X, Melman N, Ji X D, Jacobson K A: Synthesis and adenosine receptor affinity of 7-beta-D-ribofuiranosylxanthine. Nucleosides Nucleotides 1998 April;17(4):759-68.

• Brodin P, Gottikh M, Auclair C, Mouscadet J F: Inhibition of HIV-1 integration by mono- & bi-functionalized triple helix forming oligonucleotides. Nucleosides Nucleotides 1999 June-Juyl; 18(6-7):1717-8.
• Creighton T E: Proteins Structures and Molecular Principles. New York: W. H. Freeman and Co., 1984.
• De Clercq E: Carbocyclic adenosine analogues as S-adenosylhomocysteine hydrolase inhibitors and antiviral agents: recent advances. Nucleosides Nucleotides 1998 January-March;17(1-3):625-34.
• de Zwart M, Link R, von Frijtag Drabbe Kunzel J K, Cristalli G, Jacobson K A, Townsend-Nicholson A, IJzerman A P: A functional screening of adenosine analogues at the adenosine A2B receptor: a search for potent agonists. Nucleosides Nucleotides 1998 June;17(6):969-85.
• Egron D, Arzumanov A A, Dyatkina N B, Krayevsky A, Imbach J L, Aubertin A M, Gosselin G, Perigaud C: Synthesis, anti-HIV activity and stability studies of 3′-azido-2′,3′-dideoxythymidine 5′-fluorophosphate. Nucleosides Nucleotides 1999 April-May;18(4-5):983-4
• Gianolio D A, McLaughlin L W: Synthesis and triplex forming properties of pyrimidine derivative containing extended functionality. Nucleosides Nucleotides 1999 August; 18(8):1751-69.
• Gottikh M B, Volkov E M, Romanova E A, Oretskaya T S, Shabarova Z A: Synthesis of oligonucleotide-intercalator conjugates capable to inhibit HIV-1 DNA integration. Nucleosides Nucleotides 1999 June-July; 18(6-7):1645-6.
• Hotoda H, Koizumi M, Ohmine T, Furukawa H, Nishigaki T, Abe K, Kosaka T, Tsutsumi S, Sone J, Kaneko M: Biologically active oligodeoxyribonucleotides. 10: anti-HIV-1 activity and stability of modified hexanucleotides containing glycerol-skeleton. Nucleosides Nucleotides 1998 January-March; 17(1-3):243-52.
• JP10113194; Filed 19971022, Published 19980506. Donnelly, J J; Dwarki, V J; Liu, M A; Montgomery, D L; Parker, S; Shiver, J W; Ulmer J B: Nucleic Acid Preparation.
• Kang S H, Sinhababu A K, Cho M J: Synthesis and biological activity of bis(pivaloyloxymethyl) ester of 2′-azido-2′-deoxyuridine 5′-monophosphate. Nucleosides Nucleotides 1998 June; 17(6):1089-98.
• Krayevsky A, Arzumanov A, Shirokova E, Dyatkina N, Victorova L, Jasko M, Alexandrova L: dNTP modified at triphosphate residues: substrate properties towards DNA polymerases and stability in human serum. Nucleosides Nucleotides 1998 January-March; 17(1-3):681-93.
• Krayevsky A A, Dyatkina N B, Semizarov D G, Victorova L S, Shirokova E A, Theil F, Von Janta Lipinski M J, Gosselin G, Imbach J L: Reasons and limits of substrate activity of modified L-dNTP in DNA biosynthesis. Nucleosides Nucleotides 1999 April-May;18(4-5): 863-4.
• Kvasyuk E I, Mikhailopulo I A, Suhadolnik R J, Henderson E E, Muto N F, Iacono K T, Homon J, Pfleiderer W: Synthesis and biological activity of 2′,5′-oligoadenylate trimers containing 5′-terminal 5′-amino-5′-deoxy- and 5′-amino-3′,5′-dideoxyadenosine derivatives. Nucleosides Nucleotides 1999 June-July; 18(6-7): 1483-4.
• Liu J, Skradis A, Kolar C, Kolath J, Anderson J, Lawson T, Talmadge J, Gmeiner W H: Increased cytotoxicity and decreased in vivo toxicity of FdUMP[10] relative to 5-FU. Nucleosides Nucleotides 1999 August;18(8): 1789-802.
• Lutz M J, Will D W, Breipohl G, Benner S A, Uhlmann E: Synthesis of a monocharged peptide nucleic acid (PNA) analog and its recognition as substrate by DNA polymerases. Nucleosides Nucleotides 1999 March;18(3): 393-401. Monaco V, van de Wetering K I, Meeuwenoord N J, van den Elst HA, Stuivenberg H R, Visse R, van der Kaaden J C, Moolenaar G F, Verhoeven E E, Goosen N, van der Marel G A, van Boom J H: Synthesis and biological evaluation of modified DNA fragments for the study of nucleotide excision repair in E. coli. Nucleosides Nucleotides 1999 June-July; 18(6-7):1339-41.
• Morozova O V, Kolpashchikov D M, Ivanova T M, Godovikova T S: Synthesis of new photocross-linking 5-C-base-substituted UTP analogs and their application in highly selective affinity labelling of the tick-borne encephalitis virus RNA replicase proteins. Nucleosides Nucleotides 1999 June-July; 18(6-7): 1513-4.
• Nguyen-Ba N, Chan L, Quimpere M, Turcotte N, Lee N, Mitchell H, Bedard J: Design and SAR study of a novel class of nucleotide analogues as potent anti-HCMV agents. Nucleosides Nucleotides 1999 April-May; 18(4-5):821-7.
• Pandolfi D, Rauzi F, Capobianco M L: Evaluation of different types of end-capping modifications on the stability of oligonucleotides toward 3′- and 5′-exonucleases. Nucleosides Nucleotides 1999 September; 18(9): 2051-69.
• Pankiewicz K W, Lesiak-Watanabe K: Novel mycophenolic adenine bis(phosphonate)s as potent anticancer agents and inducers of cells differentiation. Nucleosides Nucleotides 1999 April-May; 18(4-5):927-32.
• Perrin D M, Garestier T, Helene C: Expanding the catalytic repertoire of nucleic acid catalysts: simultaneous incorporation of two modified deoxyribonucleoside triphosphates bearing ammonium and imidazolyl functionalities. Nucleosides Nucleotides 1999 March; 18(3):377-91.
• Pfundheller H M, Koshkin A A, Olsen C E, Wengel J: Evaluation of oligonucleotides containing two novel 2′-O-methyl modified nucleotide monomers: a 3′-C-allyl and a 2′-O,3′-C-linked bicyclic derivative. Nucleosides Nucleotides 1999 September; 18(9):2017-30.
• Ramasamy K S, Stoisavljevic V: Synthesis and biophysical studies of modified oligonucleotides containing acyclic amino alcohol nucleoside analogs. Nucleosides Nucleotides 1999 August;18(8):1845-61.
• Schinazi R F, Lesnikowski Z J: Boron containing oligonucleotides. Nucleosides Nucleotides 1998 January-March; 17(1 -3):635-47.
• Secrist J A 3rd, Parker W B, Allan P W, Bennett L L Jr, Waud W R, Truss J W, Fowler A T, Montgomery J A, Ealick S E, Wells A H, Gillespie G Y, Gadi V K, Sorscher E J: Gene therapy of cancer: activation of nucleoside prodrugs with E. coli purine nucleoside phosphorylase. Nucleosides Nucleotides 1999 April-May;18(4-5):745-57.
• Shirokova E A, Shipitsin A V, Victorova L S, Dyatkina N B, Goryunova L E, Beabealashvilli R S, Hamilton C J, Roberts S M, Krayevsky A A: Modified nucleoside 5′-triphosphonates as a new type of antiviral agents. Nucleosides Nucleotides 1999 April-May; 18(4-5): 1027-8.
• Srivastava T K, Friedhoff P, Pingoud A, Katti S B: Application of oligonucleoside methylphosphonates in the studies on phosphodiester hydrolysis by Serratia endonuclease. Nucleosides Nucleotides 1999 September; 18(9): 1945-60.
• Stattel J M, Yanachkov I, Wright G E: Synthesis and biocheibical study of N2-(p-n-butylphenyl)-2′-deoxyguanosine 5′-(alpha,beta-imido)triphosphate (BuPdGMPNHPP): a non-substrate inhibitor of B family DNA polymerases. Nucleosides Nucleotides 1998 August; 17(8): 1505-13.
• Terato H, Morita H, Ohyama Y, Ide H: Novel modification of 5-formyluracil by cysteine derivatives in aqueous solution. Nucleosides Nucleotides 1998 January-March; 17(1-3): 131-41.
• Tomikawa A, Seno M, Sato-Kiyotaki K, Ohtsuki C, Hirai T, Yamaguchi T, Kawaguchi T, Yoshida S, Saneyoshi M: Synthetic nucleosides and nucleotides. 40. Selective inhibition of eukaryotic DNA polymerase alpha by 9-(beta-D-arabinofuranosyl)-2-(p-n-butylanilino) adenine 5′-triphosphate (BuAaraATP) and its 2′-up azido analog: synthesis and enzymatic evaluations. Nucleosides Nucleotides 1998 January-March; 17(1-3):487-501.
• U.S. Pat. No. 5,580,859; Filed 19940318, Issued 19961203. Felgner, P L.; Wolff, J A.; Rhodes, G H.; Malone, R W.; Carson, D A.: Delivery of exogenous DNA sequences in a mammal.
• U.S. Pat. No. 5,589,466; Filed 19950126, Issued 19961231. Felgner, P L.; Wolff, J A.; Rhodes, G H.; Malone, R W.; Carson, D A.: Induction of a protective immune response in a mammal by injecting a DNA sequence.
• U.S. Pat. No. 5,641,665; Filed 19941128, Issued 19970624. Hobart, P M.; Margalith, M; Parker, S E.; Khatibi, S: Plasmids suitable for IL-2 expression.
• U.S. Pat. No. 5,693,622; Filed 19950607, Issued 19971202. Wolff, J A. ;Duke, D J.; Felgner, P L.: Expression of exogenous polynucleotide sequences cardiac muscle of a mammal.
• U.S. Pat. No. 5,703,055; Filed 19940126, Issued 19971230. Felgner, P L.; Wolff, J A; Rhodes, G H.; Malone, R W; Carson, D A.: Generation of antibodies through lipid mediated DNA delivery.
• U.S. Pat. No. 5,846,946; Filed 19960614, Issued 19981208. Huebner, R C.; Norman, J A.; Liang, X; Camer, K R.; Barbour, A G.; Luke, C J.: Compositions and methods for administering Borrelia DNA.
• U.S. Pat. No. 5,910,488; Filed 19951201, Issued 19990608. Nabel, G J.; Nabel, E G.; Lew, D; Marquet, M: Plasmids suitable for gene therapy.

Victorova L S, Semizarov D G, Shirokova E A, Alexandrova L A, Arzumanov A A, Jasko M V, Krayevsky A A: Human DNA polymerases and retroviral reverse transcriptases: selectivity in respect to dNTPs modified at triphosphate residues. Nucleosides Nucleotides 1999 April-May; 18(4-5): 1031-2.

• von Janta-Lipinski M, Gaertner K, Lehmann C, Scheer H, Schildt J, Matthes E: Protein and RNA of human telomerase as targets for modified oligonucleotides. Nucleosides Nucleotides 1999 June-July; 18(6-7):1719-20
• WO9011092; Filed 19900321, A1 Published 19901004. Felgner, P L. ;Wolff, J A; Rhodes, G H.; Malone, R W; Carson, D A.: Expression Of Exogenus Polynucleotide Sequences In A Vertebrate.
• WO9314778; Filed 19930121, A1 Published 19930805. Rhodes, G H.; Dwarki, V J.; Felgner, P L; Wang-Felgner, J; Manthorpe, M: Ex Vivo Gene Transfer.
• WO9421797; Filed 19940314, A1 Published 19940929. Donnelly, J J.; Dwarki, V J.; Liu, M A.; Montgomery, D L.; Parker, S E.; Shiver, J W.; Ulmer, J B.: Nucleic Acid Pharmaceuticals.
• WO9633736; Filed 19960426, A1 Published 19961031. Baruch D I; Pasloske B L; Howard, R J: Malaria Peptides and Vaccines.
• WO9735992; Filed 19970317, A1 Published 19971002. Hobart, P M.; Liang, X: Tetracycline Inducible/Repressible Systems.
• WO9926663; Filed 19981120, A2 Published 19990603. Horton, H; Parker, S; Manthorpe, M; Felgner, P: Treatment Of Cancer Using Cytokine-Expressing Polynucleotides And Compositions Therefor.
• WO9941368; Filed 19990210, A2 Published 19990819. Punnonen J, Stemmier W P, Whalen R G; Howard, R: Optimization of Immunomodulatory Properties of Genetic Vaccines.
• WO9941369; Filed 19990210, A2 Published 19990819. Punnonen J, Stemmer W P, Whalen R G; Howard, R: Genetic Vaccine Vector Engineering.
• WO9941383; Filed 19990210, A1 Published 19990819. Punnonen J, Bass, S H, Whalen, R G, Howard, R, Stemmer, W P: Antigen Library Immunization.
• WO9941402; Filed 19990210, A2 Published 19990819. Punnonen J, Stemmer, W P, Howard R, Patten P A: Targeting of Genetic Vaccine Vectors.
• Structure-Activity considerations are well-known in the art, and the following illustrative but non-limiting examples of references (incorporated by reference in their entirety) are provided:
• Dunbrack R L Jr, Gerloff D L, Bower M, Chen X, Lichtarge O, Cohen F E: Meeting review: the Second meeting on the Critical Assessment of Techniques for Protein Structure Prediction (CASP2), Asilomar, Calif., Dec. 13-16, 1996. Fold Des 2(2): R27-42, (1997).
• Fischer D, Eisenberg D: Protein fold recognition using sequence-derived predictions. Protein Sci 5(5): 947-55, (May 1996).
• Havel T F: An evaluation of computational strategies for use in the determination of protein structure from distance constraints obtained by nuclear magnetic resonance. Prog Biophys Mol Biol 56(1): 43-78, (1991).
• Lichtarge O, Yamamoto K R, Cohen F E: Identification of finctional surfaces of the zinc binding domains of intracellular receptors. J Mol Biol 274(3): 325-37, (Dec. 5, 1997).
• Matsumoto R, Sali A, Ghildyal N, Karplus M, Stevens R L: Packaging of proteases and proteoglycans in the granules of mast cells and other hematopoietic cells. A cluster of histidines on mouse mast cell protease 7 regulates its binding to heparin serglycin proteoglycans. J Biol Chem 270(33): 19524-31, (Aug. 18, 1995).
• Sali A: Comparative protein modeling by satisfaction of spatial restraints. Mol Med Today 1(6): 270-7, (September 1995).
• Sali A, Matsumoto R, McNeil H P, Karplus M, Stevens: R L Three-dimensional models of four mouse mast cell chymases. Identification of proteoglycan binding regions and protease-specific antigenic epitopes. J Biol Chem 268(12):9023-34, Apr. 25, 1993.
• Sali A: Modeling mutations and homologous proteins. Curr Opin Biotechnol 6(4): 437-51, (August 1995).
• Sali A, Potterton L, Yuan F, van Vlijmen H, Karplus M: Evaluation of comparative protein modeling by MODELLER. Proteins 23(3): 318-26

Claims

1. A method of producing a progeny library comprised of chimerized but pre-determined polynucleotide sequences each of which is comprised of a pre-determined number of building block sequences that are assembled in non-random order, the method comprising:

(a) generating a plurality of pre-determined nucleic acid building block sequences comprised of sequences delineated by demarcation points selected from aligned progenitor nucleic acid sequences; and

(b) non-stochastically assembling said nucleic acid building block sequences to produce said chimerized but pre-determined polynucleotide sequences, such that a designed overall assembly order is achieved for each of said chimerized but pre-determined polynucleotide sequence.

2. The method of claim 1 where the progenitor nucleic acid sequences comprise sequences derived from an uncultivated organism or an environmental sample.

3. The method of claim 1 where the progenitor nucleic acid sequences are comprised of genomic nucleic acid sequences.

4. The method of claim 1, where the progeny library is comprised of at least 10¹⁰ different pre-determined progeny molecular sequences.

5. The method of claim 1, where the progeny library is comprised of at least 10¹⁵ different pre-determined progeny molecular sequences.

6. The method of any of claims 1-5, where the nucleic acid building block sequences are obtained from polynucleotide sequences that encode enzymes or fragments thereof.

7. The method of any of claims 1-5, where the nucleic acid building block sequences are assembled to produce polynucleotide encoding biochemical pathways from one or more operons or gene clusters of portions thereof.

8. The method of any of claims 1-5, where the nucleic acid building block sequences are obtained from polynucleotide encoding polyketides or fragments thereof.

9. The method of any of claims 1-5, where the nucleic acid building block sequences are obtained from polynucleotide encoding antibodies or antibody fragments or other peptides or polypeptides.

10. The method of any of claims 1-5, where the step of (b) non-stochastically assembling said nucleic acid building blocks is performed to generate a display library comprised of polypeptides or antibodies or peptidomimetic antibodies or antibody variable region sequences suitable for affinity interaction screening.

11. The method of any of claims 1-5, further comprising the step of

(c) screening said progeny library to identify an evolved molecular property.

12. The method of claim 1, where step of (c) is comprised of expression screening to identify an evolved molecular property.

13. A method of producing a progeny library comprised of chimerized but pre-determined polynucleotide sequences each of which is comprised of a pre-determined number of building block sequences that are assembled in non-random order, the method comprising: (a) generating a plurality of pre-determined nucleic acid building block sequences comprised of sequences delineated by demarcation points selected to create nucleic acid building blocks of a pre-determined size from aligned progenitor nucleic acid sequences, wherein each of said plurality of pre-determined nucleic acid building blocks is a double stranded building block with two nucleotide overhangs generated by a method comprising the steps of (i) generating overlapping blunt-ended amplification products; (ii) melting the blunt-ended amplification products to produce single stranded nucleic acids; (iii) annealing the single stranded nucleic acids to produce a population of double stranded nucleic acids; and (iv) selecting for double stranded nucleic acids with two nucleotide overhangs; wherein selecting for double stranded nucleic acids with two nucleotide overhangs comprises degrading other nucleic acids in the population with a 3′ acting nuclease; and (b) non-stochastically assembling said nucleic acid building block sequences to produce said chimerized but pre-determined polynucleotide sequences, such that a designed overall assembly order is achieved for each of said chimerized but pre-determined polynucleotide sequence.

14. The method of claim 13 where the progenitor nucleic acid sequences comprise sequences derived from an uncultivated organism or an environmental sample.

15. The method of claim 13 where the progenitor nucleic acid sequences are comprised of genomic nucleic acid sequences.

16. The method of claim 13, where the progeny library is comprised of at least 10¹⁰ different pre-determined progeny molecular sequences.

17. The method of claim 13, where the progeny library is comprised of at least 10¹⁵ different pre-determined progeny molecular sequences.

18. The method of any of claims 13 to 17, where the nucleic acid building block sequences are obtained from polynucleotide sequences that encode enzymes or fragments thereof.

19. The method of any of claims 13 to 17, where the nucleic acid building block sequences are assembled to produce polynucleotide encoding biochemical pathways from one or more operons or gene clusters of portions thereof.

20. The method of any of claims 13 to 17, where the nucleic acid building block sequences are obtained from polynucleotide encoding polyketides or fragments thereof.

21. The method of any of claims 13 to 17, where the nucleic acid building block sequences are obtained from polynucleotide encoding antibodies or antibody fragments or other peptides or polypeptides.

22. The method of any of claims 13 to 17, where the step of (b) non-stochastically assembling said nucleic acid building blocks is performed to generate a display library comprised of polypeptides or antibodies or peptidomimetic antibodies or antibody variable region sequences suitable for affinity interaction screening.

23. The method of any of claims 13 to 17, further comprising the step of (c) screening said progeny library to identify an evolved molecular property.

24. The method of claim 13, where step of (c) is comprised of expression screening to identify an evolved molecular property.

25. The method of claim 13, wherein the 3′ acting nuclease is exonuclease III.