Dengue tetravalent vaccine containing a common 30 nucleotide deletion in the 3′-UTR of dengue types 1,2,3, and 4, or antigenic chimeric dengue viruses 1,2,3, and 4

Abstract

The invention relates to a dengue virus tetravalent vaccine containing a common 30 nucleotide deletion (Δ30) in the 3′-untranslated region of the genome of dengue virus serotypes 1, 2, 3, and 4, or antigenic chimeric dengue viruses of serotypes 1, 2, 3, and 4.

Description

RELATED APPLICATIONS

This application is a continuation and claims the benefit of priority of International Application No. PCT/US03/13279 filed Apr. 25, 2003, designating the United States of America and published in English on Nov. 13, 2003, as WO 03/092592, which claims the benefit of priority of U.S. Provisional Application No. 60/377,860 filed May 3, 2002 and U.S. Provisional Application No. 60/436,500 filed Dec. 23, 2002, all of which are hereby expressly incorporated by reference in their entireties.

FIELD OF THE INVENTION

The invention relates to a dengue virus tetravalent vaccine containing a common 30 nucleotide deletion (Δ30) in the 3′-untranslated region of the genome of dengue virus serotypes 1, 2, 3, and 4, or antigenic chimeric dengue viruses of serotypes 1, 2, 3, and 4.

BACKGROUND OF THE INVENTION

Dengue virus is a positive-sense RNA virus belonging to the Flavivirus genus of the family Flaviviridae. Dengue virus is widely distributed throughout the tropical and semitropical regions of the world and is transmitted to humans by mosquito vectors. Dengue virus is a leading cause of hospitalization and death in children in at least eight tropical Asian countries (WHO 1997 Dengue Haemorrhagic Fever: Diagnosis, Treatment, Prevention, and Control 2nd Edition, Geneva). There are four serotypes of dengue virus (DEN1, DEN2, DEN3, and DEN4) that annually cause an estimated 50-100 million cases of dengue fever and 500,000 cases of the more severe form of dengue virus infection known as dengue hemorrhagic fever/dengue shock syndrome (DHF/DSS) (Gubler, D. J. and Meltzer, M. 1999 Adv Virus Res 53:35-70). This latter disease is seen predominantly in children and adults experiencing a second dengue virus infection with a serotype different than that of their first dengue virus infection and in primary infection of infants who still have circulating dengue-specific maternal antibody (Burke, D. S. et al. 1988 Am J Trop Med Hyg 38:172-180; Halstead, S. B. et al. 1969 Am J Trop Med Hyg 18:997-1021; Thein, S. et al. 1997 Am J Trop Med Hyg 56:566-575). A dengue vaccine is needed to lessen disease burden caused by dengue virus, but none is licensed. Because of the association of more severe disease with secondary dengue virus infection, a successful vaccine must simultaneously induce immunity to all four serotypes. Immunity is primarily mediated by neutralizing antibody directed against the envelope (E) glycoprotein, a virion structural protein. Infection with one serotype induces long-lived homotypic immunity and a short-lived heterotypic immunity (Sabin, A. 1955 Am J Trop Med Hyg 4:198-207). Therefore, the goal of immunization is to induce a long-lived neutralizing antibody response against DEN1, DEN2, DEN3, and DEN4, which can best be achieved economically using live attenuated virus vaccines. This is a reasonable goal since a live attenuated vaccine has already been developed for the related yellow fever virus, another mosquito-borne flavivirus present in tropical and semitropical regions of the world (Monath, T. P. and Heinz, F. X. 1996 in: Fields Virology, Fields, D. M et al. eds. Philadelphia: Lippincott-Raven Publishers, pp. 961-1034).

Several live attenuated dengue vaccine candidates have been developed and evaluated in humans and non-human primates. The first live attenuated dengue vaccine candidates were host range mutants developed by serial passage of wild-type dengue viruses in the brains of mice and selection of mutants attenuated for humans (Kimura, R. and Hotta, S. 1944 Jpn J Bacteriol 1:96-99; Sabin, A. B. and Schlesinger, R. W. 1945 Science 101:640; Wisserman, C. L. et al. 1963 Am J Trop Med Hyg 12:620-623). Although these candidate vaccine viruses were immunogenic in humans, their poor growth in cell culture discouraged further development. Additional live attenuated DEN1, DEN2, DEN3, and DEN4 vaccine candidates have been developed by serial passage in non-human tissue culture (Angsubhakorn, S. et al. 1994 Southeast Asian J Trop Med Public Health 25:554-559; Bancroft, W. H. et al. 1981 Infect Immun 31:698-703; Bhamarapravati, N. et al. 1987 Bull World Health Organ 65:189-195; Eckels, K. H. et al. 1984 Am J Trop Med Hyg 33:684-698; Hoke, C. H. Jr. et al. 1990 Am J Trop Med Hyg 43:219-226; Kanesa-Thasan, N. et al. 2001 Vaccine 19:3179-3188) or by chemical mutagenesis (McKee, K. T. et al. 1987 Am J Trop Med Hyg 36:435-442). It has proven very difficult to achieve a satisfactory balance between attenuation and immunogenicity for each of the four serotypes of dengue virus using these approaches and to formulate a tetravalent vaccine that is safe and satisfactorily immunogenic against each of the four dengue viruses (Kanesa-Thasan, N. et al. 2001 Vaccine 19:3179-3188; Bhamarapravati, N. and Sutee, Y. 2000 Vaccine 18:44-47).

Two major advances using recombinant DNA technology have recently made it possible to develop additional promising live attenuated dengue virus vaccine candidates. First, methods have been developed to recover infectious dengue virus from cells transfected with RNA transcripts derived from a full-length cDNA clone of the dengue virus genome, thus making it possible to derive infectious viruses bearing attenuating mutations that have been introduced into the cDNA clone by site-directed mutagenesis (Lai, C. J. et al. 1991 PNAS USA 88:5139-5143). Second, it is possible to produce antigenic chimeric viruses in which the structural protein coding region of the full-length cDNA clone of dengue virus is replaced by that of a different dengue virus serotype or from a more divergent flavivirus (Bray, M. and Lai, C. J. 1991 PNAS USA 88:10342-10346; Chen, W. et al. 1995 J Virol 69:5186-5190; Huang, C. Y. et al. 2000 J Virol 74:3020-3028; Pletnev, A. G. and Men, R. 1998 PNAS USA 95:1746-1751). These techniques have been used to construct intertypic chimeric dengue viruses that have been shown to be effective in protecting monkeys against homologous dengue virus challenge (Bray, M. et al. 1996 J Virol 70:4162-4166). A similar strategy is also being used to develop attenuated antigenic chimeric dengue virus vaccines based on the attenuation of the yellow fever vaccine virus or the attenuation of the cell-culture passaged dengue viruses (Monath, T. P. et al. 1999 Vaccine 17:1869-1882; Huang, C. Y. et al. 2000 J Virol 74:3020-3028).

Another study examined the level of attenuation for humans of a DEN4 mutant bearing a 30-nucleotide deletion (Δ30) introduced into its 3′-untranslated region by site-directed mutagenesis and that was found previously to be attenuated for rhesus monkeys (Men, R. et al. 1996 J Virol 70:3930-3937). Additional studies were carried out to examine whether this Δ30 mutation present in the DEN4 vaccine candidate was the major determinant of its attenuation for monkeys. It was found that the Δ30 mutation was indeed the major determinant of attenuation for monkeys, and that it specified a satisfactory balance between attenuation and immunogenicity for humans (Durbin, A. P. et al. 2001 Am J Trop Med Hyg 65:405-13).

SUMMARY OF THE INVENTION

The previously identified Δ30 attenuating mutation, created in dengue virus type 4 (DEN4) by the removal of 30 nucleotides from the 3′-UTR, is also capable of attenuating a wild-type strain of dengue virus type 1 (DEN1). Removal of 30 nucleotides from the DEN1 3′-UTR in a highly conserved region homologous to the DEN4 region encompassing the Δ30 mutation yielded a recombinant virus attenuated in rhesus monkeys to a level similar to recombinant virus DEN4Δ30. This establishes the transportability of the Δ30 mutation and its attenuation phenotype to a dengue virus type other than DEN4. The effective transferability of the Δ30 mutation, described by this work, establishes the usefulness of the Δ30 mutation to attenuate and improve the safety of commercializable dengue virus vaccines of any serotype. We envision a tetravalent dengue virus vaccine containing dengue virus types 1, 2, 3, and 4 each attenuated by the Δ30 mutation. We also envision a tetravalent dengue virus vaccine containing recombinant antigenic chimeric viruses in which the structural genes of dengue virus types 1, 2, and 3 replace those of DEN4Δ30; 1, 2, and 4 replace those of DEN3Δ30; 1, 3, and 4 replace those of DEN2Δ30; and 2, 3, and 4 replace those of DEN1Δ30. In some instances, such chimeric dengue viruses are attenuated not only by the Δ30 mutation, but also by their chimeric nature. The presence of the Δ30 attenuating mutation in each virus component precludes the reversion to a wild-type virus by intertypic recombination. In addition, because of the inherent genetic stability of deletion mutations, the Δ30 mutation represents an excellent alternative for use as a common mutation shared among each component of a tetravalent vaccine.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1. The live attenuated tetravalent dengue virus vaccine contains dengue viruses representing each of the 4 serotypes, with each serotype containing its full set of unaltered wild-type structural and non-structural proteins and a shared Δ30 attenuating mutation. The relative location of the Δ30 mutation in the 3′ untranslated region (UTR) of each component is indicated by an arrow.

FIG. 2. A. The Δ30 mutation removes 30 contiguous nucleotides (shaded) from the 3′ UTR of DEN4. Nucleotides are numbered from the 3′ terminus. B. Nucleotide sequence alignment of the TL2 region of DEN1, DEN2, DEN3, and DEN4 and their Δ30 derivatives. Also shown is the corresponding region for each of the four DEN serotypes. Upper case letters indicate sequence homology among all 4 serotypes, underlining indicates nucleotide pairing to form the stem structure. C. Predicted secondary structure of the TL2 region of each DEN serotype. Nucleotides that are removed by the Δ30 mutation are boxed (DEN1—between nts 10562-10591, DEN2 Tonga/74—between nts 10541-10570, DEN3 Sleman/78—between nts 10535-10565, and DEN4—between nts 10478-10507).

FIG. 3. Viremia levels in rhesus monkeys inoculated with rDEN4 vaccine candidates bearing 5-FU derived mutations. Groups of four or two (rDEN4 and rDEN4Δ30) monkeys were inoculated with 5.0 log₁₀PFU virus subcutaneously. Serum was collected daily and virus titers were determined by plaque assay in Vero cells. The limit of virus detection was 0.7 log₁₀PFU/ml. Mean virus titers are indicated for each group.

FIG. 4. Viremia levels in rhesus monkeys inoculated with rDEN4 vaccine candidates bearing pairs of charge-to-alanine mutations in NS5. Groups of four or two (rDEN4 and rDEN4Δ30) monkeys were inoculated with 5.0 log₁₀PFU virus subcutaneously. Serum was collected daily and virus titers were determined by plaque assay in Vero cells. The limit of virus detection was 1.0 log₁₀PFU/ml. Mean virus titers are indicated for each group. Viremia was not detected in any monkey after day 4.

FIG. 5. The Δ30 mutation attenuates both DEN1 and DEN4 for rhesus monkeys. Groups of 4 monkeys were immunized subcutaneously with 5.0 log₁₀PFU of the indicated virus. Serum was collected each day following immunization and virus titers were determined and are shown as mean log₁₀PFU/ml.

FIG. 6. A. Diagram of the p2 (Tonga/74) full-length cDNA plasmid. Regions subcloned are indicated above the plasmid. Numbering begins at the 5′ end of the viral sequence. B. The Δ30 mutation removes the indicated 30 nucleotides from the 3′ UTR sequence to create p2Δ30.

FIG. 7. Viremia levels in rhesus monkeys inoculated with DEN2 (Tonga/74), rDEN2, and rDEN2Δ30 vaccine candidate. Groups of four monkeys were inoculated with 5.0 log₁₀PFU virus subcutaneously. Serum was collected daily and virus titers were determined by plaque assay in Vero cells. The limit of virus detection was 0.7 log₁₀PFU/ml. Mean virus titers are indicated for each group. Viremia was not detected in any monkey after day 8.

FIG. 8. A. Diagram of the p3 (Sleman/78) full-length cDNA plasmid. Regions subcloned are indicated above the plasmid. Numbering begins at the 5′ end of the viral sequence. The sequence and insertion location of the SpeI linker is shown. B. The Δ30 mutation removes the indicated 31 nucleotides from the 3′ UTR sequence to create p3Δ30.

FIG. 9. A. Recombinant chimeric dengue viruses were constructed by introducing either the CME or the ME regions of DEN2 (Tonga/74) into the DEN4 genetic background. The relative location of the Δ30 mutation in the 3′ UTR is indicated by an arrow and intertypic junctions 1, 2, and 3 are indicated. B. Nucleotide and amino acid sequence of the intertypic junction regions. Restriction enzyme recognition sites used in assembly of each chimeric cDNA are indicated.

FIG. 10. Growth kinetics in Vero cells of chimeric rDEN2/4Δ30 viruses encoding single or combined Vero cell adaptation mutations. Vero cells were infected with the indicated viruses at an MOI of 0.01. At the indicated time points post-infection, 1 ml samples of tissue culture medium were removed, clarified by centrifugation, and frozen at −80° C. The level of virus replication was assayed by plaque titration in C6/36 cells. Lower limit of detection was 0.7 log₁₀PFU/ml. Replication levels on day 4 post-infection are indicated by the dashed line.

FIG. 11. A. Recombinant chimeric dengue viruses were constructed by introducing either the CME or the ME regions of DEN3 (Sleman/78) into the DEN4 genetic background. The relative location of the Δ30 mutation in the 3′ UTR is indicated by an arrow and intertypic junctions 1, 2, and 3 are indicated. Restriction enzyme recognition sites used in assembly of each chimeric cDNA are indicated. B. Nucleotide and amino acid sequence of the intertypic junction regions. Restriction enzyme recognition sites used in assembly of each chimeric cDNA are indicated.

FIG. 12. A. Recombinant chimeric dengue viruses were constructed by introducing either the CME or the ME regions of DEN1 (Puerto Rico/94) into the DEN4 genetic background. The relative location of the Δ30 mutation in the 3′ UTR is indicated by an arrow and intertypic junctions 1, 2, and 3 are indicated. Restriction enzyme recognition sites used in assembly of each chimeric cDNA are indicated. B. Nucleotide and amino acid sequence of the intertypic junction regions. Restriction enzyme recognition sites used in assembly of each chimeric cDNA are indicated.

Brief Description of the Sequences
         GenBank Accession
Serotype No. or description

DEN1     U88535
DEN2     Tonga/74
DEN3     Sleman/78
DEN4     AF326825

Brief Description of the SEQ ID NOs
	Figure,
	Table, or	SEQ
Identification	Appendix	ID NO.
TL2 region of DEN1	FIG. 2C	1
TL2 region of DEN2	FIG. 2C	2
TL2 region of DEN3	FIG. 2C	3
TL2 region of DEN4	FIG. 2C	4
TL2 region of DEN1Δ30	FIG. 2B	5
TL2 region of DEN2Δ30	FIG. 2B	6
TL2 region of DEN3Δ30	FIG. 2B	7
TL2 region of DEN4Δ30	FIG. 2B	8
TL2 region of p2	FIG. 6B	9
TL2 region of p2Δ30	FIG. 6B	10
TL2 region of p3	FIG. 8B	11
TL2 region of p3Δ30	FIG. 8B	12
Spel linker in p3	FIG. 8A	13
rDEN2/4 junction 1	FIG. 9B	14-nt, 15-aa
rDEN2/4 junction 2	FIG. 9B	16-nt, 17-aa
rDEN2/4 junction 3	FIG. 9B	18-nt, 19-aa
rDEN3/4 junction 1	FIG. 11B	20-nt, 21-aa
rDEN3/4 junction 2	FIG. 11B	22-nt, 23-aa
rDEN3/4 junction 3	FIG. 11B	24-nt, 25-aa
rDEN1/4 junction 1	FIG. 12B	26-nt, 27-aa
rDEN1/4 junction 2	FIG. 12B	28-nt, 29-aa
rDEN1/4 junction 3	FIG. 12B	30-nt, 31-aa
D4 selected NS4B region	Table 15	32-nt, 33-aa
D1 selected NS4B region	Table 15	34-nt, 35-aa
D2 selected NS4B region	Table 15	36-nt, 37-aa
D3 selected NS4B region	Table 15	38-nt, 39-aa
CCACGGGCGCCGT	Table 26	40
AAGGCCTGGA	Table 26	41
TATCCCCGGGAC	Table 26	42
AGAGCTCTCTC	Table 26	43
GAATCTCCACCCGGA	Table 26	44
CTGTCGAATC	Table 26	45
DEN2 (Tonga/74)	Appendix 1	46-nt, 47-aa
cDNA plasmid p2
DEN3 (Sleman/78)	Appendix 2	48-nt, 49-aa
cDNA plasmid p3
DEN1 (Puerto Rico/94) CME	Appendix 3	50-nt, 51-aa
chimeric region
DEN1 (Puerto Rico/94) ME	Appendix 4	52-nt, 53-aa
chimeric region

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT

Introduction

A molecular approach is herewith used to develop a genetically stable live attenuated tetravalent dengue virus vaccine. Each component of the tetravalent vaccine, namely, DEN1, DEN2, DEN3, and DEN4, must be attenuated, genetically stable, and immunogenic. A tetravalent vaccine is needed to ensure simultaneous protection against each of the four dengue viruses, thereby precluding the possibility of developing the more serious illnesses dengue hemorrhagic fever/dengue shock syndrome (DHF/DSS), which occur in humans during secondary infection with a heterotypic wild-type dengue virus. Since dengue viruses can undergo genetic recombination in nature (Worobey, M. et al. 1999 PNAS USA 96:7352-7), the tetravalent vaccine should be genetically incapable of undergoing a recombination event between its four virus components that could lead to the generation of viruses lacking attenuating mutations. Previous approaches to develop a tetravalent dengue virus vaccine have been based on independently deriving each of the four virus components through separate mutagenic procedures, such as passage in tissue culture cells derived from a heterologous host. This strategy has yielded attenuated vaccine candidates (Bhamarapravati, N. and Sutee, Y. 2000 Vaccine 18:44-7). However, it is possible that gene exchanges among the four components of these independently derived tetravalent vaccines could occur in vaccinees, possibly creating a virulent recombinant virus. Virulent polioviruses derived from recombination have been generated in vaccinees following administration of a trivalent poliovirus vaccine (Guillot, S. et al. 2000 J Virol 74:8434-43).

The present invention describes: (1) improvements to the previously described rDEN4Δ30 vaccine candidate, 2) attenuated rDEN1Δ30, rDEN2Δ30, and rDEN3Δ30 recombinant viruses containing a 30 nucleotide deletion (Δ30) in a section of the 3′ untranslated region (UTR) that is homologous to that in the rDEN4Δ30 recombinant virus, (3) a method to generate a tetravalent dengue virus vaccine composed of rDEN1Δ30, rDEN2Δ30, rDEN3Δ30, and rDEN4Δ30, 4) attenuated antigenic chimeric viruses, rDEN1/4Δ30, rDEN2/4Δ30, and rDEN3/4Δ30, for which the CME, ME, or E gene regions of rDEN4Δ30 have been replaced with those derived from DEN1, DEN2, or DEN3; alternatively rDEN1/3Δ30, rDEN2/3Δ30, and rDEN4/3Δ30 for which CME, ME, or E gene regions of rDEN3Δ30 have been replaced with those derived from DEN1, 2, or 4; alternatively rDEN1/2Δ30, rDEN3/2Δ30, and rDEN4/2Δ30 for which CME, ME, or E gene regions of rDEN2Δ30 have been replaced with those derived from DEN1, 3, or, 4; and alternatively rDEN2/1Δ30, rDEN3/1Δ30, and rDEN4/1Δ30 for which CME, ME, or E gene regions of rDEN1Δ30 have been replaced with those derived from DEN2, 3, or 4, and 5) a method to generate a tetravalent dengue virus vaccine composed of rDEN1/4Δ30, rDEN2/4Δ30, rDEN3/4Δ30, and rDEN4Δ30, alternatively rDEN1/3Δ30, rDEN2/3Δ30, rDEN4/3Δ30, and rDEN3Δ30, alternatively rDEN1/2Δ30, rDEN3/2Δ30, rDEN4/2Δ30, and rDEN2Δ30, and alternatively rDEN2/1Δ30, rDEN3/1Δ30, rDEN4/1Δ30, and rDEN1Δ30. These tetravalent vaccines are unique since they contain a common shared attenuating mutation which eliminates the possibility of generating a virulent wild-type virus in a vaccinee since each component of the vaccine possesses the same Δ30 attenuating deletion mutation. In addition, the rDEN1Δ30, rDEN2Δ30, rDEN3Δ30, rDEN4Δ30 tetravalent vaccine is the first to combine the stability of the Δ30 mutation with broad antigenicity. Since the Δ30 deletion mutation is in the 3′ UTR of each virus, all of the proteins of the four component viruses are available to induce a protective immune response. Thus, the method provides a mechanism of attenuation that maintains each of the proteins of DEN1, DEN2, DEN3, and DEN4 viruses in a state that preserves the full capability of each of the proteins of the four viruses to induce humoral and cellular immune responses against all of the structural and non-structural proteins present in each dengue virus serotype.

As previously described, the DEN4 recombinant virus, rDEN4Δ30 (previously referred to as 2AΔ30), was engineered to contain a 30 nucleotide deletion in the 3′UTR of the viral genome (Durbin, A. P. et al. 2001 Am J Trop Med Hyg 65:405-13; Men, R. et al. 1996 J Virol 70:3930-7). Evaluation in rhesus monkeys showed the virus to be significantly attenuated relative to wild-type parental virus, yet highly immunogenic and completely protective. Also, a phase I clinical trial with adult human volunteers showed the rDEN4Δ30 recombinant virus to be safe and satisfactorily immunogenic (Durbin, A. P. et al. 2001 Am J Trop Med Hyg 65:405-13). To develop a tetravalent vaccine bearing a shared attenuating mutation in a untranslated region, we selected the Δ30 mutation to attenuate wild-type dengue viruses of serotypes 1, 2, and 3 since it attenuated wild-type DEN4 virus for rhesus monkeys and was safe in humans (FIG. 1).

The Δ30 mutation was first described and characterized in the DEN4 virus (Men, R. et al. 1996 J Virol 70:3930-7). In DEN4, the mutation consists of the removal of 30 contiguous nucleotides comprising nucleotides 10478-10507 of the 3′ UTR (FIG. 2A) which form a putative stem-loop structure referred to as TL2 (Proutski, V. et al. 1997 Nucleic Acids Res 25:1194-202). Among the flaviviruses, large portions of the UTR form highly conserved secondary structures (Hahn, C. S. et al. 1987 J Mol Biol 198:33-41; Proutski, V. et al. 1997 Nucleic Acids Res 25:1194-202). Although the individual nucleotides are not necessarily conserved in these regions, appropriate base pairing preserves the stem-loop structure in each serotype, a fact that is not readily apparent when only considering the primary sequence (FIG. 2B, C).

Immunogenic Dengue Chimeras and Methods for their Preparation

Immunogenic dengue chimeras and methods for preparing the dengue chimeras are provided herein. The immunogenic dengue chimeras are useful, alone or in combination, in a pharmaceutically acceptable carrier as immunogenic compositions to minimize, inhibit, or immunize individuals and animals against infection by dengue virus.

Chimeras of the present invention comprise nucleotide sequences encoding the immunogenicity of a dengue virus of one serotype and further nucleotide sequences selected from the backbone of a dengue virus of a different serotype. These chimeras can be used to induce an immunogenic response against dengue virus.

In another embodiment, the preferred chimera is a nucleic acid chimera comprising a first nucleotide sequence encoding at least one structural protein from a dengue virus of a first serotype, and a second nucleotide sequence encoding non-structural proteins from a dengue virus of a second serotype different from the first. In another embodiment the dengue virus of the second serotype is DEN4. In another embodiment, the structural protein can be the C protein of a dengue virus of the first serotype, the prM protein of a dengue virus of the first serotype, the E protein of a dengue virus of the first serotype, or any combination thereof.

The term “residue” is used herein to refer to an amino acid (D or L) or an amino acid mimetic that is incorporated into a peptide by an amide bond. As such, the amino acid may be a naturally occurring amino acid or, unless otherwise limited, may encompass known analogs of natural amino acids that function in a manner similar to the naturally occurring amino acids (i.e., amino acid mimetics). Moreover, an amide bond mimetic includes peptide backbone modifications well known to those skilled in the art.

Furthermore, one of skill in the art will recognize that individual substitutions, deletions or additions in the amino acid sequence, or in the nucleotide sequence encoding for the amino acids, which alter, add or delete a single amino acid or a small percentage of amino acids (typically less than 5%, more typically less than 1%) in an encoded sequence are conservatively modified variations, wherein the alterations result in the substitution of an amino acid with a chemically similar amino acid. Conservative substitution tables providing functionally similar amino acids are well known in the art. The following six groups each contain amino acids that are conservative substitutions for one another:

• • 1) Alanine (A), Serine (S), Threonine (T);
  • 2) Aspartic acid (D), Glutamic acid (E);
  • 3) Asparagine (N), Glutamine (Q);
  • 4) Arginine (R), Lysine (K);
  • 5) Isoleucine (I), Leucine (L), Methionine (M), Valine (V); and
  • 6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W).

As used herein, the terms “virus chimera,” “chimeric virus,” “dengue chimera” and “chimeric dengue virus” means an infectious construct of the invention comprising nucleotide sequences encoding the immunogenicity of a dengue virus of one serotype and further nucleotide sequences derived from the backbone of a dengue virus of a different serotype.

As used herein, “infectious construct” indicates a virus, a viral construct, a viral chimera, a nucleic acid derived from a virus or any portion thereof, which may be used to infect a cell.

As used herein, “nucleic acid chimera” means a construct of the invention comprising nucleic acid comprising nucleotide sequences encoding the immunogenicity of a dengue virus of one serotype and further nucleotide sequences derived from the backbone of a dengue virus of a different serotype. Correspondingly, any chimeric virus or virus chimera of the invention is to be recognized as an example of a nucleic acid chimera.

The structural and nonstructural proteins of the invention are to be understood to include any protein comprising or any gene encoding the sequence of the complete protein, an epitope of the protein, or any fragment comprising, for example, three or more amino acid residues thereof.

Dengue Chimeras

Dengue virus is a mosquito-borne flavivirus pathogen. The dengue virus genome contains a 5′ untranslated region (5′ UTR), followed by a capsid protein (C) encoding region, followed by a premembrane/membrane protein (prM) encoding region, followed by an envelope protein (E) encoding region, followed by the region encoding the nonstructural proteins (NS1-NS2A-NS2B-NS3-NS4A-NS4B-NS5) and finally a 3′ untranslated region (3′ UTR). The viral structural proteins are C, prM and E, and the nonstructural proteins are NS1-NS5. The structural and nonstructural proteins are translated as a single polyprotein and processed by cellular and viral proteases.

The dengue chimeras of the invention are constructs formed by fusing structural protein genes from a dengue virus of one serotype, e.g. DEN1, DEN2, DEN3, or DEN4, with non-structural protein genes from a dengue virus of a different serotype, e.g., DEN1, DEN2, DEN3, or DEN4.

The attenuated, immunogenic dengue chimeras provided herein contain one or more of the structural protein genes, or antigenic portions thereof, of the dengue virus of one serotype against which immunogenicity is to be conferred, and the nonstructural protein genes of a dengue virus of a different serotype.

The chimera of the invention contains a dengue virus genome of one serotype as the backbone, in which the structural protein gene(s) encoding C, prM, or E protein(s) of the dengue genome, or combinations thereof, are replaced with the corresponding structural protein gene(s) from a dengue virus of a different serotype that is to be protected against. The resulting viral chimera has the properties, by virtue of being chimerized with a dengue virus of another serotype, of attenuation and is therefore reduced in virulence, but expresses antigenic epitopes of the structural gene products and is therefore immunogenic.

The genome of any dengue virus can be used as the backbone in the attenuated chimeras described herein. The backbone can contain mutations that contribute to the attenuation phenotype of the dengue virus or that facilitate replication in the cell substrate used for manufacture, e.g., Vero cells. The mutations can be in the nucleotide sequence encoding non-structural proteins, the 5′ untranslated region or the 3′ untranslated region. The backbone can also contain further mutations to maintain the stability of the attenuation phenotype and to reduce the possibility that the attenuated virus or chimera might revert back to the virulent wild-type virus. For example, a first mutation in the 3′ untranslated region and a second mutation in the 5′ untranslated region will provide additional attenuation phenotype stability, if desired. In particular, a mutation that is a deletion of 30 nts from the 3′ untranslated region of the DEN4 genome between nts 10478-10507 results in attenuation of the DEN4 virus (Men et al. 1996 J. Virology 70:3930-3933; Durbin et al. 2001 Am J Trop Med 65:405-413, 2001). Therefore, the genome of any dengue type 4 virus containing such a mutation at this locus can be used as the backbone in the attenuated chimeras described herein. Furthermore, other dengue virus genomes containing an analogous deletion mutation in the 3′ untranslated region of the genomes of other dengue virus serotypes may also be used as the backbone structure of this invention.

Such mutations may be achieved by site-directed mutagenesis using techniques known to those skilled in the art. It will be understood by those skilled in the art that the virulence screening assays, as described herein and as are well known in the art, can be used to distinguish between virulent and attenuated backbone structures.

Construction of Dengue Chimeras

The dengue virus chimeras described herein can be produced by substituting at least one of the structural protein genes of the dengue virus of one serotype against which immunity is desired into a dengue virus genome backbone of a different serotype, using recombinant engineering techniques well known to those skilled in the art, namely, removing a designated dengue virus gene of one serotype and replacing it with the desired corresponding gene of dengue virus of a different serotype. Alternatively, using the sequences provided in GenBank, the nucleic acid molecules encoding the dengue proteins may be synthesized using known nucleic acid synthesis techniques and inserted into an appropriate vector. Attenuated, immunogenic virus is therefore produced using recombinant engineering techniques known to those skilled in the art.

As mentioned above, the gene to be inserted into the backbone encodes a dengue structural protein of one serotype. Preferably the dengue gene of a different serotype to be inserted is a gene encoding a C protein, a prM protein and/or an E protein. The sequence inserted into the dengue virus backbone can encode both the prM and E structural proteins of the other serotype. The sequence inserted into the dengue virus backbone can encode the C, prM and E structural proteins of the other serotype. The dengue virus backbone is the DEN1, DEN2, DEN3, or DEN4 virus genome, or an attenuated dengue virus genome of any of these serotypes, and includes the substituted gene(s) that encode the C, prM and/or E structural protein(s) of a dengue virus of a different serotype, or the substituted gene(s) that encode the prM and/or E structural protein(s) of a dengue virus of a different serotype.

Suitable chimeric viruses or nucleic acid chimeras containing nucleotide sequences encoding structural proteins of dengue virus of any of the serotypes can be evaluated for usefulness as vaccines by screening them for phenotypic markers of attenuation that indicate reduction in virulence with retention of immunogenicity. Antigenicity and immunogenicity can be evaluated using in vitro or in vivo reactivity with dengue antibodies or immunoreactive serum using routine screening procedures known to those skilled in the art.

Dengue Vaccines

The preferred chimeric viruses and nucleic acid chimeras provide live, attenuated viruses useful as immunogens or vaccines. In a preferred embodiment, the chimeras exhibit high immunogenicity while at the same time not producing dangerous pathogenic or lethal effects.

The chimeric viruses or nucleic acid chimeras of this invention can comprise the structural genes of a dengue virus of one serotype in a wild-type or an attenuated dengue virus backbone of a different serotype. For example, the chimera may express the structural protein genes of a dengue virus of one serotype in either of a dengue virus or an attenuated dengue virus background of a different serotype.

The strategy described herein of using a genetic background that contains nonstructural regions of a dengue virus genome of one serotype, and, by chimerization, the properties of attenuation, to express the structural protein genes of a dengue virus of a different serotype has lead to the development of live, attenuated dengue vaccine candidates that express structural protein genes of desired immunogenicity. Thus, vaccine candidates for control of dengue pathogens can be designed.

Viruses used in the chimeras described herein are typically grown using techniques known in the art. Virus plaque or focus forming unit (FFU) titrations are then performed and plaques or FFU are counted in order to assess the viability, titer and phenotypic characteristics of the virus grown in cell culture. Wild type viruses are mutagenized to derive attenuated candidate starting materials.

Chimeric infectious clones are constructed from various dengue serotypes. The cloning of virus-specific cDNA fragments can also be accomplished, if desired. The cDNA fragments containing the structural protein or nonstructural protein genes are amplified by reverse transcriptase-polymerase chain reaction (RT-PCR) from dengue RNA with various primers. Amplified fragments are cloned into the cleavage sites of other intermediate clones. Intermediate, chimeric dengue clones are then sequenced to verify the sequence of the inserted dengue-specific cDNA.

Full genome-length chimeric plasmids constructed by inserting the structural or nonstructural protein gene region of dengue viruses into vectors are obtainable using recombinant techniques well known to those skilled in the art.

Methods of Administration

The viral chimeras described herein are individually or jointly combined with a pharmaceutically acceptable carrier or vehicle for administration as an immunogen or vaccine to humans or animals. The terms “pharmaceutically acceptable carrier” or “pharmaceutically acceptable vehicle” are used herein to mean any composition or compound including, but not limited to, water or saline, a gel, salve, solvent, diluent, fluid ointment base, liposome, micelle, giant micelle, and the like, which is suitable for use in contact with living animal or human tissue without causing adverse physiological responses, and which does not interact with the other components of the composition in a deleterious manner.

The immunogenic or vaccine formulations may be conveniently presented in viral plaque forming unit (PFU) unit or focus forming unit (FFU) dosage form and prepared by using conventional pharmaceutical techniques. Such techniques include the step of bringing into association the active ingredient and the pharmaceutical carrier(s) or excipient(s). In general, the formulations are prepared by uniformly and intimately bringing into association the active ingredient with liquid carriers. Formulations suitable for parenteral administration include aqueous and non-aqueous sterile injection solutions which may contain anti-oxidants, buffers, bacteriostats and solutes which render the formulation isotonic with the blood of the intended recipient, and aqueous and non-aqueous sterile suspensions which may include suspending agents and thickening agents. The formulations may be presented in unit-dose or multi-dose containers, for example, sealed ampoules and vials, and may be stored in a freeze-dried (lyophilized) condition requiring only the addition of the sterile liquid carrier, for example, water for injections, immediately prior to use. Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules and tablets commonly used by one of ordinary skill in the art.

Preferred unit dosage formulations are those containing a dose or unit, or an appropriate fraction thereof, of the administered ingredient. It should be understood that in addition to the ingredients particularly mentioned above, the formulations of the present invention may include other agents commonly used by one of ordinary skill in the art.

The immunogenic or vaccine composition may be administered through different routes, such as oral or parenteral, including, but not limited to, buccal and sublingual, rectal, aerosol, nasal, intramuscular, subcutaneous, intradermal, and topical. The composition may be administered in different forms, including, but not limited to, solutions, emulsions and suspensions, microspheres, particles, microparticles, nano-particles and liposomes. It is expected that from about 1 to about 5 doses may be required per immunization schedule. Initial doses may range from about 100 to about 100,000 PFU or FFU, with a preferred dosage range of about 500 to about 20,000 PFU or FFU, a more preferred dosage range of from about 1000 to about 12,000 PFU or FFU and a most preferred dosage range of about 1000 to about 4000 PFU or FFU. Booster injections may range in dosage from about 100 to about 20,000 PFU or FFU, with a preferred dosage range of about 500 to about 15,000, a more preferred dosage range of about 500 to about 10,000 PFU or FFU, and a most preferred dosage range of about 1000 to about 5000 PFU or FFU. For example, the volume of administration will vary depending on the route of administration. Intramuscular injections may range in volume from about 0.1 ml to 1.0 ml.

The composition may be stored at temperatures of from about −100° C. to about 4° C. The composition may also be stored in a lyophilized state at different temperatures including room temperature. The composition may be sterilized through conventional means known to one of ordinary skill in the art. Such means include, but are not limited to, filtration. The composition may also be combined with bacteriostatic agents to inhibit bacterial growth.

Administration Schedule

The immunogenic or vaccine composition described herein may be administered to humans, especially individuals travelling to regions where dengue virus infection is present, and also to inhabitants of those regions. The optimal time for administration of the composition is about one to three months before the initial exposure to the dengue virus. However, the composition may also be administered after initial infection to ameliorate disease progression, or after initial infection to treat the disease.

Adjuvants

A variety of adjuvants known to one of ordinary skill in the art may be administered in conjunction with the chimeric virus in the immunogen or vaccine composition of this invention. Such adjuvants include, but are not limited to, the following: polymers, co-polymers such as polyoxyethylene-polyoxypropylene copolymers, including block co-polymers, polymer p 1005, Freund's complete adjuvant (for animals), Freund's incomplete adjuvant; sorbitan monooleate, squalene, CRL-8300 adjuvant, alum, QS 21, muramyl dipeptide, CpG oligonucleotide motifs and combinations of CpG oligonucleotide motifs, trehalose, bacterial extracts, including mycobacterial extracts, detoxified endotoxins, membrane lipids, or combinations thereof.

Nucleic Acid Sequences

Nucleic acid sequences of dengue virus of one serotype and dengue virus of a different serotype are useful for designing nucleic acid probes and primers for the detection of dengue virus chimeras in a sample or specimen with high sensitivity and specificity. Probes or primers corresponding to dengue virus can be used to detect the presence of a vaccine virus. The nucleic acid and corresponding amino acid sequences are useful as laboratory tools to study the organisms and diseases and to develop therapies and treatments for the diseases.

Nucleic acid probes and primers selectively hybridize with nucleic acid molecules encoding dengue virus or complementary sequences thereof. By “selective” or “selectively” is meant a sequence which does not hybridize with other nucleic acids to prevent adequate detection of the dengue virus sequence. Therefore, in the design of hybridizing nucleic acids, selectivity will depend upon the other components present in the sample. The hybridizing nucleic acid should have at least 70% complementarity with the segment of the nucleic acid to which it hybridizes. As used herein to describe nucleic acids, the term “selectively hybridizes” excludes the occasional randomly hybridizing nucleic acids, and thus has the same meaning as “specifically hybridizing.” The selectively hybridizing nucleic acid probes and primers of this invention can have at least 70%, 80%, 85%, 90%, 95%, 97%, 98% and 99% complementarity with the segment of the sequence to which it hybridizes, preferably 85% or more.

The present invention also contemplates sequences, probes and primers that selectively hybridize to the encoding nucleic acid or the complementary, or opposite, strand of the nucleic acid. Specific hybridization with nucleic acid can occur with minor modifications or substitutions in the nucleic acid, so long as functional species-species hybridization capability is maintained. By “probe” or “primer” is meant nucleic acid sequences that can be used as probes or primers for selective hybridization with complementary nucleic acid sequences for their detection or amplification, which probes or primers can vary in length from about 5 to 100 nucleotides, or preferably from about 10 to 50 nucleotides, or most preferably about 18-24 nucleotides. Isolated nucleic acids are provided herein that selectively hybridize with the species-specific nucleic acids under stringent conditions and should have at least five nucleotides complementary to the sequence of interest as described in Molecular Cloning: A Laboratory Manual, 2nd ed., Sambrook, Fritsch and Maniatis, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., 1989.

If used as primers, the composition preferably includes at least two nucleic acid molecules which hybridize to different regions of the target molecule so as to amplify a desired region. Depending on the length of the probe or primer, the target region can range between 70% complementary bases and full complementarity and still hybridize under stringent conditions. For example, for the purpose of detecting the presence of dengue virus, the degree of complementarity between the hybridizing nucleic acid (probe or primer) and the sequence to which it hybridizes is at least enough to distinguish hybridization with a nucleic acid from other organisms.

The nucleic acid sequences encoding dengue virus can be inserted into a vector, such as a plasmid, and recombinantly expressed in a living organism to produce recombinant dengue virus peptide and/or polypeptides.

The nucleic acid sequences of the invention include a diagnostic probe that serves to report the detection of a cDNA amplicon amplified from the viral genomic RNA template by using a reverse-transcription/polymerase chain reaction (RT/PCR), as well as forward and reverse amplimers that are designed to amplify the cDNA amplicon. In certain instances, one of the amplimers is designed to contain a vaccine virus-specific mutation at the 3′-terminal end of the amplimer, which effectively makes the test even more specific for the vaccine strain because extension of the primer at the target site, and consequently amplification, will occur only if the viral RNA template contains that specific mutation.

Automated PCR-based nucleic acid sequence detection systems have been recently developed. TaqMan assay (Applied Biosystems) is widely used. A more recently developed strategy for diagnostic genetic testing makes use of molecular beacons (Tyagi and Kramer, 1996 Nature Biotechnology 14:303-308). Molecular beacon assays employ quencher and reporter dyes that differ from those used in the TaqMan assay. These and other detection systems may used by one skilled in is the art.

EXAMPLE 1

Improvement of Dengue Virus Vaccine Candidate rDEN4Δ30

The safety of recombinant live-attenuated dengue-4 vaccine candidate rDEN4Δ30 was evaluated in twenty human volunteers who received a dose of 5.0 log₁₀plaque forming units (PFU) (Durbin A. P. et al. 2001 Am J Trop Med Hyg 65:405-413). The vaccine candidate was found to be safe, well-tolerated and immunogenic in all of the vaccinees. However, five of the vaccinees experienced a transient elevation in alanine aminotransferase levels, three experienced neutropenia and ten vaccinees developed an asymptomatic macular rash, suggesting that it may be necessary to further attenuate this vaccine candidate.

Currently, a randomized, double-blind, placebo-controlled, dose de-escalation study is being conducted to determine the human infectious dose 50 (HID₅₀) of rDEN4Δ30. Each dose cohort consists of approximately twenty vaccinees and four placebo recipients. To date, complete data for doses of 3.0 log₁₀PFU and 2.0 log₁₀PFU has been collected. rDEN4Δ30 infected 100% of vaccinees when 3.0 log₁₀PFU was administered and 95% of vaccinees when 2.0 log₁₀PFU was administered (Table 1). The vaccine candidate caused no symptomatic illness at either dose (Table 1). One vaccinee who received 3.0 log₁₀PFU experienced a transient elevation in alanine aminotransferase levels and approximately one fourth of the vaccinees experienced neutropenia at both doses (Table 1). Neutropenia was transient and mild. More than half of the vaccinees developed a macular rash at both doses; the occurrence of rash was not correlated with vaccination dose or with viremia (Table 1 and Table 2). Neither peak titer nor onset of viremia differed between the 3.0 log₁₀PFU and 2.0 log₁₀PFU doses, though both measures of viremia were significantly lower for these doses than for a dose of 5.0 log₁₀PFU (Table 3). The vaccine candidate was immunogenic in 95% of vaccinees at both doses and neutralizing antibody did not decline between days 28 and 42 post-vaccination (Table 4). Although the HID₅₀ has not been determined yet, it is clearly less than 2.0 log₁₀PFU. Interestingly, decreases in the dose of vaccine have had no consistent effect on immunogenicity, viremia, benign neutropenia or the occurrence of rash. Thus will not necessarily be possible to further attenuate rDEN4Δ30 by decreasing the dose of virus administered, and other approaches must be developed.

TABLE 1
rDEN4Δ30 clinical summary
		No.	No.	Mean	No. volunteers with:
No. of		in-	with	peak			Neutro-
subjects	Dosea	fected	viremia	titerb	Fever	Rash	peniac	↑ALT
20	5.0	20	14	1.2 (0.2)	1d	10	3	5
20	3.0	20	7	0.4 (0.0)	0	11	5	1e
20	2.0	19	11	0.6 (0.1)	1d	16	4	0
8	0	0	0	0	0	0	0	0
aLog10 pfu
bLog10 pfu/mL
cNeutropenia defined as ANC < 1500/dl
dT Max in volunteer = 100.4° F.
eALT day 0 = 78, ALT max = 91 (day 14)

TABLE 2
Pattern of rash in vaccinees
	No.	No.				Mean
	with	with	Viremia	Viremia	Mean day of	duration
Dosea	viremia	rash	& rash	no rash	onset ± SD	(days ± SD)
5	14/20	10/20	9/20	5/20	8.1 ± 1.3 [A]a	3.6 ± 2.0 [A]
3	7/20	11/20	6/20	1/20	12.2 ± 1.4 [B]	5.0 ± 2.1 [A]
2	11/20	16/20	9/20	2/20	11.2 ± 1.4 [B]	6.9 ± 1.7 [B]
alog10 pfu
bMeans in each column with different letters are significantly different (α = 0.05)

TABLE 3
rDEN4Δ30 viremia summary
			Mean onset of	Mean duration
	# with	Mean peak titer	viremia	of viremia
Dosea	viremia	(log10 pfu/mL)	(day ± SD)	(day ± SD)
5	14	1.2 ± 0.2 [A]	5.8 ± 2.4 [A]b	4.4 ± 2.4 [A]
3	7	0.4 ± 0.0 [B]	9.1 ± 2.5 [B]	1.6 ± 1.0 [B]
2	11	0.6 ± 0.1 [B]	8.7 ± 2.4 [B]	2.6 ± 2.0 [A]
alog10 pfu
bMeans in each column with different letters are significantly different (α = 0.05)

TABLE 4
Immunogenicity of rDEN4Δ30
			Geometric mean
			serum neutralizing	%
No. of	Dose	No.	antibody titer (range)	serocon-
subjects	(log10)	infected	Day 28	Day 42	version
20	5.0	20	567 (72-2455)	399 (45-1230)	100
20	3.0	20	156 (5-2365)	158 (25-1222)	95
20	2.0	19	163 (5-943)	165 (5-764)	95
8	0	0	0	0	0

Two approaches have been taken to further attenuate rDEN4Δ30. This first is the generation and characterization of attenuating point mutations in rDEN4 using 5′ fluorouracil mutagenesis (Blaney, J. E. Jr. et al. 2002 Virology 300: 125-139; Blaney, J. E. Jr. et al. 2001 J. Virol. 75: 9731-9740). This approach has identified a panel of point mutations that confer a range of temperature sensitivity (ts) and small plaque (sp) phenotypes in Vero and HuH-7 cells and attenuation (att) phenotypes in suckling mouse brain and SCID mice engrafted with HuH-7 cells (SCID-HuH-7 mice). In this example, a subset of these mutations has been introduced to rDEN4Δ30 and the phenotypes of the resulting viruses evaluated.

A second approach was to create a series of paired charge-to-alanine mutations in contiguous pairs of charged amino acid residues in the rDEN4 NS5 gene. As demonstrated previously, mutation of 32 individual contiguous pairs of charged amino acid residues in rDEN4 NS5 conferred a range of ts phenotypes in Vero and HuH-7 cells and a range of att phenotypes in suckling mouse brain (Hanley, K. H. et al. 2002 J. Virol. 76 525-531). As demonstrated below, these mutations also confer an att phenotype in SCID-HuH-7 mice. These mutations have been introduced, either as single pairs or sets of two pairs, into rDEN4Δ30 to determine whether they are compatible with the Δ30 mutation and whether they enhance the att phenotypes of rDEN4Δ30.

A panel of rDEN4 viruses bearing individual point mutations have been characterized which possess temperature sensitive and/or small plaque phenotypes in tissue culture and varying levels of attenuated replication in suckling mouse brain when compared to wild type rDEN4 virus (Blaney, J. E. et al. 2002 Virology 300:125-139; Blaney, J. E. et al. 2001 J Virol. 75:9731-9740). Three mutations have been selected to combine with the Δ30 deletion mutation to evaluate their ability to further restrict replication of rDEN4Δ30 in rhesus monkeys. First, the missense mutation in NS3 at nucleotide 4995 (Ser>Pro) which confers temperature sensitivity in Vero and HuH-7 cells and restricted replication in suckling mouse brain was previously combined with the Δ30 mutation (Blaney, J. E. et al. 2001 J Virol. 75:9731-9740). The resulting virus, rDEN4Δ30-4995, was found to be more restricted (1,000-fold) in mouse brain replication than rDEN4Δ30 virus (<5-fold) when compared to wild type rDEN4 virus. Second, a missense mutation at nucleotide 8092 (Glu>Gly) which also confers temperature sensitivity in Vero and HuH-7 cells and 10,000-fold restricted replication in suckling mouse brain was combined with the Δ30 mutation here. Third, a substitution in the 3′ UTR at nucleotide 10634 which confers temperature sensitivity in Vero and HuH-7 cells, small plaque size in HuH-7 cells, and approximately 1,000-fold restricted replication in suckling mouse brain and SCID mice transplanted with HuH-7 cells was combined with the Δ30 mutation here (Blaney, J. E. et al. 2002 Virology 300:125-139).

For the present investigation, subcloned fragments of p4 (Durbin, A. P. et al. 2001 Am J Trop Med Hyg 65:405-13) containing the above mutations were introduced into the p4Δ30 cDNA clone. For transcription and recovery of virus, cDNA was linearized with Acc65I (isoschizomer of KpnI which cleaves leaving only a single 3′ nucleotide) and used as template for transcription by SP6 RNA polymerase as previously described (Blaney, J. E. et al. 2002 Virology 300:125-139). C6/36 mosquito cells were transfected using liposome-mediated transfection and cell culture supernatants were harvested between days five and seven. Recovered virus was terminally diluted twice in Vero cells and passaged two (rDEN4Δ30-4995) or three (rDEN4Δ30-8092 and rDEN4Δ30-10634) times in Vero cells.

The complete genomic sequences of rDEN4Δ30-4995, rDEN4Δ30-8092, and rDEN4Δ30-10634 viruses were determined as previously described (Durbin et al. 2001 Am. J. Trop. Med. Hyg. 65:405-413). As expected, each rDEN4Δ30 virus derivative contained the Δ30 mutation. Unexpectedly, in rDEN4Δ30-4995 virus, the nucleotide changes in the codon containing nucleotide 4995, resulted in a Ser>Leu amino acid change rather than a Ser>Pro change since the p4Δ30-4995 cDNA was designed to introduce the Ser>Pro change (Table 5). The p4Δ30-4995 cDNA clone was indeed found to encode a Ser>Pro change at nucleotide 4995, so it is unclear how the virus population acquired the Ser>Leu mutation. Nevertheless, this virus was evaluated to assess the phenotype specified by this missense mutation. rDEN4Δ30-4995 virus was also found to contain an incidental mutation at nucleotides 4725-6 which resulted in a single amino acid change (Ser>Asp). The rDEN4Δ30-8092 and rDEN4Δ30-10634 viruses contained the appropriate nucleotide substitutions as well as additional incidental mutations in E, NS4B and NS4B, respectively (Table 5).

TABLE 5
Missense and UTR mutations present in rDEN4Δ30 virus
derivatives bearing introduced point mutations.
				Amino	Amino
		Nucleotide	Nucleotide	acid	acid
Virus	Gene	position	substitution	positiona	change
rDEN4Δ30-	NS3	4725	U > G	1542	Ser > Asp
4995	NS3	4726	C > A	1542	Ser > Asp
	NS3	4995b	U > C	1632	Ser > Leu
rDEN4Δ30-	E	1612	A > C	504	Asp > Ala
8092	NS4B	7131	A > G	2344	Thr > Ala
	NS5	8092b	A > G	2664	Glu > Gly
rDEN4Δ30-	NS4B	6969	A > U	2290	Met > Leu
10634	NS4B	7182	G > C	2361	Gly > Arg
	3′ UTR	10634b	U > C	none	none
aAmino acid position in DEN4 polyprotein beginning with the methionine residue of the C protein (nucleotides 102-104) as position 1.
bMutation restricts replication in mouse models of DEN4 infection which were introduced by Kunkel mutagenesis.

Replication of the three modified rDEN4Δ30 viruses were compared to rDEN4Δ30 and wild type rDEN4 virus in the suckling mouse brain model and SCID mice transplanted with HuH-7 cells (SCID-HuH-7 mice). Experiments were conducted as previously described (Blaney, J. E. et al. 2002 Virology 300:125-139; Blaney, J. E. et al. 2001 J Virol. 75:9731-9740). Briefly, for infection of suckling mouse brain, groups of six seven-day-old mice were inoculated intracerebrally with 4.0 log₁₀PFU of virus and the brain of each mouse was removed five days later. Clarified supernatants of 10% brain suspensions were then frozen at −70° C., and the virus titer was determined by plaque assay in Vero cells. For analysis of DEN4 virus replication in SCID-HuH-7 mice, four to six week-old SCID mice were injected intraperitoneally with 10⁷ HuH-7 cells. Five to six weeks after transplantation, mice were infected by direct inoculation into the tumor with 4.0 log₁₀PFU of virus, and serum for virus titration was obtained by tail-nicking on day 7. The virus titer was determined by plaque assay in Vero cells.

Wild type rDEN4 virus replicated to 6.0 log₁₀PFU/g in suckling mouse brain, and rDEN4Δ30 was restricted in replication by 0.7 log₁₀PFU/g, which is similar to previous observations (Table 6) (Blaney, J. E. et al. 2001 J Virol. 75:9731-9740). rDEN4Δ30-4995, rDEN4Δ30-8092, and rDEN4Δ30-10634 viruses were found to have restricted replication in suckling mouse brain when compared to rDEN4 virus of 3.3, 2.8, and 2.4 log₁₀PFU/g, respectively. These results indicate that the additional attenuating mutations serve to further restrict replication of the rDEN4Δ30 virus in mouse brain ranging from 50-fold (rDEN4Δ30-10634) to 400-fold (rDEN4Δ30-4995). In SCID-HuH-7 mice, virus titer of rDEN4Δ30 virus was 0.4 log₁₀PFU/ml lower than rDEN4 virus, which is also similar to previous studies (Blaney, J. E. et al. 2002 Virology 300:125-139). Each modified rDEN4Δ30 virus was found to be further restricted in replication in SCID-HuH-7 mice (Table 6). rDEN4Δ30-4995, rDEN4Δ30-8092, and rDEN4Δ30-10634 viruses had restricted replication in SCID-HuH-7 mice when compared to rDEN4 virus of 2.9, 1.1, and 2.3 log₁₀PFU/g below the level of wild type rDEN4 virus, respectively. Two important observations were made: (1) The 4995, 8092 and 10634 mutations were compatible for viability with the Δ30 mutation, and (2) These three modified rDEN4Δ30 viruses had between a 10 and 1,000-fold reduction in replication in comparison to rDEN4 wild-type virus, which allows viruses with a wide range of attenuation in this model to be further evaluated in monkeys or humans.

TABLE 6
Addition of point mutations in NS3, NS5, or the 3′ UTR to
rDEN4Δ30 virus further attenuates the virus for suckling
mouse brain and SCID-HuH-7 mice.
	Replication in suckling	Replication in
	mouse braina	SCID-HuH-7 micec
		Virus	Mean		Virus	Mean
		titer ± SE	log10-unit		titer ± SE	log10-unit
	No. of	log10 PFU/g	reduction	No. of	log10 PFU/ml	reduction
Virus	mice	brain	from wtb	mice	serum	from wtb
rDEN4	12	6.0 ± 0.1	—	13	6.4 ± 0.2	—
rDEN4Δ30	12	5.3 ± 0.1	0.7	20	6.0 ± 0.2	0.4
rDEN4Δ30-4995	6	2.7 ± 0.4	3.3	5	3.5 ± 0.3	2.9
rDEN4Δ30-8092	6	3.2 ± 0.2	2.8	7	5.0 ± 0.4	1.1
rDEN4Δ30-10634	12	3.6 ± 0.1	2.4	5	4.4 ± 0.3	2.3
aGroups of 6 suckling mice were inoculated i.c. with 104 PFU of virus. Brains were removed 5 days later, homogenized, and titered in Vero cells.
bComparison of mean virus titers of mice inoculated with mutant virus and concurrent rDEN4 wt control.
cGroups of HuH-7-SCID mice were inoculated directly into the tumor with 104 PFU virus. Serum was collected on day 6 and 7 and titered in Vero cells.

Based on the findings in the two mouse models of DEN4 virus infection, each of the rDEN4Δ30-4995, rDEN4Δ30-8092, and rDEN4Δ30-10634 viruses was evaluated in the rhesus macaque model of DEN4 infection which has been previously described (Durbin et al. 2001 Am. J. Trop. Med. Hyg. 65:405-413). Briefly, groups of four (rDEN4Δ30-4995, rDEN4Δ30-8092, and rDEN4Δ30-10634) or two (rDEN4, rDEN4Δ30, mock) monkeys were inoculated with 5.0 log₁₀PFU virus subcutaneously. Monkeys were observed daily and serum was collected on days 0 to 6, 8, 10, and 12, and virus titers were determined by plaque assay in Vero cells for measurement of viremia. On day 28, serum was drawn and the level of neutralizing antibodies was tested by plaque reduction assay in Vero cells as previously described (Durbin et al. 2001 Am. J. Trop. Med. Hyg. 65:405-413).

Viremia was detected beginning on day 1 post-infection and ended by day 4 in all monkeys (Table 7, FIG. 3). Viremia was present in each monkey infected with rDEN4, rDEN4Δ30, or rDEN4Δ30-10634 virus, but only 2 out of 4 monkeys infected with rDEN4Δ30-4995 or rDEN4Δ30-8092 virus had detectable viremia. As expected, infection with rDEN4 virus resulted in the highest mean number of viremic days per monkey (3.0 days) as well as mean peak virus titer (2.2 log₁₀PFU/ml). Monkeys infected with rDEN4Δ30 virus had both a lower mean number of viremic days per monkey (2.0 days) and mean peak virus titer (1.1 log₁₀PFU/ml) compared to rDEN4 virus. Groups of monkeys infected with each of the modified rDEN4Δ30 viruses had a further restricted mean number of viremic days with those inoculated with rDEN4Δ30-8092 virus having the lowest value, 0.5 days, a 4-fold reduction compared to rDEN4Δ30 virus. The mean peak virus titer of monkeys infected with rDEN4Δ30-4995 (0.9 log₁₀PFU/ml) or rDEN4Δ30-8092 (0.7 log₁₀PFU/ml) was also lower than those infected with rDEN4Δ30 virus. However, the mean peak virus titer of monkeys infected with rDEN4Δ30-10634 (1.3 log₁₀PFU/ml) was slightly higher than those infected with rDEN4Δ30 particularly on day 2 (FIG. 3).

TABLE 7
Addition of point mutations to rDEN4Δ30 further attenuates the virus for rhesus monkeys.
					Geometric mean
		No. of	Mean no.		serum neutralizing
		monkeys	of viremic	Mean peak	antibody titer
	No. of	with	days per	virus titer	(reciprocal dilution)
Virusa	monkeys	viremia	monkeyb	(log10 PFU/ml ± SE)	Day 0	Day 28
mock	2	0	0	<0.7	<10	<10
rDEN4	2	2	3.0	2.2 ± 0.6	<10	398
rDEN4Δ30	2	2	2.0	1.1 ± 0.4	<10	181
rDEN4Δ30-4995	4	2	0.8	0.9 ± 0.2	<10	78
rDEN4Δ30-8092	4	2	0.5	0.7 ± 0.1	<10	61
rDEN4Δ30-10634	4	4	1.3	1.3 ± 0.2	<10	107
aGroups of rhesus monkeys were inoculated subcutaneously with 105 PFU of the indicated virus in a 1 ml dose. Serum was collected on days 0 to 6, 8, 10, 12, and 28. Virus titer was determined by plaque assay in Vero cells.
bViremia was not detected in any monkey after day 4.

Serum collected on day 0 and 28 was tested for the level of neutralizing antibodies against rDEN4. No detectable neutralizing antibodies were found against DEN4 on day 0, as expected, since the monkeys were pre-screened to be negative for neutralizing antibodies against flaviviruses (Table 7). On day 28, monkeys infected with rDEN4 had a mean serum neutralizing antibody titer (reciprocal dilution) of 398 which was approximately two-fold higher than monkeys infected with rDEN4Δ30 virus (1:181). This result and the two-fold higher level of viremia in rDEN4 virus-infected monkeys are similar to results obtained previously (Durbin et al. 2001 Am. J. Trop. Med. Hyg. 65:405-413). Monkeys infected with rDEN4Δ30-4995 (1:78), rDEN4Δ30-8092 (1:61), and rDEN4Δ30-10634 (1:107) viruses each had a reduced mean serum neutralizing antibody titer compared to monkeys infected with rDEN4Δ30 virus. The four monkeys which had no detectable viremia did have serum neutralizing antibody titers indicating that they were indeed infected. Despite the slight increase in mean peak virus titer of rDEN4Δ30-10634 virus compared with rDEN4Δ30 virus, rDEN4Δ30-10634 virus had a lower mean serum neutralizing antibody titer compared to monkeys infected with rDEN4Δ30 virus. This and the lower mean number of viremic days per monkey suggests that the 10634 mutation can attenuate the replication of rDEN4Δ30 virus in monkeys.

On day 28 after inoculation, all monkeys were challenged with 5.0 log₁₀PFU wild type rDEN4 virus subcutaneously. Monkeys were observed daily and serum was collected on days 28 to 34, 36, and 38, and virus titers were determined by plaque assay in Vero cells for measurement of viremia after challenge. Twenty eight days after rDEN4 virus challenge, serum was drawn and the level of neutralizing antibodies was tested by plaque reduction assay in Vero cells. Mock-inoculated monkeys had a mean peak virus titer of 2.3 log₁₀PFU/ml after challenge with a mean number of viremic days of 3.5 (Table 8). However, monkeys inoculated with rDEN4, rDEN4Δ30, or each of the modified rDEN4Δ30 viruses had no detectable viremia, indicating that despite the decreased replication and immunogenicity of rDEN4Δ30-4995, rDEN4Δ30-8092, and rDEN4Δ30-10634 viruses, each was sufficiently immunogenic to induce protection against wild type rDEN4. Increases in mean neutralizing antibody titer were minimal (<3-fold) following challenge in all inoculation groups except mock-infected providing further evidence that the monkeys were protected from the challenge.

TABLE 8
rDEN4Δ30 containing additional point mutations protects rhesus monkeys from wt
DEN4 virus challenge
		Mean no. of		Geometric mean serum
		viremic days per		neutralizing antibody
		monkey after	Mean peak	titer (reciprocal
	No. of	rDEN4	virus titer	dilution)
Virusa	monkeys	challenge	(log10 PFU/ml ± SE)	Day 28	Day 56
Mock	2	3.5	2.3 ± 0.1	<10	358
rDEN4	2	0.0	<0.7	398	753
rDEN4Δ30	2	0.0	<0.7	181	202
rDEN4Δ30-4995	4	0.0	<0.7	78	170
rDEN4Δ30-8092	4	0.0	<0.7	61	131
rDEN4Δ30-10634	4	0.0	<0.7	107	177
a28 days after primary inoculation with the indicated viruses, rhesus monkeys were challenged subcutaneously with 105 PFU rDEN4 virus in a 1 ml dose. Serum was collected on days 28 to 34, 36, 38, and 56. Virus titer was determined by plaque assay in Vero cells.

Taken together, these results indicate that the three point mutations, 4995, 8092, and 10634) described above do further attenuate the rDEN4Δ30 vaccine candidate in suckling mouse brain, SCID-HuH-7 mice, and rhesus monkeys. Because of additional incidental mutations (Table 4) present in each modified rDEN4Δ30 virus, the phenotypes cannot be directly attributed to the individual 4995, 8092, and 10634 point mutations. However, the presence of similar mouse-attenuation phenotypes in other rDEN4 viruses bearing one of these three mutations supports the contention that the 4995, 8092, and 10634 point mutations are responsible for the att phenotypes of the modified rDEN4Δ30 viruses. Since rDEN4Δ30-4995, rDEN4Δ30-8092, and rDEN4Δ30-10634 virus demonstrated decreased replication in rhesus monkeys while retaining sufficient immunogenicity to confer protective immunity, these viruses are contemplated as dengue vaccines for humans.

DEN4 viruses carrying both Δ30 and charge-to-alanine mutations were next generated. A subset of seven groups of charge-to-alanine mutations described above were identified that conferred between a 10-fold and 1,000-fold decrease in replication in SCID-HuH-7 mice and whose unmutated sequence was well-conserved across the four dengue serotypes. These mutations were introduced as single pairs and as two sets of pairs to rDEN4Δ30 using conventional cloning techniques. Transcription and recovery of virus and terminal dilution of viruses were conducted as described above. Assay of the level of temperature sensitivity of the charge-cluster-to-alanine mutant viruses in Vero and HuH-7 cells, level of replication in the brain of suckling mice and level of replication in SCID-HuH-7 mice was conducted as described above.

Introduction of one pair of charge-to-alanine mutations to rDEN4 produced recoverable virus in all cases (Table 9). Introduction of two pairs of charge-to-alanine mutations produced recoverable virus in two out of three cases (rDEN4Δ30-436-437-808-809 was not recoverable).

rDEN4Δ30 is not ts in Vero or HuH-7 cells. In contrast, seven of the seven sets of charge-to-alanine mutations used in this example conferred a ts phenotype in HuH-7 cells and five also conferred a ts phenotype in Vero cells. All six viruses carrying both Δ30 and charge-to-alanine mutations showed a ts phenotype in both Vero and HuH-7 cells (Table 9). rDEN4Δ30 is not attenuated in suckling mouse brain, whereas five of the seven sets of charge-to-alanine mutations conferred an att phenotype in suckling mouse brain (Table 10). Four of the viruses carrying both Δ30 and charge-to-alanine mutations were attenuated in suckling mouse brain (Table 10). In one case (rDEN4Δ30-23-24-396-397) combination of two mutations that did not attenuate alone resulted in an attenuated virus. Generally, viruses carrying both Δ30 and charge-to-alanine mutations showed levels of replication in the suckling mouse brain more similar to their charge-to-alanine mutant parent virus than to rDEN4Δ30.

rDEN4Δ30 is attenuated in SCID-HuH-7 mice, as are six of the seven charge-to-alanine mutant viruses used in this example. Viruses carrying both Δ30 and charge-to-alanine mutations tended to show similar or slightly lower levels of replication in SCID-HuH-7 mice compared to their charge-to-alanine mutant parent virus (Table 10). In three cases, viruses carrying both Δ30 and charge-to-alanine mutations showed at least a fivefold greater reduction in SCID-HuH-7 mice than rDEN4Δ30.

The complete genomic sequence of five viruses (rDEN4-200-201, rDEN4Δ30-200-201, rDEN4-436-437 [clone 1], rDEN4Δ30-436-437, and rDEN4-23-24-200-201) that replicated to >10⁵ PFU/ml in Vero cells at 35° C. and that showed a hundredfold or greater reduction in replication in SCID-HuH-7 mice was determined (Table 11). Each of the five contained one or more incidental mutations. In one virus, rDEN4Δ30-436-437, the one additional mutation has been previously associated with Vero cell adaptation (Blaney, J. E. Jr. et al. 2002 Virology 300:125-139). Each of the remaining viruses contained at least one incidental mutation whose phenotypic effect is unknown. Consequently, the phenotypes described cannot be directly attributed to the charge-to-alanine mutations. However, the fact that rDEN4 and rDEN4Δ30 viruses carrying the same charge-to-alanine mutations shared similar phenotypes provides strong support for the ability of charge-to-alanine mutations to enhance the attenuation of rDEN4Δ30. Because rDEN4-436-437 [clone 1] contained 4 incidental mutations, a second clone of this virus was prepared. rDEN4-436-437 [clone2] contained only one incidental mutation (Table 11), and showed the same phenotypes as rDEN4-436-437 in cell culture and SCID-HuH-7 mice. rDEN4-436-437 [clone 2] was used in the rhesus monkey study described below.

TABLE 9
Addition of charge-to-alanine mutations to rDEN4Δ30 confers a ts phenotype in both Vero and HuH-7 cells.
			Mean virus titer (log10 PFU/ml) at indicated temperature (° C.)a
	AA	No. nt	Vero	HuH-7
Virus	changedb	changed	35	37	38	39	Δc	35	37	38	39	Δ
rDEN4	none	0	7.4	7.1	7.7	7.2	0.2	7.7	7.5	7.5	7.4	0.3
rDEN4Δ30	none	30	6.6	6.6	6.5	6.5	0.1	7.4	6.9	7.0	6.4	1.0
rDEN4-23-24	KE	3	6.7	6.6	6.0	6.5	0.2	7.1	7.3	5.6	<1.7	>5.4
rDEN4Δ30-23-24			6.1	5.5	4.9	<1.7	4.4	6.5	5.9	4.7	<1.7	>4.2
rDEN4-200-201	KH	4	5.3	4.8	4.8	4.3	1.0	5.7	5.4	2.7	<1.7	>4.0
rDEN4Δ30-200-201			6.0	5.3	5.6	<1.7	>4.3	5.8	5.0	5.9	<1.7	>4.1
rDEN4-436-437	DK	4	5.2	4.2	3.4	1.9	3.3	5.9	4.9	3.2	<1.7	>4.2
rDEN4Δ30-436-437			6.3	5.7	5.5	<1.7	>4.6	6.5	5.7	5.1	<1.7	>4.8
[clone1]
rDEN4-808-809	ED	3	4.6	4.1	<1.7	<1.7	>2.9	5.2	<1.7	<1.7	<1.7	>3.5
rDEN4Δ30-808-809			5.6	4.9	4.9	<1.7	>3.9	5.9	4.8	5.1	<1.7	>4.2
rDEN4-23-24-200-201	KE, KH	7	6.0	5.2	4.2	<1.7	>4.3	6.9	6.3	<1.7	<1.7	>5.2
rDEN4Δ30-23-24-200-201			4.5	4.2	4.8	<1.7	>2.8	4.9	4.5	2.9	<1.7	>3.2
rDEN4-23-24-396-397	KE, RE	7	6.5	5.8	5.5	<1.7	>4.8	7.1	5.9	5.4	<1.7	>5.4
rDEN4Δ30-23-24-396-397			6.1	5.2	4.8	<1.7	>4.4	6.9	5.4	4.9	<1.7	>5.2
rDEN-436-437-808-809	DK, ED	7	4.9	4.9	5.1	<1.7	>3.2	5.5	3.2	<1.7	<1.7	>3.8
aUnderlined values indicate a 2.5 or 3.5 log10 PFU/ml reduction in titer in Vero or HuH-7 cells, respectively, at the indicated temperature when compared to the permissive temperature (35° C.).
bAmino acid pair(s) changed to pair of Ala residues.
cReduction in titer (log10 pfu/ml) compared to the permissive temperature (35° C.).

TABLE 10
Addition of charge-to-alanine mutations attenuates rDEN4Δ30 in suckling mouse
brain and enhances attenuation in SCID-HuH-7 mice.
	Replication in suckling micea	Replication in SCID-HuH-7 miceb
			Mean log			Mean log
		Mean virus titer ± SE	reduction from		Mean virus titer ± SE	reduction from
Virus	n	(log10 PFU/g brain)	wtb	n	(log10 PFU/ml serum)	wtd
rDEN4	18	6.2 ± 0.4	—	33	5.4 ± 0.3	—
rDEN4Δ30	12	5.9 ± 0.8	0.2	8	3.4 ± 0.3	2.3
rDEN4-23-24	18	4.7 ± 0.1	1.6	19	4.7 ± 0.5	1.3
rDEN4Δ30-23-24	6	5.6 ± 0.3	0.7	7	4.6 ± 0.4	1.5
rDEN4-200-201	12	5.5 ± 0.5	0.6	12	3.7 ± 0.2	2.6
rDEN4Δ30-200-201	6	5.5 ± 0.6	0.1	4	3.3 ± 0.6	1.8
rDEN4-436-437	18	2.7 ± 0.4	3.5	10	2.9 ± 0.7	2.5
rDEN4Δ30-436-437 [clone 1]	6	2.9 ± 0.3	3.4	4	2.3 ± 0.4	2.8
rDEN4-808-809	6	1.8 ± 0.1	3.1	8	3.2 ± 0.4	3.0
rDEN4Δ30-808-809	12	3.9 ± 0.7	2.1	4	3.7 ± 0.6	2.4
rDEN4-23-24-200-201	12	5.3 ± 0.5	0.7	13	3.4 ± 0.1	2.9
rDEN4Δ30-23-24-200-201	6	3.0 ± 0.2	2.6	5	1.8 ± 0.1	3.3
rDEN4-23-24-396-397	12	4.6 ± 0.9	1.5	8	3.6 ± 0.3	2.3
rDEN4Δ30-23-24-396-397	6	3.0 ± 0.2	2.6	5	2.2 ± 0.3	2.9
rDEN-436-437-808-809	6	<1.7 ± 0.0	3.6	8	2.1 ± 0.3	2.4
aGroups of six suckling mice were inoculated i.c. with 104 PFU virus in a 30 μl inoculum. The brain was removed 5 days later, homogenized, and virus was quantitated by titration in Vero cells.
bDetermined by comparing the mean viral titers in mice inoculated with sample virus and concurrent wt controls (n = 6). The attenuation (att) phenotype is defined as a reduction of ≧1.5 log10 PFU/g compared to wt virus; reductions of 1.5 are listed in boldface.
cGroups of SCID-HuH-7 mice were inoculated directly into the tumor with 104 PFU virus.
dDetermined by comparing mean viral titers in mice inoculated with sample virus and concurrent wt controls.

The attenuation phenotype is defined as a reduction of ≧1.5 log₁₀PFU/g compared to wt virus; reductions of ≧1.5 are listed in boldface.

TABLE 11
Missense and UTR mutations present in rDEN4 virus derivatives bearing
charge-to-alanine and the Δ30 mutation.
		Nucleotide	Nucleotide	Amino acid
Virus	Genea,b	position	substitution	positionc	Amino acid changeb
rDEN4-200-201	prM	626	A > T	61	Glu > Asp
	NS4A	6659	C > T	93	Leu > Phe
	NS5	8160-8165	AAACA > GCAGC	200-201	LysHis > AlaAla
rDEN4Δ30-200-201	NS3	4830	G > A	102	Gly > Arg
	NS5	8106	G > A	181	Val > Ile
	NS5	8160-8165	AAACA > GCAGC	200-201	LysHis > AlaAla
	3′ UTR	10478-10507	Δ30 deletion	None	None
rDEN4-436-437 [clone 1]	E	2331	T > G	464	Trp > Gly
	NS1	2845	C > T	140	Ser > Phe
	NS3*	4891	T > C	122	Ile > Thr
	NS5	8869-8873	GACAA > GCAGC	436-437	AspLys > AlaAla
	NS5	9659	A > G	699	Lys > Arg
rDEN4-436-437 [clone 2]	NS4B	7153	T > C	108	Val > Ala
	NS5	8869-8873	GACAA > GCAGC	436-437	AspLys > AlaAla
rDEN4Δ30-436-437	NS4B*	7163	A > C	111	Leu > Phe
	NS5	8869-73	GACAA > GCAGC	436-437	AspLys > AlaAla
	3′ UTR	10478-10507	Δ30 deletion	None	None
rDEN4-23-24-200-201	NS3	6751	A > C	124	Lys > Thr
	NS5	7629-7633	AAAGA > GCAGC	23-24	LysGlu > AlaAla
	NS5	8160-8165	AAACA > GCAGC	200-201	LysHis > AlaAla
aAsterisk indicates previously identified Vero cell adaptation mutation.
bBold values indicate mutations designed to occur in the designated virus.
cAmino acid position in the protein product of the designated DEN4 gene; numbering starts with the amino terminus of the protein.

Based on the attenuation in the SCID-HuH7 mouse model, four of the charge-to-alanine mutant viruses (rDEN4-200-201, rDEN4Δ30-200-201, rDEN4-436-437 [clone 2], rDEN4Δ30-436-437) were evaluated in rhesus macaques as described above. As with the study of viruses carrying attenuating point mutations, viremia was detected on day 1 post-infection and ended by day 4 in all monkeys (FIG. 4, Table 12). Viremia was detected in most of the monkeys infected; only one of the four monkeys infected with rDEN4Δ30-200-201 and one of the four monkeys infected with rDEN4Δ30-436-437 showed no detectable viremia. Monkeys infected with rDEN4 showed the highest mean peak virus titer; and in each case viruses carrying the Δ30 mutation showed an approximately 0.5 log decrease in mean peak virus titer relative to their parental viruses and a 0.5 to 2 day decrease in mean number of viremic days per monkey. Monkeys infected with viruses carrying both the Δ30 and charge-to-alanine mutations showed a two-fold reduction in mean peak viremia relative to those infected with rDEN4Δ30. This suggests that addition of the charge-to-alanine mutations further attenuates rDEN4Δ30 for rhesus macaques.

As expected, none of the monkeys in this study showed detectable levels of neutralizing antibody on day 0. On day 28, every monkey infected with a virus showed a detectable levels of neutralizing antibody, indicating that all of the monkeys, even those that showed no detectable viremia, had indeed been infected. As in the study of attenuating point mutations, monkeys infected with rDEN4 had a mean serum neutralizing antibody titer (reciprocal dilution) which was approximately twice that of monkeys that had been infected with rDEN4Δ30. Monkeys infected with rDEN4-200-201 and rDEN4-436-437 [clone 2] had similar mean neutralizing antibody titers to rDEN4, and those infected with rDEN4Δ30-200-201 and rDEN4Δ30-436-437 had similar mean neutralizing antibody titers to rDEN4. In each case the addition of the Δ30 mutation to a virus resulted in a two-fold decrease in neutralizing antibody. Thus, although the addition of charge-to-alanine mutations to rDEN4Δ30 decreased mean peak viremia below that of rDEN4Δ30 alone, it did not affect levels of neutralizing antibody.

TABLE 12
Addition of paired charge-to-alanine mutations to rDEN4Δ30
further attenuates the virus for rhesus monkeys.
					Geometric mean
					serum neutralizing
		No. of	Mean no.		antibody titer
		monkeys	of viremic	Mean peak	(reciprocal
	No. of	with	days per	virus titer	dilution)
Virusa	monkeys	viremia	monkeyb	(log10 PFU/ml ± SE)	Day 0	Day 28
mock	2	0	0	<0.7	<5	<5
rDEN4	2	2	2.5	2.6 ± 0.3	<5	276
rDEN4Δ30	2	2	2.0	2.1 ± 0.1	<5	131
rDEN4-200, 201	4	4	2.3	1.8 ± 0.3	<5	212
rDEN4Δ30-200, 201	4	3	1.5	1.3 ± 0.2	<5	139
rDEN4-436, 437 [cl 2)	4	4	3.3	1.8 ± 0.2	<5	273
rDEN4Δ30-436, 437	4	3	1.3	1.0 ± 0.0	<5	143
aGroups of rhesus monkeys were inoculated subcutaneously with 105 PFU of the indicated virus in a 1 ml dose. Serum was collected on days 0 to 6, 8, 10 and 28. Virus titer was determined by plaque assay in Vero cells.
bViremia was not detected in any monkey after day 4.

After challenge with rDEN4 on day 28, mock-infected monkeys had a mean peak virus titer of 1.5 log₁₀PFU/ml and a mean number of viremic days of 3.0 (Table 13). However, none of the monkeys previously inoculated with rDEN4, rDEN4Δ30 or the charge-to-alanine mutant viruses showed detectable viremia. Additionally, none of the monkeys showed a greater than four-fold increase in serum neutralizing antibody titer. Together these data indicate that infection with any of the viruses, including those carrying both Δ30 and the charge-to-alanine mutations, protected rhesus macaques from challenge with rDEN4.

TABLE 13
rDEN4Δ30 containing charge-to-alanine mutations protects rhesus monkeys from
wt DEN4 virus challenge
		Mean no. of		Geometric mean serum
		viremic days		neutralizing antibody
		per monkey	Mean peak	titer (reciprocal
	No. of	after rDEN4	virus titer	dilution)
Virusa	monkeys	challenge	(log10 PFU/ml ± SE)	Day 28	Day 56
mock	2	3.0	1.5 ± 0.7	<5	284
rDEN4	2	0.0	<0.7	276	316
rDEN4Δ30	2	0.0	<0.7	131	96
rDEN4-200, 201	4	0.0	<0.7	212	356
rDEN4Δ30-200, 201	4	0.0	<0.7	139	132
rDEN4-436,	4	0.0	<0.7	273	401
437 [cl 2]
rDEN4Δ30-436, 437	4	0.0	<0.7	143	182
a28 days after primary inoculation with the indicated viruses, rhesus monkeys were challenged subcutaneously with 105 PFU rDEN4 virus in a 1 ml dose. Serum was collected on days 28 to 34, 36, 10, and 56. Virus titer was determined by plaque assay in Vero cells.

Addition of charge-to-alanine mutations to rDEN4Δ30 can confer a range of is phenotypes in both Vero and HuH-7 cells and att phenotypes in suckling mouse brain and can either enhance or leave unchanged attenuation in SCID-HuH-7 mice. Most importantly, addition of these mutations can decrease the viremia produced by rDEN4Δ30 in rhesus macaques without decreasing neutralizing antibody titer or protective efficacy. Thus addition of such mutations to rDEN4Δ30 is contemplated as enhancing attenuation in humans. Also, mutations are contemplated as being added that do not change the overall level of attenuation, but stabilize the attenuation phenotype because they themselves are independently attenuating even in the absence of the Δ30 mutation. Charge-to-alanine mutations are particularly useful because they occur outside of the structural gene regions, and so can be used to attenuate structural gene chimeric viruses. Moreover, they involve at least three nucleotide changes, making them unlikely to revert to wild type sequence.

A series of point mutations that enhance the replication of rDEN4 in Vero cells tissue culture have been identified; these are primarily located in the NS4B gene (Blaney, J. E. et. al. 2002 Virology 300:125-139; Blaney, J. E. et al. 2001 J Virol 75:9731-9740). Vero cell adaptation mutations confer two desirable features upon a vaccine candidate. First, they enhance virus yield in Vero cells, the intended substrate for vaccine production, and thus render vaccine production more cost-effective. Second, although each of these Vero adaptation mutations are point mutations, they are likely to be extremely stable during vaccine manufacture, because they give a selective advantage in Vero cells. At least one Vero cell adaptation mutation, at position 7129, was also shown to decrease mosquito infectivity of rDEN4; poor mosquito infectivity is another desirable characteristic of a dengue vaccine candidate. To investigate the generality of this finding, we tested the effect of the remaining Vero cell adaptation mutations on the ability of rDEN4 to infect Aedes aegypti mosquitoes fed on an infectious bloodmeal. Table 14 shows the infectivity of each virus carrying a single Vero cell adaptation mutation at high titer. Of these, only one mutation, at position 7182, was associated with a large decrease in mosquito infectivity. Thus 7182 may be a particularly valuable mutation to include in an rDEN4 vaccine candidate, as it has opposite effects on replication in Vero cells and in mosquitoes.

TABLE 14
Effect of Vero cell adaptation mutations on rDEN4 mosquito infectivity
	Aedes aegypti (oral infection)
	Dosea		% infectedb
Virus	(log10 pfu)	No. tested	Midgut	Head
rDEN4	4.3	27	70	25
rDEN4-4891	4.4	23	74	13
rDEN4-4995	4.8	20	80	50
rDEN4-7153	4.8	20	80	30
rDEN4-7546	4.6	20	55	10
rDEN4-7162	5.0	20	55	25
rDEN4-7163	4.9	15	73	72
rDEN4-7182	5.0	20	20	0
rDEN4-7630	4.3	10	70	10
aVirus titer ingested, assuming a 2 iμl bloodmeal.
bPercentage of mosquitoes with IFA detectable antigen in midgut or head tissue prepared 21 days after oral infection.

EXAMPLE 2

Generation and Characterization of a Recombinant DEN1 Virus Containing the Δ30 Mutation

We first sought to determine if the Δ30 mutation was able to satisfactorily attenuate a wild-type DEN virus other than the DEN4 serotype. To do this, the Δ30 mutation was introduced into the cDNA for DEN1 (Western Pacific). The pRS424DEN1WP cDNA clone (Puri, B. et al. 2000 Virus Genes 20:57-63) was digested with BamHI and used as template in a PCR using Pfu polymerase with forward primer 30 (DEN1 nt 10515-10561 and 10592-10607) and the M13 reverse sequencing primer (101 nt beyond the 3′ end of DEN1 genome sequence). The resulting PCR product was 292 bp and contained the Δ30 mutation. The pRS424DEN1WP cDNA was partially digested with Apa I, then digested to completion with Sac II and the vector was gel isolated, mixed with PCR product, and used to transform yeast strain YPH857 to yield growth on plates lacking tryptophan (Polo, S. et al. 1997 J Virol 71:5366-74). Positive yeast colonies were confirmed by PCR and restriction enzyme analysis. DNA isolated from two independent yeast colonies was used to transform E. coli strain STBL2. Plasmid DNA suitable for generating RNA transcripts was prepared and the presence of the Δ30 mutation was verified by sequence analysis.

For transcription and generation of virus, cDNA (designated pRS424DEN1Δ30) that was linearized with Sac II was used as template in a transcription reaction using SP6 RNA polymerase as described (Polo, S. et al. 1997 J Virol 71:5366-74). Transcription reactions were electroporated into LLC-MK2 cells and infection was confirmed by observation of CPE and immunofluorescence and harvested on day 14. Virus stocks were amplified on C6/36 mosquito cells and titered on LLC-MK2 cells. The genome of the resulting virus, rDEN1Δ30, was sequenced to confirm the presence of the Δ30 mutation. The Δ30 mutation removes nucleotides 10562-10591 of DEN1 (FIG. 2B, C), which corresponds to the TL2 of DEN1. The virus replicates efficiently in Vero cell culture to titers of 6.5 log₁₀PFU/ml, indicating that the Δ30 mutation is compatible with efficient growth of DEN1 in cell culture, a property essential for manufacture of the vaccine. Using similar techniques, parent virus rDEN1 was generated. Incidental mutations arising from virus passage in tissue culture were identified in both rDEN1 and rDEN1Δ30 using sequence analysis and are listed in Table 15. An additional rDEN1Δ30 virus was derived by transfection and amplification in Vero cells. Although this virus was not evaluated in the studies described below, its sequence analysis is included in Table 15. The properties of rDEN1Δ30 as a vaccine in vivo were next examined.

TABLE 15
Missense mutations present among the recombinant DEN1 viruses and
correlation of NS4B region mutations with those found in DEN4
	Trans-		Nucleo-	Nucleo-	Amino	Amino
	fection		tide	tide	acid	acid
Virus	cell type	Gene	position	change	position	change
wt rDEN1	LLC-MK2	prM	816	C > U	241	Ala > Val
		NS4B	7165a	U > G	2357	Phe > Leu
		NS4B	7173b	U > C	2360	Val > Ala
rDEN1Δ30	LLC-MK2	E	1748	A > U	552	Thr > Ser
rDEN1Δ30	Vero	E	1545	A > G	484	Lys > Arg
aSame nucleotide as 7154 in rDEN4.
bSame nucleotide as 7162 in rDEN4

* Nucleotide and amino acid comparison of selected NS4B region:

         7         7         7         7         7         7
DEN4     1         1         1         1         1         1
base     3         4         5         6         7         8
Number:  890123456789012345678901234567890123456789012345678901234567
         ++    ++  + +++++ +  +  +  + ++  +   ++++++++ ++ ++ ++ ++

D4 7128- CCAACAACCUUGACAGCAUCCUUAGUCAUGCUUUUAGUCCAUUAUGCAAUAAUAGGCCCA
         P  T  T  L  T  A  S  L  V  M  L  L  V  H  T  A  I  I  G  P

D1 7139- CCGCUGACGCUGACAGCGGCGGUAUUUAUGCUAGUGGCUCAUUAUGCCAUAAUUGGACCC
         P  L  T  L  T  A  A  V  P  M  L  V  A  H  T  A  I  I  G  P

D2 7135- CCUAUAACCCUCACAGCGGCUCUUCUUUUAUUGGUAGCACAUUAUGCCAUCAUAGGACCG
         P  I  T  L  T  A  A  L  L  L  L  V  A  H  T  A  I  I  G  P

D3 7130- CCACUAACUCUCACAGCGGCAGUUCUCCUGCUAGUCACGCAUUAUGCUAUUAUAGGUCCA
         P  L  T  L  T  A  A  V  L  L  L  V  T  H  T  A  I  I  G  P
         +     +  +  +  +              +        +  +  +  +  +  +  +
D4 = rDEN4
Dl = rDENl(WP)
D2 = rDEN2(Tonga/74)
D3 = rDEN3(Sleman/78)
+Homology among all four serotypes
Nucleotides are underlined in even multiples of 10.

Evaluation of the replication, immunogenicity, and protective efficacy of rDEN1Δ30 and wild-type parental rDEN1 virus (derived from the pRS424DEN1WP cDNA) in juvenile rhesus monkeys was performed as follows. Dengue virus-seronegative monkeys were injected subcutaneously with 5.0 log₁₀PFU of virus in a 1 ml dose divided between two injections in each side of the upper shoulder area. Monkeys were observed daily and blood was collected on days 0-10 and 28 and serum was stored at −70° C. Titer of virus in serum samples was determined by plaque assay in Vero cells as described previously (Durbin, A. P. et al. 2001 Am J Trop Med Hyg 65:405-13). Plaque reduction neutralization titers were determined for the day 28 serum samples as previously described (Durbin, A. P. et al. 2001 Am J Trop Med Hyg 65:405-13). All monkeys were challenged on day 28 with a single dose of 5.0 log₁₀PFU of wild-type rDEN1 and blood was collected for 10 days. Virus titer in post-challenge sera was determined by plaque assay in Vero cells. Monkeys inoculated with full-length wild-type rDEN1 were viremic for 2-3 days with a mean peak titer of 2.1 log₁₀PFU/ml (Table 16), and monkeys inoculated with rDEN1Δ30 were viremic for less than 1 day with a mean peak titer of 0.8 log₁₀PFU/ml, indicating that the Δ30 mutation is capable of attenuating DEN1. As expected for an attenuated virus, the immune response, as measured by neutralizing antibody titer, was lower following inoculation with rDEN1Δ30 compared to inoculation with wild-type rDEN1 (Table 16), yet sufficiently high to protect the animals against wild-type DEN1 virus challenge. Wild-type rDEN1 virus was not detected in any serum sample collected following virus challenge, indicating that monkeys were completely protected following immunization with either full-length wild-type rDEN1 or recombinant virus rDEN1Δ30. The level of attenuation specified by the Δ30 mutation was comparable in both the DEN1 and DEN4 genetic backgrounds (FIG. 5).

TABLE 16
The Δ30 mutation attenuates rDEN1 for rhesus monkeys
		Mean no.	Mean peak	Mean	Mean peak
		days with	titer	neutralization	titer of
Virus*	n	viremia	(log10 pfu/ml)	titer	challenge virus
rDEN1	4	2.8	2.1	1230	<0.7
rDEN1Δ30	4	0.5	0.8	780	<0.7
*Rhesus monkeys were inoculated subcuateously with 5.0 log10 PFU of virus. Serum samples were collected daily for 10 days. Serum for neutralization assay was collected on day 28. All monkeys were challenged on day 28 with 5.0 log10 PFU of rDEN1.

As previously reported, rDEN4 virus replicated to greater than 6.0 log₁₀PFU/ml serum in SCID-HuH-7 mice, while the replication of rDEN4 virus bearing the Δ30 mutation was reduced by about 10-fold (Blaney, J. E. Jr. et al. 2002 Virology 300:125-139). The replication of rDEN1Δ30 was compared to that of wt rDEN1 in SCID-HuH-7 mice (Table 17). rDEN1Δ30 replicated to a level approximately 100-fold less than its wt rDEN1 parent. This result further validates the use of the SCID-HuH-7 mouse model for the evaluation of attenuated strains of DEN virus, with results correlating closely with those observed in rhesus monkeys.

TABLE 17
The Δ30 mutation attenuates rDEN1 for HuH-7-SCID mice
		No. of	Mean peak virus titer6
	Virus	Mice5	(log10 pfu/ml ± SE)
	wt rDEN1	9	7.3 ± 0.2
	rDEN1Δ30	8	5.0 ± 0.3
5Groups of HuH-7-SCID mice were inoculated directly into the tumor with 4.0 log10 pfu virus. Serum was collected on day 6 and 7, and virus titer was determined by plaque assay in Vero cells.
6Significant difference was found between rDEN1 and rDEN1Δ30 viruses, Tukey-Kramer test (P < 0.005).

Finally, the infectivity of rDEN1 and rDEN1Δ30 for mosquitoes was assessed, using the methods described in detail in Example 5. Previously, the Δ30 mutation was shown to decrease the ability of rDEN4 to cross the mosquito midgut barrier and establish a salivary gland infection (Troyer, J. M. et al. 2001 Am J Trop Med Hyg 65:414-419). However neither rDEN1 nor rDEN1Δ30 was able to infect the midgut of Aedes aegypti mosquitoes efficiently via an artificial bloodmeal (Table 18), so it was not possible to determine whether Δ30 might further block salivary gland infection. A previous study also showed that the Δ30 had no effect on the infectivity of rDEN4 for Toxorhynchites splendens mosquitoes infected via intrathoracic inoculation (Troyer, J. M. et al. 2001 Am J Trop Med Hyg 65:414-419), and a similar pattern was seen for rDEN1 and rDEN1Δ30 (Table 18). The genetic basis for the inability of rDEN1 to infect the mosquito midgut has not been defined at this time. However, this important property of restricted infectivity for the mosquito midgut is highly desirable in a vaccine candidate since it would serve to greatly restrict transmission of the vaccine virus from a vaccinee to a mosquito vector.

TABLE 18
DEN1 and DEN1Δ30 viruses are both highly infectious for
Toxorhynchites splendens, but do not infect Aedes aegypti efficiently.
	Toxorhynchites splendens
	(intrathoracic inoculation)	Aedes aegypti (oral infection)
	Dosea			Dosec		% infectedd
Virus	(log10 pfu)	No. tested	% infectedb	(log10 pfu)	No. tested	Midgut	Head
rDEN1	3.5	7	100	4.0	26	11	0
	2.5	8	75
	1.5	7	71
	0.5	5	60
			MID50 < 0.5			MID50 ≧ 4.4
rDEN1	2.7	8	100	3.2	20	10	0
Δ30	1.7	7	100
	0.7	6	83
			MID50 < 0.7			MID50 ≧ 3.6
aAmount of virus present in 0.22 μl inoculum.
bPercentage of mosquitoes with IFA detectable antigen in head tissue prepared 14 days after inoculation.
cVirus titer ingested, assuming a 2 μl bloodmeal.
dPercentage of mosquitoes with IFA detectable antigen in midgut or head tissue prepared 21 days after oral infection. When virus infection was detected, but did not exceed a frequency of 50% at the highest dose of virus ingested, the MID50 was estimated by assuming that a 10-fold more concentrated virus dose would infect 100% of the mosquitoes.

Thus, the Δ30 mutation, first described in DEN4, was successfully transferred to rDEN1. The resulting virus, rDEN1Δ30, was shown to be attenuated in monkeys and SCID-HuH-7 mice to levels similar to recombinant virus rDEN4Δ30, thereby establishing the conservation of the attenuation phenotype specified by the Δ30 mutation in a different DEN virus background. Based on the favorable results of rDEN4Δ30 in recent clinical trials (Durbin, A. P. et al. 2001 Am J Trop Med Hyg 65:405-13), it is predicted that rDEN1Δ30 will be suitably attenuated in humans. To complete the tetravalent vaccine, attenuated rDEN2 and rDEN3 recombinant viruses bearing the Δ30 mutation are contemplated as being prepared (See Examples 3 and 4 below). The demonstration that the Δ30 mutation specifies a phenotype that is transportable to another DEN serotype has important implications for development of the tetravalent vaccine. This indicates that the Δ30 mutation is expected to have a corresponding effect on DEN2 and DEN3 wild-type viruses.

EXAMPLE 3

Generation and Characterization of a Recombinant DEN2 Virus Containing the Δ30 Mutation

Evaluation of rDEN1Δ30 showed that it was satisfactorily attenuated. Based on this result, we sought to extend our technology to the creation of a DEN2 vaccine candidate. To do this, the Δ30 mutation was introduced into the cDNA of DEN2. A DEN2 virus isolate from a 1974 dengue epidemic in the Kingdom of Tonga (Tonga/74) (Gubler, D. J. et al. 1978 Am J Trop Med Hyg 27:581-589) was chosen to represent wt DEN2. The genome of DEN2 (Tonga/74) was sequenced in its entirety and served as consensus sequence for the construction of a full-length cDNA clone (Appendix 1). cDNA fragments of DEN2 (Tonga/74) were generated by reverse-transcription of the genome as indicated in FIG. 6A. Each fragment was subcloned into a plasmid vector and sequenced to verify that it matched the consensus sequence as determined for the virus. This yielded seven cloned cDNA fragments spanning the genome. Cloned fragments were modified as follows: Fragment X, representing the 5′ end of the genome was abutted to the SP6 promoter; Fragment L was modified to contain a translationally-silent SpeI restriction site at genomic nucleotide 2353; Fragment R was modified to contain a translationally-silent SpeI restriction site also at genomic nucleotide 2353, and to stabilize the eventual full-length clone, two additional translationally-silent mutations at nucleotides 2362-2364 and 2397 were created to ensure that translation stop codons were present in all reading frames other than that used to synthesize the virus polyprotein; Fragment A was modified at nucleotide 3582 to ablate a naturally occurring SpeI restriction site and at nucleotide 4497 to ablate a naturally occurring KpnI restriction site; Fragment C was modified at nucleotide 9374 to ablate a naturally occurring KpnI restriction site; and Fragment Y, representing the 3′ end of the genome was abutted to a KpnI restriction site. Each fragment was added incrementally between the AscI and KpnI restriction sites of DEN4 cDNA clone p4 (Durbin, A. P. et al. 2001 Am J Trop Med Hyg 65:405-13) to generate a full-length DEN2 cDNA clone (p2) with the same vector background successfully used to generate rDEN4 and rDEN4Δ30. cDNA clone p2 was sequenced to confirm that the virus genome region matched the DEN2 (Tonga/74) consensus sequence, with the exception of the translationally-silent modifications noted above. The Δ30 mutation was introduced into Fragment Y to generate Fragment YΔ30. To create p2Δ30, the Fragment Y region of p2 was replaced with Fragment YΔ30 (FIG. 6A, B).

For transcription and generation of infectious virus, cDNA (p2 and p2Δ30) was linearized with Acc65I (isoschizomer of KpnI which cleaves leaving only a single 3′ nucleotide) and used as template in a transcription reaction using SP6 RNA polymerase as previously described (Blaney, J. E. et. al. 2002 Virology 300:125-139). Transcripts were introduced into Vero cells or C6/36 mosquito cells using liposome-mediated transfection and cell culture supernatants were harvested on day 7.

rDEN2 virus was recovered from the p2 cDNA in both Vero and C6/36 cells, while rDEN2Δ30 was recovered from the p2Δ30 cDNA clone in only C6/36 cells (Table 19). The level of infectious virus recovered in C6/36 cells was comparable for the p2 and p2Δ30 cDNA clones when assayed by plaque titration and immunostaining in Vero or C6/36 cells. As previously observed, the efficiency of transfection in C6/36 cells was higher than that in Vero cells. Two rDEN2Δ30 viruses were recovered from independent cDNA clones, #2 and #10.

TABLE 19
rDEN2 virus is recovered in Vero and C6/36 cells, but
rDEN2Δ30 virus is recovered only in C6/36 cells.
				Virus titer of transfection
				harvest (day 7) determined
				in the indicated
Transfection	cDNA			cell type (log10 PFU/ml)
cell type	construct	Clone	Virus	Vero cells	C6/36 cells
Vero cells	p2	#8A	rDEN2	3.1	4.3
	p2Δ30	#2	rDEN2Δ30	<0.7	<0.7
	p2Δ30	#10	rDEN2Δ30	<0.7	<0.7
C6/36 cells	p2	#8A	rDEN2	5.5	7.5
	p2Δ30	#2	rDEN2Δ30	4.8	7.6
	p2Δ30	#10	rDEN2Δ30	4.6	7.5

To produce working stocks of rDEN2 and rDEN2Δ30 viruses, transfection harvests were passaged and terminally diluted in Vero cells, and genomic sequences of the viruses were determined. The Vero cell transfection harvest of rDEN2 virus was terminally diluted once in Vero cells, and individual virus clones were passaged once in Vero cells. To assess whether any homologous Vero cell adaptation mutations identified in the rDEN4 NS4B 7100-7200 region were present in these virus clones, seven independent terminally diluted clones were sequenced over this region. Each of the seven rDEN2 viruses contained a single nucleotide substitution in this region at nucleotide 7169 (U>C) resulting in a Val>Ala amino acid change. This nucleotide corresponds to the 7162 mutation identified in rDEN4 (Blaney, J. E. et. al. 2002 Virology 300:125-139), which has a known Vero cell adaptation phenotype suggesting that this mutation may confer a replication enhancement phenotype in rDEN2 virus. One rDEN2 virus clone was completely sequenced and in addition to the 7169 mutation, a missense mutation (Glu>Ala) was found in NS5 at residue 3051 (Table 20).

TABLE 20
Missense mutations which accumulate in rDEN2 and rDEN2Δ30
viruses after transfection or passage in Vero cells.
		Nucleotide	Nucleotide	Amino acid	Amino acid
Virus	Gene	position	substitution	positiona	change
rDEN2b	NS4B	7169c	U > C	2358	Val > Ala
(Vero)	NS5	9248	A > C	3051	Glu > Ala
rDEN2Δ30d	NS3	4946	A > G	1617	Lys > Arg
(Vero)	NS4B	7169c	U > C	2358	Val > Ala
aAmino acid position in DEN2 polyprotein beginning with the methionine residue of the C protein (nucleotides 97-99) as position 1.
bVirus was recovered in Vero cells and terminally-diluted once in Vero cells. Virus stock was prepared in Vero cells.
cSame nucleotide position as 7162 in rDEN4.
dVirus was recovered in C6/36 cells and passaged three times in Vero cells. Virus was then terminally diluted and a stock was prepared in Vero cells.

Because both rDEN2 and rDEN2Δ30 viruses grown in Vero cells acquired the same mutation at nucleotide 7169, which corresponds to the Vero cell adaptation mutation previously identified in rDEN4 at nucleotide 7162, it was reasoned that this mutation is associated with growth adaptation of rDEN2 and rDEN2Δ30 in Vero cells. In anticipation that the 7169 mutation may allow rDEN2Δ30 to be recovered directly in Vero cells, the mutation was introduced into the rDEN2Δ30 cDNA plasmid to create p2Δ30-7169. Transcripts synthesized from p2Δ30-7169, as well as p2 and p2Δ30 were introduced into Vero cells or C6/36 mosquito cells using liposome-mediated transfection as described above. Virus rDEN2Δ30-7169 was recovered from the p2Δ30-7169 cDNA in both Vero and C6/36 cells, while rDEN2Δ30 was recovered from the p2Δ30 cDNA clone in only C6/36 cells (Table 21). The 7169 mutation is both necessary and sufficient for the recovery of rDEN2Δ30 in Vero cells.

TABLE 21
rDEN2Δ30-7169 virus containing the 7169 Vero cell adaptation
mutation is recovered in both Vero and C6/36 cells
				Virus titer of trans-
				fection harvest
				(day 14) determined
Transfection	cDNA			in C6/36 cells
cell type	construct	Clone	Virus	(log10 PFU/ml)
Vero cells	p2	#8A	rDEN2	6.8
	p2Δ30	#2	rDEN2Δ30	<0.7
	p2Δ30-7169a	#37	rDEN2Δ30-7169	5.1
C6/36 cells	p2	#8A	rDEN2	6.9
	p2Δ30	#2	rDEN2Δ30	7.1
	p2Δ30-7169	#37	rDEN2Δ30-7169	7.2
aNucleotide 7169 in rDEN2 corresponds to nucleotide 7162 in rDEN4 which has been shown to be associated with growth adaptation in Vero cells.

To initially assess the ability of the Δ30 mutation to attenuate rDEN2 virus in an animal model, the replication of DEN2 (Tonga/74), rDEN2, and rDEN2Δ30 viruses was evaluated in SCID-HuH-7 mice. Previously, attenuation of vaccine candidates in SCID-HuH-7 mice has been demonstrated to be predictive of attenuation in the rhesus monkey model of infection (Examples 1 and 2). The recombinant viruses tested in this experiment were recovered in C6/36 cells. The DEN2 Tonga/74 virus isolate, rDEN2, and two independent rDEN2Δ30 viruses, (clones 20A and 21A) which were derived from two independent p2Δ30 cDNA clones, were terminally diluted twice in C6/36 cells prior to production of a working stock in C6/36 cells. These viruses should not contain any Vero cell adaptation mutations. DEN2 Tonga/74 virus replicated to a mean virus titer of 6.2 log₁₀PFU/ml in the serum of SCID-HuH-7 mice, and rDEN2 virus replicated to a similar level, 5.6 log₁₀ PFU/ml (Table 22). Both rDEN2Δ30 viruses were greater than 100-fold restricted in replication compared to rDEN2 virus. These results indicate that the Δ30 mutation has an attenuating effect on replication of rDEN2 virus similar to that observed for rDEN4 and rDEN1 viruses.

TABLE 22
The Δ30 mutation restricts rDEN2 virus replication
in SCID-HuH-7 mice.
		Mean virus	Mean log10-unit
	No. of	titer ± SE (log10	reduction from
Virus	mice	PFU/ml serum)a	value for wtb
DEN2 (Tonga/74)	8	6.2 ± 0.3	—
rDEN2	9	5.6 ± 0.2	—
rDEN2Δ30 (clone 20A)	9	3.1 ± 0.2	2.5
rDEN2Δ30 (clone 21A)	9	2.9 ± 0.3	2.7
aGroups of SCID-HuH-7 mice were inoculated directly into the tumor with 104 PFU virus grown in C6/36 cells. Serum was collected on day 7 and titered in C6/36 cells.
bComparison of mean virus titers of mice inoculated with mutant virus and concurrent rDEN2 control.

DEN2 virus replication in SCID-HuH-7 mice was also determined using DEN2 (Tonga/74), rDEN2, and rDEN2Δ30 which were passaged in Vero cells (see Table 20, footnotes b and d). Both rDEN2 and rDEN2Δ30 had acquired a mutation in NS4B, nucleotide 7169, corresponding to the 7162 mutation identified in rDEN4 as Vero cell adaptation mutation. In the presence of the 7169 mutation, the Δ30 mutation reduced replication of rDEN2Δ30 by 1.0 log₁₀PFU/ml (Table 23). Previously, using virus grown in C6/36 cells and lacking the 7169 mutation, the Δ30 mutation reduced replication of rDEN2Δ30 by about 2.5 log₁₀PFU/ml (Table 22). These results indicate that Vero cell growth adaptation in DEN2 may also confer a slight growth advantage in HuH-7 liver cells. Nevertheless, the attenuation conferred by the Δ30 mutation is still discernible in these Vero cell growth adapted viruses.

TABLE 23
The Δ30 mutation restricts Vero cell adapted rDEN2 virus
replication in SCID-HuH-7 mice.
			Mean log10-unit
	No.	Mean virus titer ± SE	reduction from
Virus	of mice	(log10 PFU/ml serum)a	value for wtb
DEN2 (Tonga/74)	6	5.9 ± 0.3	—
rDEN2	7	5.9 ± 0.2	—
rDEN2Δ30	9	4.9 ± 0.3	1.0
aGroups of SCID-HuH-7 mice were inoculated directly into the tumor with 104 PFU virus. Serum was collected on day 7 and titered in C6/36 cells.
bComparison of mean virus titers of mice inoculated with rDEN2Δ30 and rDEN2 control.

Evaluation of the replication, immunogenicity, and protective efficacy of rDEN2Δ30 and wild-type parental rDEN2 virus in juvenile rhesus monkeys was performed as follows. Dengue virus-seronegative monkeys were injected subcutaneously with 5.0 log₁₀PFU of virus in a 1 ml dose divided between two injections in each side of the upper shoulder area. Monkeys were observed daily and blood was collected on days 0-10 and 28 and serum was stored at −70° C. Viruses used in this experiment were passaged in Vero cells, and recombinant viruses contained the mutations shown in Table 20 (See footnotes b and d). Titer of virus in serum samples was determined by plaque assay in Vero cells as described previously (Durbin, A. P. et al. 2001 Am J Trop Med Hyg 65:405-13). Plaque reduction neutralization titers were determined for the day 28 serum samples as previously described (Durbin, A. P. et al. 2001 Am J Trop Med Hyg 65:405-13). All monkeys were challenged on day 28 with a single dose of 5.0 log₁₀PFU of wt DEN2 (Tonga/74) and blood was collected for 10 days. Virus titer in post-challenge sera was determined by plaque assay in Vero cells. Monkeys inoculated with wt DEN2 (Tonga/74) or rDEN2 were viremic for 4-5 days with a mean peak titer of 2.1 or 1.9 log₁₀PFU/ml, respectively.

Monkeys inoculated with rDEN2Δ30 were viremic for 2-3 days with a mean peak titer of 1.7 log₁₀PFU/ml (Table 24, FIG. 7), indicating that the Δ30 mutation is capable of attenuating DEN2, although not to the same low level observed in rDEN1Δ30 (Table 16). As expected for an attenuated virus, the immune response, as measured by neutralizing antibody titer, was lower following inoculation with rDEN2Δ30 compared to inoculation with wt DEN2 (Tonga/74) or rDEN2 (Table 24), yet sufficiently high to protect the animals against wt DEN2 virus challenge (Table 25). Thus, the decreased number of days of viremia for rDEN2Δ30, the decreased mean peak titer, and the decreased serum antibody response indicate that the Δ30 mutation attenuates rDEN2 for rhesus monkeys.

TABLE 24
rDEN2Δ30 is slightly more attenuated for rhesus monkeys than rDEN2
					Geometric mean
					serum neutralizing
		No. of	Mean no.		antibody titer
		monkeys	of viremic	Mean peak	(reciprocal
	No. of	with	days per	virus titer	dilution)
Virusa	monkeys	viremia	monkeyb	(log10 PFU/ml ± SE)	Day 0	Day 28
mock	2	0	0	<0.7	<10	<10
DEN2 (Tonga/74)	4	4	4.5	2.1 ± 0.3	<10	311
rDEN2 (Vero)	4	4	4.0	1.9 ± 0.1	<10	173
rDEN2Δ30 (Vero)	4	4	2.8	1.7 ± 0.2	<10	91
aGroups of rhesus monkeys were inoculated subcutaneously with 105 PFU of the indicated virus in a 1 ml dose. Serum was collected on days 0 to 6, 8, 10, 12, and 28. Virus titer was determined by plaque assay in Vero cells.
bViremia was not detected in any monkey after day 8.

TABLE 25
rDEN2Δ30 protects rhesus monkeys from wt DENT2 virus challenge
				Geometric mean
		Mean no. of		serum neutralizing
		viremic days per	Mean peak	antibody titer
	No. of	monkey after	virus titer	(reciprocal dilution)
Virusa	monkeys	DEN2 challenge	(log10 PFU/ml ± SE)	Day 28	Day 56
Mock	2	4.0	2.1 ± 0.1	<10	338
DEN2 (Tonga/74)	4	0	<0.7	311	334
rDEN2 (Vero)	4	0	<0.7	173	318
rDEN2Δ30 (Vero)	4	0	<0.7	91	267
a28 days after inoculation with the indicated viruses, monkeys were challenged subcutaneously with 105 PFU DEN2 (Tonga/74) in a 1 ml dose. Serum was collected on days 28 to 34, 36, 38, and 56. Virus titer was determined by plaque assay in Vero cells.

The infectivity of DEN2 (Tonga/74), rDEN2 and rDEN2Δ30 for Aedes aegypti mosquitoes via an artificial bloodmeal was evaluated using the methods described in detail in Example 5. However at doses of 3.3 to 3.5 log₁₀pfu ingested, none of these three viruses infected any mosquitoes, indicating that DEN2 (Tonga/74) is poorly infectious for Aedes aegypti. As with rDEN1, the genetic basis for this lack of infectivity remains to be defined. The important property of restricted infectivity for the mosquito midgut is highly desirable in a vaccine candidate because it would serve to greatly restrict transmission of the virus from a vaccinee to a mosquito vector.

Several missense mutation identified in rDEN4 have been demonstrated to confer attenuated replication in suckling mouse brain and/or SCID-HuH-7 mice (Blaney, J. E. et al. 2002 Virology 300:125-139; Blaney, J. E. et al. 2001 J Virol 75:9731-9740). In addition, missense mutations that enhance replication of rDEN4 virus in Vero cells have been characterized. The significant sequence conservation among the DEN virus serotypes provides a strategy by which the mutations identified in rDEN4 viruses are contemplated as being used to confer similar phenotypes upon rDEN2 virus. Six mutations identified in rDEN4 virus that are at a site conserved in rDEN2 virus are being introduced into the p2 and p2Δ30 cDNA clones (Table 26). Specifically, two rDEN4 mutations, NS3 4891 and 4995, which confer Vero cell adaptation phenotypes and decreased replication in mouse brain, one mutation, NS4B 7182, which confers a Vero cell adaptation phenotype, and three mutations, NS1 2650, NS3 5097, and 3′ UTR 10634 which confer decreased replication in mouse brain and SCID-HuH-7 mice are being evaluated. These mutations have been introduced into sub-cloned fragments of the p2 and p2Δ30 cDNA clones, and have been used to generate mutant full-length cDNA clones (Table 26), from which virus has been recovered in C6/36 cells (Table 27). The evaluation of these mutant rDEN2 viruses is contemplated as determining that such point mutations can be transported into a different DEN virus serotype and confer a similar useful phenotype, as has been demonstrated for the Δ30 deletion mutation.

TABLE 26
Introduction of conserved point mutations characterized in
rDEN4 viruses into rDEN2 Tonga/74 virus.
Phenotype in
rDEN4 virus		Mutation in rDEN4 virus	Mutation introduced into DEN2 virus
Vero	Mouse	SCID-		Nucleo-	Amino	Amino	Nucleo-	Amino	Amino	RE
Adap-	brain	HuH-7		tide	acid	acid	tide	acid	acid	site/mutagenic
tationa	attb	attc	Gene/region	position	positiond	change	position	positiond	change	regione
+	+	−	NS3	4891	1597	Ile > Thr	4889	1598	Ile > Thr	Nar I
										CCAcgGGcGCCGT
+	+	−	NS3	4995	1632	Ser > Pro	4993	1633	Ser > Pro	Stu I
										AAGGccTGGA
+	−	−	NS4b	7182	2361	Gly > Ser	7189	2365	Gly > Ser	Xma I
										TAtccCCGGGAC
−	+	+	NS1	2650	850	Asn > Ser	2648	851	Asn > Ser	Sac I
										AGAgcTctcTC
−	+	+	NS3	5097	1666	Asp > Asn	5095	1667	Asp > Asn	Xma I
										GaATCTCCACCCgGA
−	+	+	3′ UTR	10634	n/af	n/a	10698	n/a	n/a	none
										CTGTcGAATC
aPresence of the indicated mutation increases plaque size in Vero cells two-fold or greater than rDEN4 virus.
bPresence of the indicated mutation restricts replication in 7-day-old mouse brain greater than 100-fold compared to rDEN4 virus.
cPresence of the indicated mutation restricts replication in SCID-HuH-7 mice greater than 100-fold compared to rDEN4 virus.
dAmino acid position in DEN4 or DEN2 polyprotein beginning with the methionine residue of the C protein (nucleotides 102-104 or 97-99, respectively) as position 1.
ePrimers were engineered which introduced (underline) translationally-silent restriction enzyme (RE) sites. Lowercase letters indicate nt changes and bold letters indicate the site of the 5-FU mutation, which in some oligonucleotides differs from the original nucleotide substitution change in order to create a unique RE site. The change preserves the codon for the amino acid substitution.
fNucleotide substitution in the 3′ UTR is U > C in DEN4 and DEN2 virus.

TABLE 27
rDEN2 viruses containing conserved 5-FU mutations
are recovered in C6/36 cells.
	Virus	Nucleotide	Virus titer of transfection
	(nucleotide	position in	harvest (day 7) determined
	position in rDEN2)	rDEN4	in C6/36 cells (log10 PFU/ml)
	rDEN2-4889	4891	7.6
	rDEN2-4993	4995	7.2
	rDEN2-7189	7182	3.5
	rDEN2-2648	2650	—a
	rDEN2-5095	5097	—a
	rDEN2-10698	10634	7.7
	aTransfection has not yet been attempted.

EXAMPLE 4

Generation and Characterization of a Recombinant DEN3 Virus Containing the Δ30 Mutation

Because rDEN1Δ30 was satisfactorily attenuated, we sought to extend our technology to the creation of a DEN3 vaccine candidate. To do this, the Δ30 mutation was introduced into the cDNA of DEN3, similar to the method used to create rDEN2Δ30. A DEN3 virus isolate from a 1978 dengue epidemic in rural Sleman, Central Indonesia (Sleman/78) (Gubler, D. J. et al. 1981 Am J Trop Med Hyg 30:1094-1099) was chosen to represent wt DEN3. The genome of DEN3 (Sleman/78) was sequenced in its entirety and served as consensus sequence for the construction of a full-length cDNA clone (Appendix 2). cDNA fragments of DEN3 (Sleman/78) were generated by reverse-transcription of the genome as indicated in FIG. 8A. Each fragment was subcloned into a plasmid vector and sequenced to verify that it matched the consensus sequence as determined for the virus. This yielded six cloned cDNA fragments spanning the genome. Cloned fragments were modified as follows: Fragment 5, representing the 5′ end of the genome was abutted to the SP6 promoter preceded by an AscI restriction site; Fragment 1L was modified to contain a translationally-silent SpeI restriction site at genomic nucleotide 2345; Fragment 1R was modified to contain a translationally-silent SpeI restriction site also at genomic nucleotide 2345, and to stabilize the eventual full-length clone, three additional translationally-silent mutations at nucleotides 2354-2356, 2360-2362, and 2399 were created to ensure that translation stop codons were present in all reading frames other than that used to synthesize the virus polyprotein; Fragment 3 was modified at nucleotide 9007 to ablate a naturally occurring KpnI restriction site; and Fragment 4, representing the 3′ end of the genome was abutted to a KpnI restriction site. Each fragment was added incrementally between the AscI and KpnI restriction sites of DEN4 cDNA clone p4 (Durbin, A. P. et al. 2001 Am J Trop Med Hyg 65:405-13) to generate a full-length DEN3 cDNA clone with the same vector background successfully used to generate rDEN4 and rDEN2. However, a stable, full-length clone could not be recovered in E. coli when fragments 1L and 1R were combined into the same cDNA molecule. To overcome this instability, a synthetic DNA linker (FIG. 8A) containing redundant termination codons in each of the forward and reverse open reading frames was introduced into the SpeI restriction site at the same time that fragment 1L was added to complete the full-length cDNA construct. The resulting p3 clone containing the linker sequence was stable in E. coli, indicating that the linker sequence was sufficient to interrupt whatever deleterious element exists in this region. cDNA clone p3 was sequenced and the virus genome was found to match the DEN3 (Sleman/78) consensus sequence, with the exception of the linker sequence and translationally-silent modifications noted above (Appendix 2—shown with the linker sequence removed). The Δ30 mutation was introduced into Fragment 4 to generate Fragment 4Δ30. To create p3Δ30, the Fragment 4 region of p3 was replaced with Fragment 4Δ30 (FIG. 8A, B).

For transcription and generation of infectious virus, cDNA plasmids p3 and p3Δ30 were digested with SpeI and religated to remove the linker sequence, linearized with Acc65I (isoschizomer of KpnI which cleaves leaving only a single 3′ nucleotide), and used as templates in a transcription reaction using SP6 RNA polymerase as previously described (Blaney, J. E. et. al. 2002 Virology 300:125-139). Transcripts were introduced into Vero cells or C6/36 mosquito cells using liposome-mediated transfection and cell culture supernatants were harvested on day 14.

rDEN3 virus was recovered from the p3 cDNA in both Vero and C6/36 cells, while rDEN3Δ30 was recovered from the p3Δ30 cDNA clone in only C6/36 cells (Table 28). The level of infectious virus recovered in C6/36 cells was comparable for the p3 and p3Δ30 cDNA clones when assayed by plaque titration in Vero or C6/36 cells. As previously observed, the efficiency of transfection in C6/36 cells was higher than that in Vero cells. Two rDEN3Δ30 viruses were recovered from independent cDNA clones, #22 and #41.

TABLE 28
rDEN3 virus is recovered in Vero and C6/36 cells,
but rDEN3Δ30 virus is recovered only in C6/36 cells.
				Virus titer of transfection
				harvest (day 14)
				determined in the indicated
Transfection	cDNA			cell type (log10 PFU/ml)
cell type	construct	Clone	Virus	Vero cells	C6/36 cells
Vero cells	p3	#50	rDEN3	5.2	6.3
	p3Δ30	#22	rDEN3Δ30	<0.7	<0.7
	p3Δ30	#41	rDEN3Δ30	<0.7	<0.7
C6/36 cells	p3	#50	rDEN3	5.2	6.0
	p3Δ30	#22	rDEN3Δ30	5.9	6.9
	p3Δ30	#41	rDEN3Δ30	5.1	7.2

To produce working stocks of viruses, transfection harvests will be passaged and terminally diluted in Vero cells, and genomic sequences of the viruses will be determined. To improve virus yield in Vero cells, the Vero cell adaptation mutation previously identified in rDEN4 at nucleotide 7162 was introduced into the homologous NS4B region of p3 and p3Δ30 to create p3-7164 and p3Δ30-7164. This mutation creates a Val to Ala substitution at amino acid position 2357. As demonstrated for rDEN2Δ30, this mutation allowed for the direct recovery of virus in Vero cells (Table 27) and is anticipated to have the same effect for rDEN3Δ30.

To initially assess the ability of the Δ30 mutation to attenuate rDEN3 virus in an animal model, the replication of DEN3 (Sleman/78), rDEN3, and rDEN3Δ30 viruses will be evaluated in SCID-HuH-7 mice and rhesus monkeys. Previously, attenuation of vaccine candidates in SCID-HuH-7 mice has been demonstrated to be predictive of attenuation in the rhesus monkey model of infection (Examples 1 and 2). The evaluation of these mutant rDEN3 viruses is contemplated as determining that the Δ30 deletion mutations can be transported into the DEN3 virus serotype and confer a similar useful phenotype, as has been demonstrated for DEN1, DEN2, and DEN4.

In summary, the strategy of introducing the Δ30 mutation into wild-type DEN viruses of each serotype to generate a suitably attenuated tetravalent vaccine formulation is a unique and attractive approach for several reasons. First, the mutation responsible for attenuation is a 30-nucleotide deletion in the 3′ UTR, thus assuring that all of the structural and non-structural proteins expressed by each of the four components of the tetravalent vaccine are authentic wild-type proteins. Such wild-type proteins should elicit an antibody response that is broad based, rather than based solely on the M and E proteins that are present in chimeric dengue virus vaccine candidates (Guirakhoo, F. et al. 2001 J Virol 75:7290-304; Huang, C. Y. et al. 2000 J Virol 74:3020-8). The uniqueness of this approach derives from the fact that other live attenuated dengue virus vaccines have mutations in their structural or non-structural proteins (Butrapet, S. et al. 2000 J Virol 74:3011-9; Puri, B. et al. 1997 J Gen Virol 78:2287-91), therefore the immune response induced by these viruses will be to a mutant protein, rather than a wild-type protein. Second, deletion mutations are genetically more stable than point mutations, and reversion of the attenuation phenotype is unlikely. In humans, DEN4Δ30 present in serum of vaccinees retained its Δ30 mutation, confirming its genetic stability in vivo (Durbin, A. P. et al. 2001 Am J Trop Med Hyg 65:405-13). The attenuating mutations in other existing dengue live attenuated vaccine candidates are based on less stable point mutations (Butrapet, S. et al. 2000 J Virol 74:3011-9: Puri, B. et al. 1997 J Gen Virol 78:2287-91). Third, since the Δ30 mutation is common to each of the four viruses of the tetravalent vaccine, recombination between any of the four vaccine serotypes would not lead to loss of the attenuating mutation or reversion to a wild-type phenotype. Recombination between components of the trivalent polio vaccine has been observed (Guillot, S. et al. 2000 J Virol 74:8434-43), and naturally occurring recombinant dengue viruses have been described (Worobey, M. et al. 1999 PNAS USA 96:7352-7) indicating the ability of this flavivirus to exchange genetic elements between two different viruses. Clearly, gene exchange is readily achieved between different DEN virus serotypes using recombinant cDNA techniques (Bray, M. and Lai, C. J. 1991 PNAS USA 88:10342-6). Fourth, viruses with wild-type structural proteins appear more infectious than viruses with altered structural proteins (Huang, C. Y. et al. 2000 J Virol 74:3020-80). This permits the use of a low quantity of each of the four virus components in the final vaccine, contributing to the low cost of manufacture. Low-cost manufacture is an essential element in defining the ultimate utility of a dengue virus vaccine.

EXAMPLE 5

Generation and Characterization of Intertypic Chimeric DEN2 Viruses Containing the Δ30 Mutation

The four serotypes of dengue virus are defined by antibody responses induced by the structural proteins of the virus, primarily by a neutralizing antibody response to the envelope (E) protein. These structural proteins include the E glycoprotein, a membrane protein (M), and a capsid (C) protein. The mature virus particle consists of a well-organized outer protein shell surrounding a lipid bilayer membrane and a less-well-defined inner nucleocapsid core (Kuhn, R. J. et al. 2002 Cell 108:717-25). The E glycoprotein is the major protective antigen and readily induces virus neutralizing antibodies that confer protection against dengue virus infection. An effective dengue vaccine must therefore minimally contain the E protein of all four serotypes, namely DEN1, DEN2, DEN3, and DEN4, thereby inducing broad immunity and precluding the possibility of developing the more serious illnesses DHF/DSS, which occur in humans during secondary infection with a heterotypic wild-type dengue virus. Based on a previously reported strategy (Bray, M. and Lai, C. J. 1991 PNAS USA 88:10342-6), a recombinant cDNA technology is being used to develop a live attenuated tetravalent dengue virus vaccine composed of a set of intertypic chimeric dengue viruses bearing the structural proteins of each serotype.

Following the identification of a suitably attenuated and immunogenic DEN4 recombinant virus, namely DEN4Δ30 (Durbin, A. P et al. 2001 Am J Trop Med Hyg 65:405-13), chimeric viruses based on the DEN4 cDNA have been generated in which the C-M-E (CME) or M-E (ME) genes have been replaced with the corresponding genes derived from the prototypic DEN2 New Guinea C (NGC) strain (FIG. 9A). To create the CME chimeric viruses, the BglII/XhoI region of the cDNA for either rDEN4 or rDEN4Δ30 was replaced with a similar region derived from DEN2. Likewise, to create the ME chimeric viruses, the PstI/XhoI region of the cDNA for either rDEN4 or rDEN4Δ30 was replaced with a homologous region derived from DEN2. The nucleotide and amino acid sequences of the resulting junctions are shown in FIG. 9B. The GenBank accession number for the nucleotide sequence of rDEN4Δ30 is AF326837. The GenBank accession number for DEN2 NGC is M29095, which represents the mouse neurovirulent strain of DEN2 NGC and differs from the prototypic strain used here as previously documented (Bray, M. et al. 1998 J Virol 72:1647-51).

For transcription and generation of virus, chimeric cDNA clones were linearized and used as template in a transcription reaction using SP6 RNA polymerase as described (Durbin, A. P et al. 2001 Am J Trop Med Hyg 65:405-13). Transcripts were introduced into Vero cells using liposome-mediated transfection and recombinant dengue virus was harvested on day 7. The genomes of the resulting viruses were confirmed by sequence analysis of viral RNA isolated from recovered virus as previously described (Durbin, A. P et al. 2001 Am J Trop Med Hyg 65:405-13). Incidental mutations arising from virus passage in tissue culture were identified in all viruses and are listed in Table 29. Notably, each virus contained a missense mutation in NS4B corresponding to a previously identified mutation from rDEN4 and associated with adaptation to replication in Vero cells (See Table 30 for correlation of nucleotide positions between rDEN4 and chimeric viruses). All viruses replicated in Vero cells to titers in excess of 6.0 log₁₀PFU/ml, indicating that the chimeric viruses, even those containing the Δ30 mutation, replicate efficiently in cell culture, a property essential for manufacture of the vaccine.

TABLE 29
Missense mutations observed among the Vero cell-grown
chimeric DEN2/4 viruses
				Amino	Amino
		Nucleotide	Nucleotide	acid	acid
Virus	Gene	position	change	position	change
rDEN2/4(CME)	NS4B	7161a	A > U	2355	Leu > Phe
rDEN2/4Δ30(CME)	M	743	G > A	216	Gly > Glu
	E	1493	C > U	466	Ser > Phe
	NS4B	7544b	C > T	2483	Ala > Val
rDEN2/4(ME)	E	1065	U > C	322	Phe > Leu
	NS4B	7163a	A > U	2354	Leu > Phe
rDEN2/4Δ30(ME)	NS4B	7163a	A > C	2354	Leu > Phe
aSame nucleotide position as 7163 in rDEN4.
bSame nucleotide position as 7546 in rDEN4.

TABLE 30
Nucleotide (nt) length differences for DEN chimeric viruses
compared to rDEN4.
rDEN	nt difference		Amino
chimeric	from rDEN4	ORF start	acid length
virus	(following CME region)	(nt position)	C	M	E
1/4 ME	0	102	113	166	495
1/4 CME	+3	102	114	166	495
2/4 ME	0	102	113	166	495
2/4 CME	−2	97	114	166	495
3/4 ME	−6	102	113	166	493
3/4 CME	−3	102	114	166	493
rDEN4	—	102	113	166	495

Results of a safety, immunogenicity, and efficacy study in monkeys are presented in Table 31. Monkeys inoculated with wild-type DEN2 were viremic for approximately 5 days with a mean peak titer of 2.1 log₁₀PFU/ml, while monkeys inoculated with any of the chimeric DEN2 viruses were viremic for 1.2 days or less and had a mean peak titer of less than 1.0 log₁₀PFU/ml. This reduction in the magnitude and duration of viremia clearly indicates that the chimeric viruses containing either the CME or ME proteins of DEN2 were more attenuated than the parental DEN2 NGC virus. Neither the animals receiving the wild-type DEN2 nor the DEN2/4 chimeric viruses were ill. The decreased replication of the attenuated viruses in monkeys is accompanied by a reduction in the immune response of inoculated monkeys. This is indicated in Table 31 by approximately a 5-fold reduction in the level of neutralizing antibody following inoculation with the chimeric viruses in comparison to titers achieved in animals inoculated with wild-type virus. Addition of the Δ30 mutation to the CME chimeric virus further attenuated the virus, such that rDEN2/4Δ30(CME) did not replicate in monkeys to a detectable level and did not induce a detectable immune response. This virus appeared over-attenuated, and if similar results were seen in humans, this virus would not be suitable for use as a vaccine. However, addition of the Δ30 mutation to the ME chimeric virus did not further attenuate this chimeric virus and the resulting rDEN2/4Δ30(ME) virus appears satisfactorily attenuated and immunogenic for use as a vaccine.

TABLE 31
Chimerization between dengue virus types 2 and 4 results in
recombinant viruses which are attenuated for rhesus monkeys.
				Mean peak	Geometric mean
			Mean no.	virus titer	neutralizing
			days with	(log10	antibody titer
Group*	Virus	n	viremia	pfu/ml)	(reciprocal)
1	rDEN2/4 (CME)	6	1.2	0.9	50
2	rDEN2/4Δ30 (CME)	8	0	<0.7	<5
3	rDEN2/4 (ME)	4	1.0	0.8	76
4	rDEN2/4Δ30 (ME)	4	0.3	0.7	62
5	DEN2 NGC	6	5.5	2.1	312
*Rhesus monkeys were inoculated subcutaneously with 5.0 log10 PFU of virus. Serum samples were collected daily for 10 days. Serum for neutralization assay was collected on day 28. Serum samples obtained before virus inoculation had a neutralizing antibody titer of <5.

As described in the previous examples, SCID mice transplanted with the HuH-7 cells are a sensitive model for the evaluation of dengue virus attenuation. Each chimeric DEN2/4 virus was inoculated into groups of SCID-HuH-7 mice and levels of virus in the serum were determined (Table 32). Chimeric viruses replicated to levels between 20- and 150-fold lower than either of the parental viruses (rDEN4 and DEN2-NGC). CME chimeric viruses were slightly more attenuated than the comparable ME chimeric viruses, with the Δ30 mutation providing a 0.5 log₁₀ reduction in replication. This level of attenuation by the Δ30 mutation was similar to that observed previously for rDEN4Δ30.

TABLE 32
Chimerization between dengue virus types 2 and 4 results in
recombinant viruses which are attenuated for HuH-7-SCID mice.
	No. of	Mean peak virus titer	Statistical
Virusa	mice	(log10 pfu/ml ± SE)	groupb
rDEN4	32	6.3 ± 0.2	A
DEN2-NGC	9	6.1 ± 0.2	A
rDEN2/4 (CME)	7	4.4 ± 0.3	B
rDEN2/4Δ30 (CME)	7	3.9 ± 0.3	B
rDEN2/4 (ME)	6	4.8 ± 0.5	B
rDEN2/4Δ30 (ME)	9	4.3 ± 0.2	B
aGroups of HuH-7-SCID mice were inoculated into the tumor with 4.0 log10 PFU of the indicated virus. Serum was collected on day 7 and virus titer was determined in Vero cells.
bMean peak titers were assigned to statistical groups using the Tukey post-hoc test (P < 0.05). Groups with the same letter designation are not significantly different.

To evaluate the replication levels of each DEN2/4 chimeric virus in mosquitoes, two different genera of mosquitoes were experimentally infected. Aedes aegypti were infected by ingesting a virus-containing blood meal. By evaluating the presence of virus antigen in both the midgut and head tissue, infectivity could be determined for the local tissues (midgut), and the ability of virus to disseminate and replicate in tissues beyond the midgut barrier (head) could also be measured. The presence of virus in the head is limited by the ability of the ingested virus to replicate in the midgut and then disseminate to the salivary glands in the head, as well as the innate ability of the virus to replicate in the salivary glands. Intrathoracic inoculation of virus into Toxorhynchites splendens bypasses the mosquito midgut barrier. Parental viruses rDEN4 and DEN2-NGC readily infect Ae. aegypti and T splendens (Table 33), with DEN2-NGC appearing to be much more infectious in T. splendens. Each of the rDEN2/4 chimeric viruses was also tested in both mosquito types. In many cases it was not possible to inoculate Ae. aegypti with an undiluted virus stock of sufficient titer to achieve a detectable infection due to the very low infectivity of several of the viruses. Nevertheless, it is clear that the rDEN2/4 chimeric viruses are less infectious for the midgut and head. Parental viruses rDEN4 and DEN2-NGC, administered at a maximum dose of approximately 4.0 log₁₀PFU, were detectable in 74% and 94% of midgut preparations, and 32% and 71% of head preparations, respectively. Among the chimeric viruses, the highest level of infectivity, as observed for rDEN2/4Δ30 (CME), resulted in only 26% infected midgut samples and 6% head samples. In the more permissive T. splendens, the rDEN2/4 chimeric viruses were generally less infectious than either parental virus, with CME chimeric viruses being less infectious than ME viruses. It has previously been reported for DEN4 that the Δ30 mutation does not have a discernable effect on virus infectivity in T. splendens similar to that observed here for the rDEN2/4 chimeric viruses (Troyer, J. M. et al. 2001 Am J Trop Med Hyg 65:414-419).

TABLE 33
Dengue 2/4 chimeric viruses are less infectious compared to
either parental virus strain in mosquitoes
	Toxorhynchites splendens	Aedes aegypti
	(intrathoracic inoculation)	(oral infection)
	Dosea	No.	%	Dosec	No.	% infectedd
Virus	log10 pfu	tested	infectedb	log10 pfu	tested	Midgut	Head
rDEN4	3.3	6	83	3.8	38	74	32
	2.3	7	57	2.8	15	26	6
	1.3	6	0	1.8	20	10	5
			MID50 = 2.2			MID50 = 3.4	MID50 ≧ 4.1
DEN2-NGC	2.5	5	100	4.0	17	94	71
	1.2	15	93	3.0	25	36	16
	0.2	4	75	2.0	30	0	0
	0.02	8	38			MID50 = 3.2	MID50 = 3.6
			MID50 = 0.5
rDEN2/4 (CME)	3.9	9	11	4.4	11	9	0
	2.9	5	0	3.4	10	0	0
			MID50 ≧ 4.3			MID50 ≧ 4.9	Nce
rDEN2/4Δ30	3.5	6	17	4.0	15	26	6
(CME)	2.5	6	17	3.0	10	0	0
			MID50 ≧ 3.9			MID50 ≧ 4.3	MID50 ≧ 4.5
rDEN2/4 (ME)	3.4	6	100	3.9	23	4	0
	2.4	5	20			MID50 ≧ 4.4	Nc
	1.4	5	0
			MID50 = 2.8
rDEN2/4Δ30	2.6	11	9	3.1	30	0	0
(ME)			MID50 ≧ 3.0			nc	Nc
aAmount of virus present in 0.22 μl inoculum.
bPercentage of mosquitoes with IFA detectable antigen in head tissue prepared 14 days after inoculation.
cVirus titer ingested, assuming a 2 μl bloodmeal.
dPercentage of mosquitoes with IFA detectable antigen in midgut or head tissue prepared 21 days after oral infection. When virus infection was detected, but did not exceed a frequency of 50% at the highest dose of virus ingested, the MID50 was estimated by assuming that a 10-fold more concentrated virus dose would infect 100% of the mosquitoes.
enc = not calculated, since virus antigen was not detected.

Chimerization of the DEN2 structural genes with rDEN4Δ30 virus resulted in a virus, rDEN2/4Δ30(CME), that had decreased replication in Vero cells compared to either parent virus. To evaluate Vero cell adaptation mutations (Blaney, J. E. et al. 2002 Virology 300:125-139) as a means of increasing the virus yield of a DEN vaccine candidate in Vero cells, selected mutations were introduced into this chimeric virus. Accordingly, rDEN2/4Δ30(CME) viruses bearing adaptation mutations were recovered, terminally diluted, and propagated in C6/36 cells to determine if the virus yield in Vero cells could be increased.

rDEN2/4Δ30(CME) viruses bearing Vero cell adaptation mutations were generated as follows. DNA fragments were excised from rDEN4 cDNA constructs encompassing single or double DEN4 Vero cell adaptation mutations and introduced into the cDNA clone of rDEN2/4Δ30(CME). The presence of the Vero cell adaptation mutation was confirmed by sequence analysis, and RNA transcripts derived from the mutant cDNA clones were transfected, terminally diluted, and propagated in C6/36 cells.

For evaluation of growth kinetics, Vero cells were infected with the indicated viruses at a multiplicity of infection (MOI) of 0.01. Confluent cell monolayers in duplicate 25-cm² tissue culture flasks were washed and overlaid with a 1 ml inoculum containing the indicated virus. After a two hour incubation at 37° C., cells were washed three times in MEM and 5 ml of MEM supplemented with 2% FBS was added. A 1 ml aliquot of tissue culture medium was removed, replaced with fresh medium, and designated the day 0 time-point. At the indicated time points post-infection, 1 ml samples of tissue culture medium were removed, clarified by centrifugation, and frozen at −80° C. The level of virus replication was assayed by plaque titration in C6/36 cells and visualized by immunoperoxidase staining. The limit of detection was <0.7 log₁₀PFU/ml.

The growth properties of rDEN2/4Δ30(CME) viruses bearing single Vero cell adaptation mutations at NS4B-7153, -7162, -7163, -7182, NS5-7630 or three combinations of mutations were compared in Vero cells with rDEN2/4Δ30 (CME) virus (FIG. 10). Without an introduced Vero cell adaptation mutation, rDEN2/4Δ30(CME) virus yield peaked at 4.4 log₁₀PFU/ml. Each individual adaptation mutation and the combined mutations conferred a substantial increase in replication. Specifically, rDEN2/4Δ30(CME)-7182 grew to the highest titer of 7.1 log₁₀PFU/ml, which was a 500-fold increase in yield. rDEN2/4Δ30(CME)-7162 had the lowest yield but still was increased 125-fold over the level of replication by rDEN2/4Δ30(CME) virus. Introduction of two adaptation mutations into rDEN2/4Δ30(CME) virus did not significantly increase virus yield over that of viruses bearing single Vero cell adaptation mutations. The observed increase of up to 500-fold in virus yield by the introduction of a Vero cell adaptation mutation into this chimeric vaccine candidate demonstrates the value of identifying and characterizing specific replication-promoting sequences in DEN viruses.

These results have particular significance for the development of a live attenuated dengue virus vaccine. First, it is clear that chimerization leads to attenuation of the resulting virus, as indicated by studies in rhesus monkeys, HuH7-SCID mice and mosquitoes. Although this conclusion was not made in the previous study with DEN2/DEN4 or DEN1/DEN4 chimeric viruses (Bray, M. et al. 1996 J Virol 70:4162-6), careful examination of the data would suggest that the chimeric viruses are more attenuated in monkeys compared to the wild-type parent viruses. Second, the Δ30 mutation can further augment this attenuation in a chimeric-dependent manner. Specifically, in this example, chimeric viruses bearing the CME region of DEN2 were over-attenuated by the addition of Δ30, whereas the attenuation phenotype of chimeric viruses bearing just the ME region of DEN2 was unaltered by the addition of the Δ30 mutation. This unexpected finding indicates that in a tetravalent vaccine comprised of individual component viruses bearing a shared attenuating mutation, such as the Δ30 mutation, only ME chimeric viruses can be utilized since CME chimeric viruses bearing the Δ30 mutation can be over-attenuated in rhesus monkeys and might provide only limited immunogenicity in humans.

EXAMPLE 6

Generation and Characterization of Intertypic Chimeric DEN3 Viruses Containing the Δ30 Mutation

Chimeric viruses based on the DEN4 cDNA have been generated in which the CME or ME genes have been replaced with the corresponding genes derived from DEN3 (Sleman/78), a virus isolate from the 1978 dengue outbreak in the Sleman region of Indonesia (Gubler, D. J. et al. 1981 Am J Trop Med Hyg 30:1094-1099) (Appendix 2). As described in Example 5 for the DEN2 chimeric viruses, CME chimeric viruses for DEN3 were generated by replacing the BglII/XhoI region of the cDNA for either rDEN4 or rDEN4Δ30 with a similar region derived from DEN3 (Sleman/78) (FIG. 11A). Likewise, to create the ME chimeric viruses, the PstI/XhoI region of the cDNA for either rDEN4 or rDEN4Δ30 was replaced with a similar region derived from DEN3 (Sleman/78). The nucleotide and amino acid sequences of the resulting junctions are shown in FIG. 11B. The genomes of the resulting viruses were confirmed by sequence analysis of viral RNA isolated from recovered virus as previously described (Durbin, A. P et al. 2001 Am J Trop Med Hyg 65:405-13). Incidental mutations arising from virus passage in tissue culture were identified in all viruses and are listed in Table 34. Notably, each virus contained a missense mutation in NS4B corresponding to a previously identified mutation from rDEN4 and associated with adaptation to growth in Vero cells (See Table 30 for correlation of nucleotide positions between rDEN4 and chimeric viruses). All viruses replicated in Vero cells to titers in excess of 5.7 log₁₀PFU/ml, indicating that the chimeric viruses, even those containing the Δ30 mutation, replicate efficiently in cell culture, a property essential for manufacture of the vaccine.

TABLE 34
Missense mutations observed among Vero cell-grown chimeric
DEN3/4 viruses
				Amino	Amino
		Nucleotide	Nucleotide	acid	acid
Virus	Gene	position	change	position	change
rDEN3/4Δ30	M	825	T > C	242	Phe > Leu
(CME)	E	1641	C > T	514	Leu > Phe
	E	2113	A > G	671	Lys > Arg
	NS4B	7159a	T > C	2353	Leu > Ser
rDEN3/4(ME)	M	460	A > G	120	Asp > Gly
	NS4B	7177b	G > U	2359	Gly > Val
	NS5	7702	C > U	2534	Ser > Phe
rDEN3/4Δ30	E	1432	A > U	444	Gln > Leu
(ME)	NS4B	7156a	U > C	2352	Leu > Ser
	NS5	8692	A > C	2864	Asn > His
aSame nucleotide position as 7162 in rDEN4.
bSame nucleotide position as 7183 in rDEN4.

As described in the previous examples, SCID mice transplanted with HuH-7 cells are a sensitive model for the evaluation of dengue virus attenuation. Each chimeric DEN3/4 virus was inoculated into groups of SCID-HuH-7 mice and levels of virus in the serum were determined (Table 35). While chimeric virus rDEN3/4 (CME) was not attenuated, the remaining chimeric viruses replicated to levels between 40- and 400-fold lower than either of the parental viruses (rDEN4 and DEN3-Sleman/78). In the CME chimeric virus, the Δ30 mutation providing a remarkable 2.7 log₁₀ reduction in replication. This level of attenuation conferred by the Δ30 mutation in the CME chimeric virus was much greater than that observed previously for rDEN4Δ30. The rDEN3/4 (ME) virus was 100-fold reduced in replication compared to either parent virus indicating that the ME chimerization was attenuating per se. Addition of the Δ30 mutation to rDEN3/4 (ME) did not result in additional attenuation.

TABLE 35
Chimerization between dengue virus types 3 and 4 results in
recombinant viruses which are attenuated for HuH-7-SCID mice.
	No. of	Mean peak virus titer	Statistical
Virusa	mice	(log10 pfu/ml ± SE)	groupb
rDEN4	32	6.3 ± 0.2	A
DEN3-Sleman/78	23	6.4 ± 0.2	A
rDEN3/4 (CME)	7	6.4 ± 0.6	A
rDEN3/4Δ30 (CME)	5	3.7 ± 0.4	B
rDEN3/4 (ME)	6	4.2 ± 0.7	B
rDEN3/4Δ30 (ME)	7	4.7 ± 0.4	A, B
aGroups of HuH-7-SCID mice were inoculated into the tumor with 4.0 log10 PFU of the indicated virus. Serum was collected on day 7 and virus titer was determined in Vero cells.
bMean peak titers were assigned to statistical groups using the Tukey post-hoc test (P < 0.05). Groups with the same letter designation are not significantly different.

Evaluation of the replication and immunogenicity of the DEN3 chimeric recombinant viruses and wild-type DEN3 virus in monkeys was performed as described in Example 5. Results of this safety and immunogenicity study in monkeys are presented in Table 36. Monkeys inoculated with rDEN3/4(CME) and wild-type DEN (Sleman/78) were viremic for approximately 2 days with a mean peak titer of between 1.6 and 1.8 log₁₀PFU/ml, respectively, indicating that chimerization of the CME structural genes of DEN3 did not lead to attenuation of virus replication, a different pattern than that observed for DEN2 chimerization (Table 31). However, chimerization of the ME structural genes resulted in attenuated viruses with undetectable viremia in monkeys, although all monkeys seroconverted with a greater than 10-fold increase in serum antibody levels. As expected for an attenuated virus, the immune response, as measured by neutralizing antibody titer, was lower following inoculation with any of the chimeric viruses compared to inoculation with wt DEN3 (Sleman/78), yet sufficiently high to protect the animals against wtDEN3 virus challenge (Table 37). It is clear that addition of the Δ30 mutation to rDEN3/4(CME) was capable of further attenuating the resulting virus rDEN3/4Δ30(CME).

TABLE 36
The Δ30 mutation further attenuates rDEN3/4(CME) for rhesus monkeys
				Geometric mean
			Mean peak	serum neutralizing
		Mean no.	virus titer	antibody
		of viremic	(log10	titer (reciprocal
	No. of	days per	PFU/ml ±	dilution)
Virusa	monkeys	monkeyb	SE)	Day 0	Day 28
DEN3	4	2.3	1.8	<5	707
(Sleman/78)
rDEN3/4	4	2.0	1.6	<5	211
(CME)
rDEN3/4Δ30	4	0	<1.0	<5	53
(CME)
rDEN3/4	4	0	<1.0	<5	70
(ME)
rDEN3/4Δ30	4	0	<1.0	<5	58
(ME)
aGroups of rhesus monkeys were inoculated subcutaneously with 105 PFU of the indicated virus in a 1 ml dose. Serum was collected on days 0 to 6, 8, 10, 12, and 28. Virus titer was determined by plaque assay in Vero cells.
bViremia was not detected in any monkey after day 4.

TABLE 37
rDEN3/4 chimeric viruses protect rhesus monkeys from
wt DEN3 virus challenge
				Geometric
				mean serum
				neutralizing
		Mean no. of	Mean peak	antibody titer
		viremic days	virus titer	(reciprocal
		per monkey	(log10	dilution)
	No. of	after rDEN3	PFU/ml ±	Day	Day
Virusa	monkeys	challenge	SE)	28	56
Mock	2	5.0	2.5 ± 0.4	<5	372
DEN3 (Sleman/78)	4	0	<1.0	707	779
rDEN3/4 (CME)	4	0	<1.0	211	695
rDEN3/4Δ30 (CME)	4	0.8	1.1 ± 0.2	53	364
rDEN3/4 (ME)	4	0	<1.0	70	678
rDEN3/4Δ30 (ME)	4	0	<1.0	58	694
a28 days after primary inoculation with the indicated viruses, rhesus monkeys were challenged subcutaneously with 10 PFU DEN3 (Sleman/78) virus in a 1 ml dose. Serum was collected on days 28 to 34, 36, 38, and 56. Virus titer was determined by plaque assay in Vero cells.

To evaluate the replication levels of each DEN3/4 chimeric virus in mosquitoes, Aedes aegypti were infected by ingesting a virus-containing blood meal (Table 38). Parental viruses rDEN4 and DEN3 (Sleman/78) readily infect Ae. aegypti. Each of the rDEN3/4 chimeric viruses was also tested. In many cases it was not possible to infect Ae. aegypti with an undiluted virus stock of sufficient titer to achieve a detectable infection due to the very low infectivity of several of the viruses. At a dose of approximately 2.8-2.9 log₁₀PFU, rDEN4, DEN3 (Sleman/78), and rDEN3/4(CME) were equally infectious and disseminated to the head with equal efficiency. For the remaining chimeric viruses, infection was not detectable even at a dose of 3.4 log₁₀PFU, indicating that replication of rDEN3/4(ME) and rDEN3/4Δ30(CME) is restricted in Ae. aegypti. By comparing infectivity of rDEN3/4(CME) and rDEN3/4Δ30(CME), it is clear that the Δ30 mutation is capable of further attenuating the chimeric virus for mosquitoes.

TABLE 38
Ability of DEN3/4 chimeric viruses to infect Aedes aegypti fed an
infectious bloodmeal.
		No.
	Dose	Mosqui-	No. (%)	No. (%)
	Ingested	toes	Midgut	Disseminated
Virus Tested	(log10 pfu)a	Tested	Infectionsb,c,d	Infectionse
rDEN4	3.8	18	14 (77%)	2 (14%)
	2.8	20	7 (34%)	2 (10%)
	1.8	18	0	0
			MID50 = 3.4	MID50 ≧ 4.4
DEN3	2.9	16	3 (18%)	2 (12%)
(Sleman)	1.9	10	1 (10%)	0
			MID50 ≧ 3.5	MID50+0≧ 3.5
rDEN3/4	3.9	20	6 (30%)	2 (10%)
(CME)	2.9	18	4 (22%)	0
	1.9	13	1 (7%)	0
			MID50 ≧ 4.2	MID50 ≧ 4.5
DEN3/4Δ30	3.3	20	0	0
(CME)			MID50 ≧ 4.3	MID50 ≧ 4.3
DEN3/4	3.4	15	0	0
(ME)			MID50 ≧ 4.4	MID50 ≧ 4.4
aAmount of virus ingested, assuming a 2μ bloodmeal.
bNumber (percentage) of mosquitoes with detectable dengue virus in midgut tissue; mosquitoes were assayed 21 days post feed, and dengue virus antigen was identified by IFA.
cWhen infection was detected, but did not exceed a frequency of 50% at the highest dose of virus ingested, the MID50 was estimated by assuming that a 10-fold more concentrated virus dose would infect 100% of the mosquitoes.
dWhen no infection was detected, the MID50 was assumed to be greater than a 10-fold higher dose of virus than the one used.
eNumber (percentage) of mosquitoes with detectable dengue virus antigen in both midgut and head tissue.

EXAMPLE 7

Generation and Characterization of Intertypic Chimeric DEN1 Viruses Containing the Δ30 Mutation

Chimeric viruses based on the DEN4 cDNA have been generated in which the CME or ME genes have been replaced with the corresponding genes derived from DEN1 (Puerto Rico/94), a virus isolate from a 1994 dengue outbreak in Puerto Rico (Appendices 3 and 4). As described in Example 4 for the DEN2 chimeric viruses, CME chimeric viruses for DEN1 were generated by replacing the BglII/XhoI region of the cDNA for either rDEN4 or rDEN4Δ30 with a similar region derived from DEN1 (Puerto Rico/94) (FIG. 12A). Likewise, to create the ME chimeric viruses, the PstI/XhoI region of the cDNA for either rDEN4 or rDEN4Δ30 was replaced with a similar region derived from DEN1 (Puerto Rico/94). The nucleotide and amino acid sequences of the resulting junctions are shown in FIG. 12B.

For transcription and generation of virus, chimeric cDNA clones were linearized and used as template in a transcription reaction using SP6 RNA polymerase as described. Transcripts were introduced into C6/36 mosquito cells using liposome-mediated transfection and recombinant dengue virus was harvested between day 7 and 14. Viruses were subsequently grown in Vero cells and biologically cloned by terminal dilution in Vero cells. All viruses replicated in Vero cells to titers in excess of 6.0 log₁₀PFU/ml, indicating that the chimeric viruses, even those containing the Δ30 mutation, replicate efficiently in cell culture. Genomic sequence analysis is currently underway to identify incidental mutations arising from virus passage in tissue culture.

To evaluate the replication levels of DEN1/4(CME) and rDEN1/4Δ30(CME) chimeric virus in mosquitoes, Aedes aegypti were infected by ingesting a virus-containing blood meal (Table 39). Parental virus rDEN4 infects Ae. aegypti with an MID50 of 4.0 log₁₀PFU. However, parental virus DEN1(Puerto Rico/94), is unable to infect Ae. aegypti at a dose of up to 3.4 log₁₀PFU. Thus CME chimeric viruses DEN1/4 and rDEN1/4Δ30 share this inability to infect Ae. aegypti. Therefore, it is unnecessary in Ae. aegypti to evaluate the effect of the Δ30 mutation on the infectivity of the DEN1/4 chimeric viruses, in a manner similar to that used for the DEN2/4 and DEN3/4 chimeric viruses.

TABLE 39
Inability of DEN1/4 chimeric viruses to infect Aedes aegypti fed
an infectious bloodmeal.
		No.
	Dose	Mosqui-	No. (%)	No. (%)
Virus	ingested	toes	Midgut	Disseminated
tested	(log10 pfu)a	Tested	Infectionsb,c,d	Infectionse
rDEN4	4.3	21	18 (85%)	8 (44%)
	3.3	15	3 (20%)	0
	2.3	20	0	0
			MID50 = 4.0	MID50 ≧ 4.3
DEN1	3.4	21	0	0
(Puerto Rico/94)			MID50 ≧ 4.4	MID50 ≧ 4.4
rDEN 1/4	3.8	20	0	0
(CME)			MID50 ≧ 4.8	MID50 ≧ 4.8
rDEN1/4Δ30	2.8	20	0	0
(CME)			MID50 ≧ 3.8	MID50 ≧ 3.8
aAmount of virus ingested, assuming a 2μ bloodmeal.
bNumber (percentage) of mosquitoes with detectable dengue virus in midgut tissue; mosquitoes were assayed 21 days post feed, and dengue virus antigen was identified by IFA.
cWhen infection was detected, but did not exceed a frequency of 50% at the highest dose of virus ingested, the MID50 was estimated by assuming that a 10-fold more concentrated virus dose would infect 100% of the mosquitoes.
dWhen no infection was detected, the MID50 was assumed to be greater than a 10-fold higher dose of virus than the one used.
eNumber (percentage) of mosquitoes with detectable dengue virus antigen in both midgut and head tissue.

As described in the previous examples, SCID mice transplanted with the HuH-7 cells are a sensitive model for the evaluation of dengue virus attenuation. Each chimeric DEN1/4 virus was inoculated into groups of SCID-HuH-7 mice and levels of virus in the serum were determined (Table 40). Chimeric viruses replicated to levels between 15- and 250-fold lower than either of the parental viruses, rDEN4 and DEN1 (Puerto Rico/94). CME chimeric viruses were more attenuated than the comparable ME chimeric viruses, with the Δ30 mutation providing a 0.8 log₁₀ reduction in replication. This level of attenuation exerted by the Δ30 mutation in the CME chimeric viruses was similar to that observed previously for rDEN4Δ30. However, the attenuating effect of the Δ30 mutation in the ME chimeric viruses is indiscernible.

TABLE 40
Chimerization between dengue virus types 1 and 4 results in
recombinant viruses which are attenuated for HuH-7-SCID mice.
	No. of	Mean peak virus titer	Statistical
Virusa	mice	(log10 pfu/ml ± SE)	groupb
rDEN4	32	6.3 ± 0.2	A
DEN1	4	6.4 ± 0.2	A
(Puerto Rico/94)
rDEN1/4 (CME)	8	4.7 ± 0.2	B, C
rDEN1/4Δ30 (CME)	6	3.9 ± 0.4	C
rDEN1/4 (ME)	6	5.0 ± 0.2	B
rDEN1/4Δ30 (ME)	6	5.1 ± 0.3	B
aGroups of HuH-7-SCID mice were inoculated into the tumor with 4.0 log10 PFU of the indicated virus. Serum was collected on day 7 and virus titer was determined in Vero cells.
bMean peak titers were assigned to statistical groups using the Tukey post-hoc test (P < 0.05). Groups with the same letter designation are not significantly different.

APPENDIX 1

Nucleotide and amino acid sequence of DEN2 (Tonga/74) cDNA plasmid p2


10        20        30        40        50        60        70        80        90
100
AGTTGTTAGTCTACGTGGACCGACAAAGACAGATTCTTTGAGGGAGCTAAGCTCAACGTAGTTCTAACTGTTTTTTGATTAGAGAGCAGATCTCTGATGA
Met>

110       120       130       140       150       160       170       180       190
200
ATAACCAACGGAAAAAGGCGAGAAACACGCCTTTCAATATGCTGAAACGCGAGAGAAACCGCGTGTCAACTGTACAACAGTTGACAAAGAGATTCTCACT
AsnAsnGlnArgLysLysAlaArgAsnThrProPheAsnMetLeuLysArgGluArgAsnArgValSerThrValGlnGlnLeuThrLysArgPheSerLeu>

210       220       230       240       250       260       270       280       290
300
TGGAATGCTGCAGGGACGAGGACCACTAAAATTGTTCATGGCCCTGGTGGCATTCCTTCGTTTCCTAACAATCCCACCAACAGCAGGGATATTAAAAAGA
GlyMetLeuGlnGlyArgGlyProLeuLysLeuPheMetAlaLeuValAlaPheLeuArgPheLeuThrIleProProThrAlaGlyIleLeuLysArg>

310       320       330       340       350       360       370       380       390
400
TGGGGAACAATTAAAAAATCAAAGGCTATTAATGTTCTGAGAGGCTTCAGGAAGAGATTTGGAAGGATGCTGAATATCTTAAACAGGAGACGTAGAACTG
TrpGlyThrIleLysLysSerLysAlaIleAsnValLeuArgGlyPheArgLysGluIleGlyArgMetLeuAsnIleLeuAsnArgARgArgArgThr>

410       420       430       440       450       460       470       480       490
500
TAGGCATGATCATCATGCTGACTCCAACAGTGATGGCGTTTCATCTGACCACACGCAACGGAGAACCACACATGATTGTCAGTAGACAAGAAAAAGGGAA
ValGlyMetIleIleMetLeuThrProThrValMetAlaPheHisLeuThrThrArgAsnGlyGluProHisMetIleValSerArgGlnGluLysGlyLys>

510       520       530       540       550       560       570       580       590
600
AAGCCTTCTGTTCAAGACAAAGGATGGCACGAACATGTGTACCCTCATGGCCATGGACCTTGGTGAGTTGTGTGAAGACACAATCACGTATAAATGTCCT
SerLeuLeuPheLysThrLysAspGlyThrAsnMetCysThrLeuMetAlaMetAspLeuGlyGluLeuCysGluAspThrIleThrTyrLysCysPro>

610       620       630       640       650       660       670       680       690
700
TTTCTCAAGCAGAACGAACCAGAAGACATAGATTGTTGGTGCAACTCCACGTCCACATGGGTAACTTATGGGACATGTACCACCACAGGAGAGCACAGAA
PheLeuLysGlnAsnGluProGluAspIleAspCysTrpCysAsnSerThrSerThrTrpValThrTyrGlyThrCysThrThrThrGlyGluHisArg>

710       720       730       740       750       760       770       780       790
800
GAGAAAAAAGATCAGTGGCGCTTGTTCCACACGTGGGAATGGGATTGGAGACACGAACTGAAACATGGATCTCATCAGAAGGGGCCTGGAAACATGCCCA
ArgGluLysArgSerValAlaLeuValProHisValGlyMetGlyLeuGluThrArgThrGluThrTrpMetSerSerGluGlyAlaTrpLysHisAlaGln>

810       820       830       840       850       860       870       880       890
900
GAGAATTGAAACTTGGATTCTGAGACATCCAGGCTTTACCATAATGGCCGCAATCCTGGCATACACCATAGGGACGACGCATTTCCAAAGAGTCCTGATA
ArgIleGluThrTrpIleLeuArgHisProGlyPheThrIleMetAlaAlaIleLeuAlaTyrThrIleGlyThrThrHisPheGlnArgValLeuIle>

910       920       930       940       950       960       970       980       990
1000
TTCATCCTACTGACAGCCATCGCTCCTTCAATGACAATGCGCTGCATAGGAATATCAAATAGGGACTTTGTGGAAGGAGTGTCAGGAGGGAGTTGGGTTG
PheIleLeuLeuThrAlaIleAlaProSerMetThrMetArgCysIleGlyIleSerAsnArgAspPheValGluGlyValSerGlyGlySerTrpVal>

1010      1020      1030      1040      1050      1060      1070      1080      1090
1100
ACATAGTTTTAGAACATGGAAGTTGTGTGACGACGATGGCAAAAAACAAACCAACACTGGACTTTGAACTGATAAAAACAGAAGCCAAACAACCTGCCAC
AspIleValLeuGluHisGlySerCysValThrThrMetAlaLysAsnLysProThrLeuAspPheGluLeuIleLysThrGluAlaLysGlnProAlaThr>

1110      1120      1130      1140      1150      1160      1170      1180      1190
1200
CTTAAGGAAGTACTGTATAGAGGCCAAACTGACCAACACGACAACAGACTCGCGCTGCCCAACACAAGGGGAACCCACCCTGAATGAAGAGCAGGACAAA
LeuArgLysTyrCysIleGluAlaLysLeuThrAsnThrThrThrAspSerArgCysProThrGlnGlyGluProThrLeuAsnGluGluGlnAspLys>

1210      1220      1230      1240      1250      1260      1270      1280      1290
1300
AGGTTTGTCTGCAAACATTCCATGGTAGACAGAGGATGGGGAAATGGATGTGGATTGTTTGGAAAAGGAGGCATCGTGACCTGTGCTATGTTCACATGCA
ArgPheValCysLysHisSerMetValAspArgGlyTrpGlyAsnGlyCysGlyLeuPheGlyLysGlyGlyIleValThrCysAlaMetPheThrCys>

1310      1320      1330      1340      1350      1360      1370      1380      1390
1400
AAAAGAACATGGAAGGAAAAATTGTTCAGCCAGAAAACCTGGAATACACTGTCGTGATAACACCTCATTCAGGGGAAGAACATGCAGTGGGAAATGACAC
LysLysAsnMetGluGlyLysIleValGlnProGluAsnLeuGluTyrThrValValIleThrProHisSerGlyGluGluHisAlaValGlyAsnAspThr>

1410      1420      1430      1440      1450      1460      1470      1480      1490
1500
AGGAAAACATGGTAAAGAAGTCAAGATAACACCACAGAGCTCCATCACAGAGGCGGAACTGACAGGCTATGGCACTGTTACGATGGAGTGCTCTCCAAGA
GlyLysHisGlyLysGluValLysIleThrProGlnSerSerIleThrGluAlaGluLeuThrGlyTyrGlyThrValThrMetGluCysSerProArg>

1510      1520      1530      1540      1550      1560      1570      1580      1590
1600
ACGGGCCTCGACTTCAATGAGATGGTGTTGCTGCAAATGGAAGACAAAGCCTGGCTGGTGCACAGACAATGGTTCCTAGACCTACCGTTGCCATGGCTGC
ThrGlyLeuAspPheAsnGluMetValLeuLeuGlnMetGluAspLysAlaTrpLeuValHisArgGlnTrpPheLeuAspLeuProLeuProTrpLeu>

1610      1620      1630      1640      1650      1660      1670      1680      1690
1700
CCGGAGCAGACACACAAGGATCAAATTGGATACAGAAAGAAACACTGGTCACCTTCAAAAATCCCCATGCGAAAAAACAGGATGTTGTTGTCTTAGGATC
ProGlyAlaAspThrGlnGlySerAsnTrplleGlnLysGluThrLeuValThrPheLysAsnProHisAlaLysLysGlnAspValValValLeuGlySer>

1710      1720      1730      1740      1750      1760      1770      1780      1790
1800
CCAAGAGGGGGCCATGCATACAGCACTCACAGGGGCTACGGAAATCCAGATGTCATCAGGAAACCTGCTGTTCACAGGACATCTCAAGTGCAGGCTGAGA
GlnGluGlyAlaMetHisThrAlaLeuThrGlyAlaThrGluIleGlnMetSerSerGlyAsnLeuLeuPheThrGlyHisLeuLysCysArgLeuArg>

1810      1820      1830      1840      1850      1860      1870      1880      1890
1900
ATGGACAAATTACAACTTAAAGGGATGTCATACTCCATGTGCACAGGAAAGTTTAAAATTGTGAAGGAAATAGCAGAAACACAACATGGAACAATAGTCA
MetAspLysLeuGlnLeuLysGlyMetSerTyrSerMetCysThrGlyLysPheLysIleValLysGluIleAlaGluThrGlnHisGlyThrIleVal>

1910      1920      1930      1940      1950      1960      1970      1980      1990
2000
TTAGAGTACAATATGAAGGAGACGGCTCTCCATGCAAGATCCCCTTTGAGATAATGGATCTGGAAAAAAGACATGTTTTGGGCCGCCTGATCACAGTCAA
IleArgValGlnTyrGluGlyAspGlySerProCysLysIleProPheGluIleMetAspLeuGluLysArgHisValLeuGlyArgLeuIleThrValAsn>

2010      2020      2030      2040      2050      2060      2070      2080      2090
2100
CCCAATTGTAACAGAAAAGGACAGTCCAGTCAACATAGAAGCAGAACCTCCATTCGGAGACAGCTACATCATCATAGGAGTGGAACCAGGACAATTGAAG
ProIleValThrGluLysAspSerProValAsnIleGluAlaGluProProPheGlyAspSerTyrIleIleIleGlyValGluProGlyGlnLeuLys>

2110      2120      2130      2140      2150      2160      2170      2180      2190
2200
CTGGACTGGTTCAAGAAAGGAAGTTCCATCGGCCAAATGTTTGAGACAACAATGAGGGGAGCGAAAAGAATGGCCATTTTGGGTGACACAGCCTGGGATT
LeuAspTrpPheLysLysGlySerSerIleGlyGlnMetPheGluThrThrMetArgGlyAlaLysArgMetAlaIleLeuGlyAspThrAlaTrpAsp>

2210      2220      2230      2240      2250      2260      2270      2280      2290
2300
TTGGATCTCTGGGAGGAGTGTTCACATCAATAGGAAAGGCTCTCCACCAGGTTTTTGGAGCAATCTACGGGGCTGCTTTCAGTGGGGTCTCATGGACTAT
PheGlySerLeuGlyGlyValPheThrSerIleGlyLysAlaLeuHisGlnValPheGlyAlaIleTyrGlyAlaAlaPheSerGlyValSerTrpThrMet>

2310      2320      2330      2340      2350      2360      2370      2380      2390
2400
GAAGATCCTCATAGGAGTTATCATCACATGGATAGGAATGAACTCACGTAGCACTAGTCTGAGCGTGTCACTGGTGTTAGTGGGAATCGTGACACTTTAC
LysIleLeuIleGlyValIleIleThrTrpIleGlyMetAsnSerArgSerThrSerLeuSerValSerLeuValLeuValGlyIleValThrLeuTyr>

2410      2420      2430      2440      2450      2460      2470      2480      2490
2500
TTGGGAGTTATGGTGCAGGCCGATAGTGGTTGCGTTGTGAGCTGGAAGAACAAAGAACTAAAATGTGGCAGTGGAATATTCGTCACAGATAACGTGCATA
LeuGlyValMetValGlnAlaAspSerGlyCysValValSerTrpLysAsnLysGluLeuLysCysGlySerGlyIlePheValThrAspAsnValHis>

2510      2520      2530      2540      2550      2560      2570      2580      2590
2600
CATGGACAGAACAATACAAGTTCCAACCAGAATCCCCTTCAAAACTGGCCTCAGCCATCCAGAAAGCGCATGAAGAGGGCATCTGTGGAATCCGCTCAGT
ThrTrpThrGluGlnTyrLysPheGlnProGluSerProSerLysLeuAlaSerAlaIleGlnLysAlaHisGluGluGlyIleCysGlyIleArgSerVal>

2610      2620      2630      2640      2650      2660      2670      2680      2690
2700
AACAAGACTGGAAAATCTTATGTGGAAACAGATAACATCAGAATTGAATCATATTCTATCAGAAAATGAAGTGAAACTGACCATCATGACAGGAGACATC
ThrArgLeuGluAsnLeuMetTrpLysGlnIleThrSerGluLeuAsnHisIleLeuSerGluAsnGluValLysLeuThrIleMetThrGlyAspIle>

2710      2720      2730      2740      2750      2760      2770      2780      2790
2800
AAAGGAATCATGCAGGTAGGAAAACGATCTTTGCGGCCTCAACCCACTGAGTTGAGGTATTCATGGAAAACATGGGGTAAAGCGAAAATGCTCTCCACAG
LysGlyIleMetGlnValGlyLysArgSerLeuArgProGlnProThrGluLeuArgTyrserTrpLysThrTrpGlyLysAlaLysMetLeuSerThr>

2810      2820      2830      2840      2850      2860      2870      2880      2890
2900
AACTCCACAATCAGACCTTCCTCATTGATGGTCCCGAAACAGCAGAATGCCCCAACACAAACAGAGCTTGGAATTCACTGGAAGTTGAGGACTACGGCTT
GluLeuHisAsnGlnThrPheLeuIleAspGlyProGluThrAlaGluCysProAsnThrAsnArgAlaTrpAsnSerLeuGluValGluAspTyrGlyPhe>

2910      2920      2930      2940      2950      2960      2970      2980      2990
3000
TGGAGTATTCACTACCAATATATGGCTAAGATTGAGAGAAAAGCAGGATGTATTTTGTGACTCAAACTCATGTGCAGCGGCCATAAAGGACAACAGAGCC
GlyValPheThrThrAsnIleTrpLeuArgLeuArgGluLysGlnAspValPheCysAspSerLysLeuMetSreAlaAlaIleLysAspAsnArgAla>

3010      3020      3030      3040      3050      3060      3070      3080      3090
3100
GTCCATGCTGATATGGGTTATTGGATAGAAAGCGCACTCAATGATACATGGAAGATAGAGAAAGCTTCTTTCATTGAAGTCAAAAGTTGCCACTGGCCAA
ValHisAlaAspMetGlyTryTrpIleGluSerAlaLeuAsnAspThrTrpLysIleGluLysAlaSerPheIleGluValLysSerCysHisTrpPro>

3110      3120      3130      3140      3150      3160      3170      3180      3190
3200
AGTCACACACCCTATGGAGTAATGGAGTGCTAGAAAGCGAGATGGTCATTCCAAAGAATTTCGCTGGACCAGTGTCACAACATAATAACAGACCAGGCTA
LysSerHisThrLeuTrpSerAsnGlyValLeuGluSerGluMetValIleProLysAsnPheAlaGlyProValSerGlnHisAsnAsnArgProGlyTyr>

3210      3220      3230      3240      3250      3260      3270      3280      3290
3300
TTACACACAAACAGCAGGACCTTGGCATCTAGGCAAGCTTGAGATGGACTTTGATTTCTGCGAAGGGACTACAGTGGTGGTAACCGAGAACTGTGGAAAC
TyrThrGlnThrAlaGlyProTrpHisLeuGlyLysLeuGluMetAspPheAspPheCysGluGlyThrThrValValValThrGluAsnCysGlyAsn>

3310      3320      3330      3340      3350      3360      3370      3380      3390
3400
AGAGGGCCCTCTTTAAGAACAACCACTGCCTCAGGAAAACTCATAACGGAATGGTGTTGTCGATCTTGCACACTACCACCACTAAGATACAGAGGTGAGG
ArgGlyProSerLeuArgThrThrThrAlaSerGlyLysLeuIleThrGluTrpCysCysArgSerCysThrLeuProProLeuArgTyrArgGlyGlu>

3410      3420      3430      3440      3450      3460      3470      3480      3490
3500
ATGGATGTTGGTACGGGATGGAAATCAGACCATTGAAAGAGAAAGAAGAAAATCTGGTCAGTTCTCTGGTTACAGCCGGACATGGGCAGATTGACAATTT
AspGlyCysTrpTyrGlyMetGluIleArgProLeuLysGluLysGluGluAsnLeuValSerSerLeuValThrAlaGlyHisGlyGlnIleAspAsnPhe>

3510      3520      3530      3540      3550      3560      3570      3580      3590
3600
CTCATTAGGAATCTTGGGAATGGCACTGTTCCTTGAAGAAATGCTCAGGACTCGAGTAGGAACAAAACATGCAATATTACTCGTCGCAGTTTCTTTCGTG
SerLeuGlyIleLeuGlyMetAlaLeuPheLeuGluGluMetLeuArgThrArgValGlyThrLysHisAlaIleLeuLeuValAlaValSerPheVal>

3610      3620      3630      3640      3650      3660      3670      3680      3690
3700
ACGCTAATCACAGGGAACATGTCTTTTAGAGACCTGGGAAGAGTGATGGTTATGGTGGGTGCCACCATGACAGATGACATAGGCATGGGTGTGACTTATC
ThrLeuIleThrGlyAsnMetSerPheArgAspLeuGlyArgValMetValMetValGlyAlaThrMetThrAspAspIleGlyMetGlyValThrTyr>

3710      3720      3730      3740      3750      3760      3770      3780      3790
3800
TCGCTCTACTAGCAGCTTTTAGAGTCAGACCAACCTTTGCAGCTGGACTGCTCTTGAGAAAACTGACCTCCAAGGAATTAATGATGACTACCATAGGAAT
LeuAlaLeuLeuAlaAlaPheArgValArgProThrPheAlaAlaGlyLeuLeuLeuArgLysLeuThrSerLysGluLeuMetMetThrThrIleGlyIle>

3810      3820      3830      3840      3850      3860      3870      3880      3890
3900
CGTTCTTCTCTCCCAGAGTAGCATACCAGAGACCATTCTTGAACTGACCGACGCGTTAGCTCTAGGCATGATGGTCCTCAAGATGGTGAGAAACATGGAA
ValLeuLeuSerGlnSerSerIleProGluThrIleLeuGluLeuThrAspAlaLeuAlaLeuGlyMetMetValLeuLysMetValArgAsnMetGlu>

3910      3920      3930      3940      3950      3960      3970      3980      3990
4000
AAATATCAGCTGGCAGTGACCATCATGGCTATTTTGTGCGTCCCAAATGCTGTGATATTACAGAACGCATGGAAAGTGAGTTGCACAATATTGGCAGTGG
LysTyrGlnLeuAlaValThrIleMetAlaIleLeuCysValProAsnAlaValIleLeuGlnAsnAlaTrpLysValSerCysThrIleLeuAlaVal>

4010      4020      4030      4040      4050      4060      4070      4080      4090
4100
TGTCTGTTTCCCCCCTGCTCTTAACATCCTCACAACAGAAAGCGGACTGGATACCATTAGCGTTGACGATCAAAGGTCTTAATCCAACAGCCATTTTTCT
ValSerValSerProLeuLeuLeuThrSerSerGlnGlnLysAlaAspTrpIleProLeuAlaLeuThrIleLysGlyLeuAsnProThrAlaIlePheLeu>

4110      4120      4130      4140      4150      4160      4170      4180      4190
4200
AACAACCCTCTCAAGAACCAACAAGAAAAGGAGCTGGCCTTTAAATGAGGCCATCATGGCGGTTGGGATGGTGAGTATCTTGGCCAGCTCTCTCTTAAAG
ThrThrLeuSerArgThrAsnLysLysArgSerTrpProLeuAsnGluAlaIleMetAlaValGlyMetValSerIleLeuAlaSerSerLeuLeuLys>

4210      4220      4230      4240      4250      4260      4270      4280      4290
4300
AATGACATCCCCATGACAGGACCATTAGTGGCTGGAGGGCTCCTTACTGTGTGCTACGTGCTAACTGGGCGGTCAGCCGATCTGGAATTAGAGAGAGCTA
AsnAspIleProMetThrGlyProLeuValAlaGlyGlyLeuLeuThrValCysTyrValLeuThrGlyArgSerAlaAspLeuGluLeuGluArgAla>

4310      4320      4330      4340      4350      4360      4370      4380      4390
4400
CCGATGTCAAATGGGATGACCAGGCAGAGATATCAGGTAGCAGTCCAATCCTGTCAAGAACAATATCAGAAGATGGCAGCATGTCAATAAAGAATGAAGA
ThrAspValLysTrpAspAspGlnAlaGluIleSerGlySerSerProIleLeuSerIleThrIleSerGluAspGlySerMetSerlleLysAsnGluGlu>

4410      4420      4430      4440      4450      4460      4470      4480      4490
4500
GGAAGAGCAAACACTGACTATACTCATTAGAACAGGATTGCTTGTGATCTCAGGACTCTTTCCGGTATCAATACCAATTACAGCAGCAGCATGGTATCTG
GluGluGlnThrLeuTheIleLeuIleArgThrGlyLeuLeuValIleSerGlyLeuPheProValSerIleProIleThrAlaAlaAlaTrpTyrLeu>

4510      4520      4530      4540      4550      4560      4570      4580      4590
4600
TGGGAAGTAAAGAAACAACGGGCTGGAGTGCTGTGGGATGTCCCCTCACCACCACCCGTGGGAAAAGCTGAATTGGAAGATGGAGCCTACAGAATCAAGC
TrpGluValLysLysGlnArgAlaGlyValLeuTrpAspValProSerProProProValGlyLysAlaGluLeuGluAspGlyAlaTyrArgIleLys>

4610      4620      4630      4640      4650      4660      4670      4680      4690
4700
AAAAAGGAATCCTTGGATATTCCCAGATCGGAGCTGGAGTTTACAAAGAAGGAACATTTCACACAATGTGGCACGTCACACGTGGCGCTGTCCTAATGCA
GlnLysGlyIleLeuGlyTyrSerGlnIleGlyAlaGlyValTyrLysGluGlyThrPheHisThrMetTrpHisValThrArgGlyAlaValLeuMetHis>

4710      4720      4730      4740      4750      4760      4770      4780      4790
4800
TAAGGGGAAGAGGATTGAACCATCATGGGCGGACGTCAAGAAAGACTTAATATCATATGGAGGAGGTTGGAAGCTAGAAGGAGAATGGAAAGAAGGAGAA
LysGlyLysArgIleGluProSerTrpAlaAspValLysLysAspLeuIleSerTyrGlyGlyGlyTrpLysLeuGluGlyGluTrpLysGluGlyGlu>

4810      4820      4830      4840      4850      4860      4870      4880      4890
4900
GAAGTCCAGGTCTTGGCATTGGAGCCAGGGAAAAATCCAAGAGCCGTCCAAACAAAGCCTGGCCTTTTTAGAACCAACACTGGAACCATAGGTGCCGTAT
GluValGlnValLeuAlaLeuGluProGlyLysAsnProArgAlaValGlnThrLysProGlyLeuPheArgThrAsnThrGlyThrIleGlyAlaVal>

4910      4920      4930      4940      4950      4960      4970      4980      4990
5000
CTCTGGACTTTTCCCCTGGGACGTCAGGATCTCCAATCGTCGACAAAAAAGGAAAAGTTGTAGGTCTCTATGGCAATGGTGTCGTTACAAGGAGTGGAGC
SerLeuAspPheSerProGlyThrSerGlySerProIleValAspLysLysGlyLysValValGlyLeuTyrGlyAsnGlyValValThrArgSerGlyAla>

5010      5020      5030      5040      5050      5060      5070      5080      5090
5100
ATATGTGAGTGCCATAGCTCAGACTGAAAAAAGCATTGAAGACAATCCAGAGATTGAAGATGACATCTTTCGAAAGAGAAGATTGACTATCATGGATCTC
TyrValSerAlaIleAlaGlnThrGluLysSerIleGluAspAsnProGluIleGluAspAspIlePheArgLysArgArgLeuThrIleMetAspLeu>

5110      5120      5130      5140      5150      5160      5170      5180      5190
5200
CACCCAGGAGCAGGAAAGACAAAGAGATACCTCCCGGCCATAGTCAGAGAGGCCATAAAAAGAGGCTTGAGAACACTAATCCTAGCCCCCACTAGAGTCG
HisProGlyAlaGlyLysThrLysArgTyrLeuProAlaIleValArgGluAlaIleLysArgGlyLeuArgThrLeuIleLeuAlaProThrArgVal>

5210      5220      5230      5240      5250      5260      5270      5280      5290
5300
TGGCAGCTGAAATGGAGGAAGCCCTTAGAGGACTTCCAATAAGATACCAAACTCCAGCTATCAGGGCTGAGCACACCGGGCGGGAGATTGTAGACTTAAT
ValAlaAlaGluMetGluGluAlaLeuArgGlyLeuProIleArgTyrGlnThrProAlaIleArgAlaGluHisThrGlyArgGluIleValAspLeuMet>

5310      5320      5330      5340      5350      5360      5370      5380      5390
5400
GTGTCATGCCACATTTACCATGAGGCTGCTATCACCAATCAGGGTGCCAAATTACAACCTGATCATCATGGACGAAGCCCATTTTACAGATCCAGCAAGC
CysHisAlaThrPheThrMetArgLeuLeuSerProIleArgValProAsnTyrAsnLeuIleIleMetAspGluAlaHisPheThrAspProAlaSer>

5410      5420      5430      5440      5450      5460      5470      5480      5490
5500
ATAGCAGCTAGGGGATACATCTCAACTCGAGTGGAGATGGGGGAGGCAGCTGGAATTTTTATGACAGCCACTCCTCCGGGTAGTAGAGATCCATTTCCTC
IleAlaAlaArgGlyTyrIleSerThrArgValGluMetGlyGluAlaAlaGlyIlePheMetThrAlaThrProProGlySerArgAspProPhePro>

5510      5520      5530      5540      5550      5560      5570      5580      5590
5600
AGAGCAATGCACCAATTATGGACGAAGAAAGAGAAATTCCGGAACGTTCATGGAACTCTGGGCACGAGTGGGTCACGGATTTTAAAGGAAAGACTGTCTG
GlnSerAsnAlaProIleMetAspGluGluArgGluIleProGluArgSerTrpAsnSerGlyHisGluTrpValThrAspPheLysGlyLysThrValTrp>

5610      5620      5630      5640      5650      5660      5670      5680      5690
5700
GTTTGTTCCAAGCATAAAAACCGGAAATGACATAGCAGCCTGCCTGAGAAAGAATGGAAAGAGGGTGATACAACTCAGTAGGAAGACCTTTGATTCTGAA
PheValProSerIleLysThrGlyAsnAspIleAlaAlaCysLeuArgLysAsnGlyLysArgValIleGlnLeuSerArgLysThrPheAspSerGlu>

5710      5720      5730      5740      5750      5760      5770      5780      5790
5800
TATGTCAAGACTAGAACCAATGACTGGGATTTCGTGGTTACAACTGACATCTCGGAAATGGGCGCCAACTTTAAAGCTGAGAGGGTCATAGACCCCAGAC
TyrValLysThrArgThrAsnAspTrpAspPheValValThrThrAspIleSerGluMetGlyAlaAsnPheLysAlaGluArgValIleAspProArg>

5810      5820      5830      5840      5850      5860      5870      5880      5890
5900
GCTGCATGAAACCAGTTATATTGACAGACGGCGAAGAGCGGGTGATTCTGGCAGGACCCATGCCAGTGACCCACTCTAGTGCAGCACAAAGAAGAGGGAG
ArgCysMetLysProValIleLeuThrAspGlyGluGluArgValIleLeuAlaGluProMetProValThrHisSerSerAlaAlaGlnArgArgGlyArg>

5910      5920      5930      5940      5950      5960      5970      5980      5990
6000
AATAGGAAGGAATCCAAGGAATGAAAATGATCAATATATATATATGGGGGAACCACTGGAAAATGATGAAGACTGTGCGCACTGGAAGGAAGCTAAGATG
IleGlyArgAsnProArgAsnGluAsnAspGlnTyrIleTyrMetGlyGluProLeuGluAsnAspGluAspCysAlaHisTrpLysGluAlaLysMet>

6010      6020      6030      6040      6050      6060      6070      6080      6090
6100
CTCCTAGATAATATCAACACACCTGAAGGAATCATTCCCAGCTTGTTCGAGCCAGAGCGTGAAAAGGTGGATGCCATTGACGGTGAATATCGCTTGAGAG
LeuLeuAspAsnIleAsnThrProGluGlyIleIleProSerLeuPheGluProGluArgGluLysValAspAlaIleAspGlyGluTyrArgLeuArg>

6110      6120      6130      6140      6150      6160      6170      6180      6190
6200
GAGAAGCACGGAAAACTTTTGTGGACCTAATGAGAAGAGGAGACCTACCAGTCTGGTTGGCTTATAAAGTGGCAGCTGAAGGTATCAACTACGCAGACAG
GlyGluAlaArgLysThrPheValAspLeuMetArgArgGlyAspLeuProValTrpLeuAlaTyrLysValAlaAlaGluGlyIleAsnTyrAlaAspArg>

6210      6220      6230      6240      6250      6260      6270      6280      6290
6300
AAGATGGTGTTTTGACGGAACCAGAAACAATCAAATCTTGGAAGAAAATGTGGAAGTGGAAATCTGGACAAAGGAAGGGGAAAGGAAAAAATTGAAACCT
ArgTrpCysPheAspGlyThrArgAsnAsnGlnIleLeuGluGluAsnValGluValGluIleTrpThrLysGluGlyGluArgLysLysLeuLysPro>

6310      6320      6330      6340      6350      6360      6370      6380      6390
6400
AGATGGTTAGATGCTAGGATCTACTCCGACCCACTGGCGCTAAAAGAGTTCAAGGAATTTGCAGCCGGAAGAAAGTCCCTAACCCTGAACCTAATTACAG
ArgTrpLeuAspAlaArgIleTyrSerAspProLeuAlaLeuLysGluPheLysGluPheAlaAlaGlyArgLysSerLeuThrLeuAsnLeuIleThr>

6410      6420      6430      6440      6450      6460      6470      6480      6490
6500
AGATGGGCAGACTCCCAACTTTTATGACTCAGAAGGCCAGAGATGCACTAGACAACTTGGCGGTGCTGCACACGGCTGAAGCGGGTGGAAAGGCATACAA
GluMetGlyArgLeuProThrPheMetThrGlnLysAlaArgAspAlaLeuAspAsnLeuAlaValLeuHisThrAlaGluAlaGlyGlyLysAlaTyrAsn>

6510      6520      6530      6540      6550      6560      6570      6580      6590
6600
TCATGCTCTCAGTGAATTACCGGAGACCCTGGAGACATTGCTTTTGCTGACACTGTTGGCCACAGTCACGGGAGGAATCTTCCTATTCCTGATGAGCGGA
HisAlaLeuSerGluLeuProGluThrLeuGluThrLeuLeuLeuLeuThrLeuLeuAlaThrValThrGlyGlyIlePheLeuPheLeuMetSerGly>

6610      6620      6630      6640      6650      6660      6670      6680      6690
6700
AGGGGTATGGGGAAGATGACCCTGGGAATGTGCTGCATAATCACGGCCAGCATCCTCTTATGGTATGCACAAATACAGCCACATTGGATAGCAGCCTCAA
ArgGlyMetGlyLysMetThrLeuGlyMetCysCysIleIleThrAlaSerIleLeuLeuTryTyrAlaGlnIleGlnProHisTrpIleAlaAlaSer>

6710      6720      6730      6740      6750      6760      6770      6780      6790
6800
TAATATTGGAGTTCTTTCTCATAGTCTTGCTCATTCCAGAACCAGAAAAGCAGAGGACACCTCAGGATAATCAATTGACTTATGTCATCATAGCCATCCT
IleIleLeuGluPhePheLeuIleValLeuLeuIleProGluProGluLysGlnArgThrProGlnAspAsnGlnLeuThrTyrVallleIleAlaIleLeu>

6810      6820      6830      6840      6850      6860      6870      6880      6890
6900
CACAGTGGTGGCCGCAACCATGGCAAACGAAATGGGTTTTCTGGAAAAAACAAAGAAAGACCTCGGACTGGGAAACATTGCAACTCAGCAACCTGAGAGC
ThrValValAlaAlaThrMetAlaAsnGluMetGlyPheLeuGluLysThrLysLysAspLeuGlyLeuGlyAsnIleAlaThrGlnGlnProGluSer>

6910      6920      6930      6940      6950      6960      6970      6980      6990
7000
AACATTCTGGACATAGATCTACGTCCTGCATCAGCATGGACGTTGTATGCCGTGGCTACAACATTTATCACACCAATGTTGAGACATAGCATTGAAAATT
AsnIleLeuAspIleAspLeuArgProAlaSerAlaTrpThrLeuTyrAlaValAlaThrThrPheIleThrProMetLeuArgHisSerIleGluAsn>

7010      7020      7030      7040      7050      7060      7070      7080      7090
7100
CCTCAGTAAATGTGTCCCTAACAGCCATAGCTAACCAAGCCACAGTGCTAATGGGTCTCGGAAAAGGATGGCCATTGTCAAAGATGGACATTGGAGTTCC
SerSerValAsnValSerLeuThrAlaIleAlaAsnGlnAlaThrValLeuMetGlyLeuGlyLysGlyTrpProLeuSerLysMetAspIleGlyValPro>

7110      7120      7130      7140      7150      7160      7170      7180      7190
7200
CCTCCTTGCTATTGGGTGTTACTCACAAGTCAACCCTATAACCCTCACAGCGGCTCTTCTTTTATTGGTAGCACATTATGCCATCATAGGACCGGGACTT
LeuLeuAlaIleGlyCysTyrSerGlnValAsnProIleThrLeuThrAlaAlaLeuLeuLeuLeuValAlaHisTyrAlaIleIleGlyProGlyLeu>

7210      7220      7230      7240      7250      7260      7270      7280      7290
7300
CAAGCCAAAGCAACTAGAGAAGCTCAGAAAAGAGCAGCAGCGGGCATCATGAAAAACCCAACTGTGGATGGAATAACAGTGATAGATCTAGATCCAATAC
GlnAlaLysAlaThrArgGluAlaGlnLysArgAlaAlaAlaGlyIleMetLysAsnProThrValAspGlyIleThrValIleAspLeuAspProIle>

7310      7320      7330      7340      7350      7360      7370      7380      7390
7400
CCTATGATCCAAAGTTTGAAAAGCAGTTGGGACAAGTAATGCTCCTAGTCCTCTGCGTGACCCAAGTGCTGATGATGAGGACTACGTGGGCTTTGTGTGA
ProTyrAspProLysPheGluLysGlnLeuGlyGlnValMetLeuLeuValLeuCysValThrGlnValLeuMetMetArgThrThrTrpAlaLeuCysGlu>

7410      7420      7430      7440      7450      7460      7470      7480      7490
7500
AGCCTTAACTCTAGCAACTGGACCCGTGTCCACATTGTGGGAAGGAAATCCAGGGAGATTCTGGAACACAACCATTGCAGTGTCAATGGCAAACATCTTT
AlaLeuThrLeuAlaThrGlyProValSerThrLeuTrpGluGlyAsnProGlyArgPheTrpAsnThrThrIleAlaValSerMetAlaAsnIlePhe>

7510      7520      7530      7540      7550      7560      7570      7580      7590
7600
AGAGGGAGTTACCTGGCTGGAGCTGGACTTCTCTTTTCTATCATGAAGAACACAACCAGCACGAGAAGAGGAACTGGCAATATAGGAGAAACGTTAGGAG
ArgGlySerTyrLeuAlaGlyAlaGlyLeuLeuPheSerIleMetLysAsnThrThrSerThrArgArgGlyThrGlyAsnIleGlyGluThrLeuGly>

7610      7620      7630      7640      7650      7660      7670      7680      7690
7700
AGAAATGGAAAAGCAGACTGAACGCATTGGGGAAAAGTGAATTCCAGATCTACAAAAAAAGTGGAATTCAAGAAGTGGACAGAACCTTAGCAAAAGAAGG
GluLysTrpLysSerArgLeuAsnAlaLeuGlyLysSerGluPheGlnIleTyrLysLysSerGlyIleGlnGluValAspArgThrLeuAlaLysGluGly>

7710      7720      7730      7740      7750      7760      7770      7780      7790
7800
CATTAAAAGAGGAGAAACGGATCATCACGCTGTGTCGCGAGGCTCAGCAAAACTGAGATGGTTCGTTGAAAGGAATTTGGTCACACCAGAAGGGAAAGTA
IleLysArgGlyGluThrAspHisHisAlaValSerArgGlySerAlaLysLeuArgTrpPheValGluArgAsnLeuValThrProGluGlyLysVal>

7810      7820      7830      7840      7850      7860      7870      7880      7890
7900
GTGGACCTTGGTTGTGGCAGAGGGGGCTGGTCATACTATTGTGGAGGATTAAAGAATGTAAGAGAAGTTAAAGGCTTAACAAAAGGAGGACCAGGACACG
ValAspLeuGlyCysGlyArgGlyGlyTrpSerTyrTyrCysGlyGlyLeuLysAsnValArgGluValLysGlyLeuThrLysGlyGlyProGlyHis>

7910      7920      7930      7940      7950      7960      7970      7980      7990
8000
AAGAACCTATCCCTATGTCAACATATGGGTGGAATCTAGTACGCTTACAGAGCGGAGTTGATGTTTTTTTTGTTCCACCAGAGAAGTGTGACACATTGTT
GluGluProIleProMetSerThrTyrGlyTrpAsnLeuValArgLeuGlnSerGlyValAspValPhePheValProProGluLysCysAspThrLeuLeu>

8010      8020      8030      8040      8050      8060      8070      8080      8090
8100
GTGTGACATAGGGGAATCATCACCAAATCCCACGGTAGAAGCGGGACGAACACTCAGAGTCCTCAACCTAGTGGAAAATTGGCTGAACAATAACACCCAA
CysAspIleGlyGluSerSerProAsnProThrValGluAlaGlyArgThrLeuArgValLeuAsnLeuValGluAsnTrpLeuAsnAsnAsnThrGln>

8110      8120      8130      8140      8150      8160      8170      8180      8190
8200
TTTTGCGTAAAGGTTCTTAACCCGTACATGCCCTCAGTCATTGAAAGAATGGAAACCTTACAACGGAAATACGGAGGAGCCTTGGTGAGAAATCCACTCT
PheCysValLysValLeuAsnProTyrMetProSerValIleGluArgMetGluThrLeuGlnArgLysTyrGlyGlyAlaLeuValArgAsnProLeu>

8210      8220      8230      8240      8250      8260      8270      8280      8290
8300
CACGGAATTCCACACATGAGATGTACTGGGTGTCCAATGCTTCCGGGAACATAGTGTCATCAGTGAACATGATTTCAAGAATGCTGATCAACAGATTCAC
SerArgAsnSerThrHisGluMetTyrTrpValSerAsnAlaSerGlyAsnIleValSerSerValAsnMetIleSerArgMetLeuIleAsnArgPheThr>

8310      8320      8330      8340      8350      8360      8370      8380      8390
8400
TATGAGACACAAGAAGGCCACCTATGAGCCAGATGTCGACCTCGGAAGCGGAACCCGCAATATTGGAATTGAAAGTGAGACACCGAACCTAGACATAATT
MetArgHisLysLysAlaThrTyrGluProAspValAspLeuGlySerGlyThrArgAsnIleGlyIleGluSerGluThrProAsnLeuAspIleIle>

8410      8420      8430      8440      8450      8460      8470      8480      8490
8500
GGGAAAAGAATAGAAAAAATAAAACAAGAGCATGAAACGTCATGGCACTATGATCAAGACCACCCATACAAAACATGGGCTTACCATGGCAGCTATGAAA
GlyLysArgIleGluLysIleLysGlnGluHisGluThrSerTrpHisTyrAspGlnAspHisProTyrLysThrTrpAlaTyrHisGlySerTyrGlu>

8510      8520      8530      8540      8550      8560      8570      8580      8590
8600
CAAAACAGACTGGATCAGCATCATCCATGGTGAACGGAGTAGTCAGATTGCTGACAAAACCCTGGGACGTTGTTCCAATGGTGACACAGATGGCAATGAC
ThrLysGlnThrGlySerAlaSerSerMetValAsnGlyValValArgLeuLeuThrLysProTrpAspValValProMetValThrGlnMetAlaMetThr>

8610      8620      8630      8640      8650      8660      8670      8680      8690
8700
AGACACAACTCCTTTTGGACAACAGCGCGTCTTCAAAGAGAAGGTGGATACGAGAACCCAAGAACCAAAAGAAGGCACAAAAAAACTAATGAAAATCACG
AspThrThrPropheGlyGlnGlnArgValPheLysGluLysValAspThrArgThrGlnGluProLysGluGlyThrLysLysLeuMetLysIleThr>

8710      8720      8730      8740      8750      8760      8770      8780      8790
8800
GCAGAGTGGCTCTGGAAAGAACTAGGAAAGAAAAAGACACCTAGAATGTGTACCAGAGAAGAATTCACAAAAAAGGTGAGAAGCAATGCAGCCTTGGGGG
AlaGluTrpLeuTrpLysGluLeuGlyLysLysLysThrProArgMetCysThrArgGluGluPheThrLysLysValArgSerAsnAlaAlaLeuGly>

8810      8820      8830      8840      8850      8860      8870      8880      8890
8900
CCATATTCACCGATGAGAACAAGTGGAAATCGGCGCGTGAAGCCGTTGAAGATAGTAGGTTTTGGGAGCTGGTTGACAAGGAAAGGAACCTCCATCTTGA
AlaIlePheThrAspGluAsnLysTrpLysSerAlaArgGluAlaValGluAspSerArgPheTrpGluLeuValAspLySGluArgAsnLeuHisLeuGlu>

8910      8920      8930      8940      8950      8960      8970      8980      8990
9000
AGGGAAATGTGAAACATGTGTATACAACATGATGGGGAAAAGAGAGAAAAAACTAGGAGAGTTTGGTAAAGCAAAAGGCAGCAGAGCCATATGGTACATG
GlyLysCysGluThrCysValTyrAsnMetMetGlyLysArgGluLysLysLeuGlyGluPheGlyLysAlaLysGlySerArgAlaIleTrpTyrMet>

9010      9020      9030      9040      9050      9060      9070      9080      9090
9100
TGGCTCGGAGCACGCTTCTTAGAGTTTGAAGCCCTAGGATTTTTGAATGAAGACCATTGGTTCTCCAGAGAGAACTCCCTGAGTGGAGTGGAAGGAGAAG
TrpLeuGlyAlaArgPheLeuGluPheGluAlaLeuGlyPheLeuAsnGluAspHisTrpPheSerArgGluAsnSerLeuSerGlyValGluGlyGlu>

9110      9120      9130      9140      9150      9160      9170      9180      9190
9200
GGCTGCATAAGCTAGGTTACATCTTAAGAGAGGTGAGCAAGAAAGAAGGAGGAGCAATGTATGCCGATGACACCGCAGGCTGGGACACAAGAATCACAAT
GlyLeuHisLysLeuGlyTyrIleLeuArgGluValSerLysLysGluGlyGlyAlaMetTyrAlaAspAspThrAlaGlyTrpAspThrArgIleThrIle>

9210      9220      9230      9240      9250      9260      9270      9280      9290
9300
AGAGGATTTGAAAAATGAAGAAATGATAACGAACCACATGGCAGGAGAACACAAGAAACTTGCCGAGGCCATTTTTAAATTGACGTACCAAAACAAGGTG
GluAspLeuLysAsnGluGluMetIleThrAsnHisMetAlaGlyGluHisLysLysLeuAlaGluAlaIlePheLysLeuThrTyrGlnAsnLysVal>

9310      9320      9330      9340      9350      9360      9370      9380      9390
9400
GTGCGTGTGCAAAGACCAACACCAAGAGGCACAGTAATGGACATCATATCGAGAAGAGACCAAAGGGGTAGTGGACAAGTTGGCACCTATGGCCTCAACA
ValArgValGlnArgProThrProArgGlyThrValMetAspIleIleSerArgArgAspGlnArgGlySerGlyGlnValGlyThrTyrGlyLeuAsn>

9410      9420      9430      9440      9450      9460      9470      9480      9490
9500
CTTTCACCAACATGGAAGCACAACTAATTAGGCAAATGGAGGGGGAAGGAATCTTCAAAAGCATCCAGCACTTGACAGCCTCAGAAGAAATCGCTGTGCA
ThrPheThrAsnMetGluAlaGlnLeuIleArgGlnMetGluGlyGluGlyIlePheLysSerIleGlnHisLeuThrAlaSerGluGluIleAlaValGln>

9510      9520      9530      9540      9550      9560      9570      9580      9590
9600
AGATTGGCTAGTAAGAGTAGGGCGTGAAAGGTTGTCAAGAATGGCCATCAGTGGAGATGATTGTGTTGTGAAACCTTTAGATGATAGATTTGCAAGAGCT
AspTrpLeuValArgValGlyArgGluArgLeuSerArgMetAlaIleSerGlyAspAspCysValValLysProLeuAspAspArgPheAlaArgAla>

9610      9620      9630      9640      9650      9660      9670      9680      9690
9700
CTAACAGCTCTAAATGACATGGGAAAGGTTAGGAAGGACATACAGCAATGGGAGCCCTCAAGAGGATGGAACGACTGGACGCAGGTGCCCTTCTGTTCAC
LeuThrAlaLeuAsnAspMetGlyLysValArgLysAspIleGlnGlnTrpGluProSerArgGlyTrpAsnAspTrpThrGlnValProPheCysSer>

9710      9720      9730      9740      9750      9760      9770      9780      9790
9800
ACCATTTTCACGAGTTAATTATGAAAGATGGTCGCACACTCGTAGTTCCATGCAGAAACCAAGATGAATTGATCGGCAGAGCCCGAATTTCCCAGGGAGC
HisHisPheHisGluLeuIleMetLysAspGlyArgThrLeuValValProCysArgAsnGlnAspGluLeuIleGlyArgAlaArgIleSerGlnGlyAla>

9810      9820      9830      9840      9850      9860      9870      9880      9890
9900
TGGGTGGTCTTTACGGGAGACGGCCTGTTTGGGGAAGTCTTACGCCCAAATGTGGAGCTTGATGTACTTCCACAGACGTGATCTCAGGCTAGCGGCAAAT
GlyTrpSerLeuArgGluThrAlaCysLeuGlyLysSerTyrAlaGlnMetTrpSerLeuMetTyrPheHisArgArgAspLeuArgLeuAlaAlaAsn>

9910      9920      9930      9940      9950      9960      9970      9980      9990
10000
GCCATCTGCTCGGCAGTCCCATCACACTGGATTCCAACAAGCCGGACAACCTGGTCCATACACGCCAGCCATGAATGGATGACGACGGAAGACATGTTGA
AlaIleCysSerAlaValProSerHisTrpIleProThrSerArgThrThrTrpSerIleHisAlaSerHisGluTrpMetThrThrGluAspMetLeu>

10010     10020     10030     10040     10050     10060     10070     10080     10090
10100
CAGTTTGGAACAGAGTGTGGATCCTAGAAAATCCATGGATGGAAGACAAAACTCCAGTGGAATCATGGGAGGAAATCCCATACCTGGGAAAAAGAGAAGA
ThrValTrpAsnArgValTrpIleLeuGluAsnProTrpMetGluAspLysThrProValGluSerTrpGluGluIleProTyrLeuGlyLysArgGluAsp>

10110     10120     10130     10140     10150     10160     10170     10180     10190
10200
CCAATGGTGCGGCTCGCTGATTGGGCTGACAAGCAGAGCCACCTGGGCGAAGAATATCCAGACAGCAATAAACCAAGTCAGATCCCTCATTGGCAATGAG
GlnTrpCysGlySerLeuIleGlyLeuThrSerArgAlaThrTrpAlaLysAsnIleGlnThrAlaIleAsnGlnValArgSerLeuIleGlyAsnGlu>

10210     10220     10230     10240     10250     10260     10270     10280     10290
10300
GAATACACAGATTACATGCCATCCATGAAAAGATTCAGAAGAGAAGAGGAAGAGGCAGGAGTTTTGTGGTAGAAAAACATGAAACAAAACAGAAGTCAGG
GluTyrThrAspTyrMetProSerMetLysArgPheArgArgGluGluGluGluAlaGlyValLeuTrp***>

10310     10320     10330     10340     10350     10360     10370     10380     10390
10400
TCGGATTAAGCCATAGTACGGGAAAAACTATGCTACCTGTGAGCCCCGTCCAAGGACGTTAAAAGAAGTCAGGCCATTTTGATGCCATAGCTTGAGCAAA

10410     10420     10430     10440     10450     10460     10470     10480     10490
10500
CTGTGCAGCCTGTAGCTCCACCTGAGAAGGTGTAAAAAATCCGGGAGGCCACAAACCATGGAAGCTGTACGCATGGCGTAGTGGACTAGCGGTTAGAGGA

10510     10520     10530     10540     10550     10560     10570     10580     10590
10600
GACCCCTCCCTTACAGATCGCAGCAACAATGGGGGCCCAAGGTGAGATGAAGCTGTAGTCTCACTGGAAGGACTAGAGGTTAGAGGAGACCCCCCCAAAA

10610     10620     10630     10640     10650     10660     10670     10680     10690
10700
CAAAAAACAGCATATTGACGCTGGGAAAGACCAGAGATCCTGCTGTCTCCTCAGCATCATTCCAGGCACAGGACGCCAGAAAATGGAATGGTGCTGTTGA

10710     10720     10730     10740     10750     10760     10770     10780     10790
10800
ATCAACAGGTTCTGGTACCGGTAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATG

10810     10820     10830     10840     10850     10860     10870     10880     10890
10900
ATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCA

10910     10920     10930     10940     10950     10960     10970     10980     10990
11000
CTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGA

11010     11020     11030     11040     11050     11060     11070     11080     11090
11100
GTTGCTCTTGCCCGGCGTCAACACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTC

11110     11120     11130     11140     11150     11160     11170     11180     11190
11200
AAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCA

11210     11220     11230     11240     11250     11260     11270     11280     11290
11300
AAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATC

11310     11320     11330     11340     11350     11360     11370     11380     11390
11400
AGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGT

11410     11420     11430     11440     11450     11460     11470     11480     11490
11500
CTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTTCAAGAATTCTCATGTTTGACAGCTTATCATCGA

11510     11520     11530     11540     11550     11560     11570     11580     11590
11600
TAAGCTTTAATGCGGTAGTTTATCACAGTTAAATTGCTAACGCAGTCAGGCACCGTGTATGAAATCTAACAATGCGCTCATCGTCATCCTCGGCACCGTC

11610     11620     11630     11640     11650     11660     11670     11680     11690
11700
ACCCTGGATGCTGTAGGCATAGGCTTGGTTATGCCGGTACTGCCGGGCCTCTTGCGGGATATCGTCCATTCCGACAGCATCGCCAGTCACTATGGCGTGC

11710     11720     11730     11740     11750     11760     11770     11780     11790
11800
TGCTGGCGCTATATGCGTTGATGCAATTTCTATGCGCACCCGTTCTCGGAGCACTGTCCGACCGCTTTGGCCGCCGCCCAGTCCTGCTCGCTTCGCTACT

11810     11820     11830     11840     11850     11860     11870     11880     11890
11900
TGGAGCCACTATCGACTACGCGATCATGGCGACCACACCCGTCCTGTGGATCCTCTACGCCGGACGCATCGTGGCCGGCATCACCGGCGCCACAGGTGCG

11910     11920     11930     11940     11950     11960     11970     11980     11990
12000
GTTGCTGGCGCCTATATCGCCGACATCACCGATGGGGAAGATCGGGCTCGCCACTTCGGGCTCATGAGCGCTTGTTTCGGCGTGGGTATGGTGGCAGGCC

12010     12020     12030     12040     12050     12060     12070     12080     12090
12100
CCGTGGCCGGGGGACTGTTGGGCGCCATCTCCTTGCATGCACCATTCCTTGCGGCGGCGGTGCTCAACGGCCTCAACCTACTACTGGGCTGCTTCCTAAT

12110     12120     12130     12140     12150     12160     12170     12180     12190
12200
GCAGGAGTCGCATAAGGGAGAGCGTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCATGACTATCGTCGCCGCA

12210     12220     12230     12240     12250     12260     12270     12280     12290
12300
CTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGA

12310     12320     12330     12340     12350     12360     12370     12380     12390
12400
TCGGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCCCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTAT

12410     12420     12430     12440     12450     12460     12470     12480     12490
12500
CGCCGGCATGGCGGCCGACGCGCTGGGCTACGTCTTGCTGGCGTTCGCGACGCGAGGCTGGATGGCCTTCCCCATTATGATTCTTCTCGCTTCCGGCGGC

12510     12520     12530     12540     12550     12560     12570     12580     12590
12600
ATCGGGATGCCCGCGTTGCAGGCCATGCTGTCCAGGCAGGTAGATGACGACCATCAGGGACAGCTTCAAGGATCGCTCGCGGCTCTTACCAGCCTAACTT

12610     12620     12630     12640     12650     12660     12670     12680     12690
12700
CGATCACTGGACCGCTGATCGTCACGGCGATTTATGCCGCCTCGGCGAGCACATGGAACGGGTTGGCATGGATTGTAGGCGCCGCCCTATACCTTGTCTG

12710     12720     12730     12740     12750     12760     12770     12780     12790
12800
CCTCCCCGCGTTGCGTCGCGGTGCATGGAGCCGGGCCACCTCGACCTGAATGGAAGCCGGCGGCACCTCGCTAACGGATTCACCACTCCAAGAATTGGAG

12810     12820     12830     12840     12850     12860     12870     12880     12890
12900
CCAATCAATTCTTGCGGAGAACTGTGAATGCGCAAACCAACCCTTGGCAGAACATATCCATCGCGTCCGCCATCTCCAGCAGCCGCACGCGGCGCATCTC

12910     12920     12930     12940     12950     12960     12970     12980     12990
13000
GGGCAGCGTTGGGTCCTGGCCACGGGTGCGCATGATCGTGCTCCTGTCGTTGAGGACCCGGCTAGGCTGGCGGGGTTGCCTTACTGGTTAGCAGAATGAA

13010     13020     13030     13040     13050     13060     13070     13080     13090
13100
TCACCGATACGCGAGCGAACGTGAAGCGACTGCTGCTGCAAAACGTCTGCGACCTGAGCAACAACATGAATGGTCTTCGGTTTCCGTGTTTCGTAAAGTC

13110     13120     13130     13140     13150     13160     13170     13180     13190
13200
TGGAAACGCGGAAGTCAGCGCCCTGCACCATTATGTTCCGGATCTGCATCGCAGGATGCTGCTGGCTACCCTGTGGAACACCTACATCTGTATTAACGAA

13210     13220     13230     13240     13250     13260     13270     13280     13290
13300
GCGCTGGCATTGACCCTGAGTGATTTTTCTCTGGTCCCGCCGCATCCATACCGCCAGTTGTTTACCCTCACAACGTTCCAGTAACCGGGCATGTTCATCA

13310     13320     13330     13340     13350     13360     13370     13380     13390
13400
TCAGTAACCCGTATCGTGAGCATCCTCTCTCGTTTCATCGGTATCATTACCCCCATGAACAGAAATCCCCCTTACACGGAGGCATCAGTGACCAAACAGG

13410     13420     13430     13440     13450     13460     13470     13480     13490
13500
AAAAAACCGCCCTTAACATGGCCCGCTTTATCAGAAGCCAGACATTAACGCTTCTGGAGAAACTCAACGAGCTGGACGCGGATGAACAGGCAGACATCTG

13510     13520     13530     13540     13550     13560     13570     13580     13590
13600
TGAATCGCTTCACGACCACGCTGATGAGCTTTACCGCAGCTGCCTCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACG

13610     13620     13630     13640     13650     13660     13670     13680     13690
13700
GTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCGCAGCCATGACCCAGTCAC

13710     13720     13730     13740     13750     13760     13770     13780     13790
13800
GTAGCGATAGCGGAGTGTATACTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAGATGCGTA

13810     13820     13830     13840     13850     13860     13870     13880     13890
13900
AGGAGAAAATACCGCATCAGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGG

13910     13920     13930     13940     13950     13960     13970     13980     13990
14000
CGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCT

14010     14020     14030     14040     14050     14060     14070     14080     14090
14100
GGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCG

14110     14120     14130     14140     14150     14160     14170     14180     14190
14200
TTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTC

14210     14220     14230     14240     14250     14260     14270     14280     14290
14300
ATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATC

14310     14320     14330     14340     14350     14360     14370     14380     14390
14400
CGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGT

14410     14420     14430     14440     14450     14460     14470     14480     14490
14500
GCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAATCCAGTTACCTTCGGAAAAAGAG

14510     14520     14530     14540     14550     14560     14570     14580     14590
14600
TTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGA

14610     14620     14630     14640     14650     14660     14670     14680     14690
14700
TCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATC

14710     14720     14730     14740     14750     14760     14770     14780     14790
14800
CTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAG

14810     14820     14830     14840     14850     14860     14870     14880     14890
14900
CGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGAT

14910     14920     14930     14940     14950     14960     14970     14980     14990
15000
ACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCC

15010     15020     15030     15040     15050     15060     15070     15080     15090
15100
ATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTGCAAGATCTGGCTAGCGAT

15110     15120     15130     15140     15150
GACCCTGCTGATTGGTTCGCTGACCATTTCCGGGCGCGCCGATTTAGGTGACACTATAG

Bases 1 to 10713: DEN2 virus genome cDNA
Bases 97 to 10269: DEN2 polyprotein ORF
Bases 97 to 438: C protein ORF
Bases 439 to 936: prM protein ORF
Bases 937 to 2421: E protein ORF
Bases 2422 to 3477: NS1 protein ORF
Bases 3478 to 4131: NS2A protein ORF
Bases 4132 to 4521: NS2B protein ORF
Bases 4522 to 6375: NS3 protein ORF
Bases 6376 to 6756: NS4A protein ORF
Bases 6757 to 6825: 2K protein ORF
Bases 6826 to 7569: NS4B protein ORF
Bases 7570 to 10269: NS5 protein ORF

APPENDIX 2

Nucleotide and amino acid sequence of DEN3 (S1eman/78) cDNA plasmid p3


10   20   30   40   50   60   70   80   90   100
AGTTGTTAGTCTACGTGGACCGACAAGAACAGTTTCGACTCGGAAGCTTGCTTAACGTAGTACTGACAGTTTTTTATTAGAGAGCAGATCTCTGATGAACMet
Asn>

110   120   130   140   150   160   170   180   190   200
AACCAACGGAAAAAGACGGGAAAACCGTCTATCAATATGCTGAAACGCGTGAGAAACCGTGTGTCAACTGGATCACAGTTGGCGAAGAGATTCTCAAGAG
AsnGlnArgLysLysThrGlyLysProSerIleAsnMetLeuLysArgValArgAsnArgValSerThrGlySerGlnLeuAlaLysArgPheSerArg>

210   220   230   240   250   260   270   280   290   300
GACTGCTGAACGGCCAAGGACCAATGAAATTGGTTATGGCGTTCATAGCTTTCCTCAGATTTCTAGCCATTCCACCGACAGCAGGAGTCTTGGCTAGATG
GlyLeuLeuAsnGlyGlnGlyProMetLysLeuValMetAlaPheIleAlaPheLeuArgPheLeuAlaIleProProThrAlaGlyValLeuAlaArgTrp>

310   320   330   340   350   360   370   380   390   400
GGGAACCTTTAAGAAGTCGGGGGCTATTAAGGTCCTGAGAGGCTTCAAGAAGGAGATCTCAAACATGCTGAGCATTATCAACAGACGGAAAAAGACATCG
GlyThrPheLysLysSerGlyAlaIleLysValLeuArgGlyPheLysLysGluIleSerAsnMetLeuSerIleIleAsnArgArgLysLysThrSer>

410   420   430   440   450   460   470   480   490   500
CTCTGTCTCATGATGATGTTACCAGCAACACTTGCTTTCCACTTGACTTCACGAGATGGAAGCCGCGCATGATTGTGGGGAAGAATGAAAGAGGAAAAT
LeuCysLeuMetMetLeuProAlaThrLeuAlaPheHisLeuThrSerArgAspGlyGluProArgMetIleValGlyLysAsnGluArgGlyLys>

510   520   530   540   550   560   570   580   590   600
CCCTACTTTTTAAGACAGCCTCTGGAATCAACATGTGCACACTCATAGCCATGGATTTGGGAGAGATGTGTGATGACACGGTCACCTACAAATGCCCCCT
SerLeuLeuPheLysThrAlaSerGlyIleAsnMetCysThrLeuIleAlaMetAspLeuGlyGluMetCysAspAspThrValThrTyrLysCysProLeu>

610   620   630   640   650   660   670   680   690   700
CATTACTGAAGTGGAGCCTGAAGACATTGACTGCTGGTGCAACCTTACATCGACATGGGTGACCTACGGAACGTGCAATCAAGCTGGAGAGCACAGACGC
IleThrGluValGluProGluAspIleAspCysTrpCysAsnLeuThrSerThrTrpValThrTyrGlyThrCysAsnGlnAlaGlyGluHisArgArg>

710   720   730   740   750   760   770   780   790   800
GACAAAAGATCGGTGGCGTTAGCTCCCCATGTCGGCATGGGACTGGACACACGCACCCAAACCTGGATGTCGGCTGAAGGAGCTTGGAGACAGGTCGAGA
AspLysArgSerValAlaLeuAlaProHisValGlyMetGlyLeuAspThrArgThrGlnThrTrpMetSerAlaGluGlyAlaTrpArgGlnValGlu>

810   820   830   840   850   860   870   880   890   900
AGGTAGAGACATGGGCCTTTAGGCACCCAGGGTTCACAATACTAGCCCTATTTCTTGCCCATTACATAGGCACTTCCTTGACCCAGAAAGTGGTTATTTT
LysValGluThrTrpAlaPheArgHisProGlyPheThrIleLeuAlaLeuPheLeuAlaHisTyrIleGlyThrSerLeuThrGlnLysValValIlePhe>

910   920   930   940   950   960   970   980   990   1000
CATACTACTAATGCTGGTCACCCCATCCATGACAATGAGATGCGTGGGAGTAGGAAACAGAGATTTTGTGGAAGGCCTATCAGGAGCTACGTGGGTTGAC
IleLeuLeuMetLeuValThrProSerMetThrMetArgCysValGlyValGlyAsnArgAspPheValGluGlyLeuSerGlyAlaThrTrpValAsp>

1010   1020   1030   1040   1050   1060   1070   1080   1090   1100
GTGGTGCTCGAGCACGGTGGGTGTGTGACTACCATGGCTAAGAACAAGCCCACGCTGGATATAGAGCTCCAGAAGACCGAGGCCACCCAACTGGCGACCC
ValValLeuGluHisGlyGlyCysValThrThrMetAlaLysAsnLysProThrLeuAspIleGluLeuGlnLysThrGluAlaThrGlnLeuAlaThr>

1110   1120   1130   1140   1150   1160   1170   1180   1190   1200
TAAGGAAACTATGTATTGAGGGAAAAATTACCAACGTAACAACCGACTCAAGGTGCCCCACCCAAGGGGAAGCGATTTTACCTGAGGAGCAGGACCAGAA
LeuArgLysLeuCysIleGluGlyLysIleThrAsnValThrThrAspSerArgCysProThrGlnGlyGluAlaIleLeuProGluGluGlnAspGlnAsn>

1210   1220   1230   1240   1250   1260   1270   1280   1290   1300
CCACGTGTGCAAGCACACATACGTGGACAGAGGCTGGGGAAACGGTTGTGGTTTGTTTGGCAAGGGAAGCCTGGTAACATGCGCGAAATTTCAATGTTTG
HisValCysLysHisThrTyrValAspArgGlyTrpGlyAsnGlyCysGlyLeuPheGlyLysGlySerLeuValThrCysAlaLysPheGlnCysLeu>

1310   1320   1330   1340   1350   1360   1370   1380   1390   1400
GAATCAATAGAGGGAAAAGTGGTGCAGCATGAGAACCTCAAATACACCGTCATCATCACAGTGCACACAGGAGATCAACACCAGGTGGGAAATGAAACGC
GluSerIleGluGlyLysValValGlnHisGluAsnLeuLysTyrThrValIleIleThrValHisThrGlyAspGlnHisGlnValGlyAsnGluThr>

1410   1420   1430   1440   1450   1460   1470   1480   1490   1500
AGGGAGTCACGGCTGAGATAACACCCCAGGCATCAACCGTTGAAGCCATCTTACCTGAATATGGAACCCTTGGGCTAGAATGCTCACCACGGACAGGTTT
GlnGlyValThrAlaGluIleThrProGlnAlaSerThrValGluAlaIleLeuProGluTyrGlyThrLeuGlyLeuGluCysSerProArgThrGlyLeu>

1510   1520   1530   1540   1550   1560   1570   1580   1590   1600
AGATTTCAATGAAATGATTTTGTTGACAATGAAGAACAAAGCATGGATGGTACATAGACAATGGTTTTTTGACCTACCTTTACCATGGACATCAGGAGCT
AspPheAsnGluMetIleLeuLeuThrMetLysAsnLysAlaTrpMetValHisArgGlnTrpPhePheAspLeuProLeuProTrpThrSerGlyAla>

1610   1620   1630   1640   1650   1660   1670   1680   1690   1700
ACAACAGAAACACCAACCTGGAATAAGAAAGAGCTTCTTGTGACATTCAAAAACGCACATGCAAAAAAGCAAGAAGTAGTAGTCCTTGGATCGCAAGAGG
ThrThrGluThrProThrTrpAsnLysLysGluLeuLeuValThrPheLysAsnAlaHisAlaLysLysGlnGluValValValLeuGlySerGlnGlu>

1710   1720   1730   1740   1750   1760   1770   1780   1790   1800
GAGCAATGCACACAGCACTGACAGGAGCTACAGAGATCCAAACCTCAGGAGGCACAAGTATTTTTGCGGGGCACTTAAAATGTAGACTCAAGATGGACAA
GlyAlaMetHisThrAlaLeuThrGlyAlaThrGluIleGlnThrSerGlyGlyThrSerIlePheAlaGlyHisLeuLysCysArgLeuLysMetAspLys>

1810   1820   1830   1840   1850   1860   1870   1880   1890   1900
ATTGGAACTCAAGGGGATGAGCTATGCAATGTGCTTGAATGCCTTTGTGTTGAAGAAAGAAGTCTCCGAAACGCAACATGGGACAATACTCATCAAGGTT
LeuGluLeuLysGlyMetSerTyrAlaMetCysLeuAsnAlaPheValLeuLysLysGluValSerGluThrGlnHisGlyThrIleLeuIleLysVal>

1910   1920   1930   1940   1950   1960   1970   1980   1990   2000
GAGTACAAAGGGGAAGATGCACCTTGCAAGATTCCTTTCTCCACGGAGGATGGACAAGGGAAAGCCCACAATGGCAGACTGATCACAGCTAACCCAGTGG
GluTyrLysGlyGluAspAlaProCysLysIleProPheSerThrGluAspGlyGlnGlyLysAlaHisAsnGlyArgLeuIleThrAlaAsnProVal>

2010   2020   2030   2040   2050   2060   2070   2080   2090   2100
TGACCAAGAAGGAGGAGCCTGTCAATATTGAGGCAGAACCTCCTTTTGGGGAAAGCAATATAGTAATTGGAATTGGAGACAAAGCCTTGAAAATCAACTG
ValThrLysLysGluGluProValAsnIleGluAlaGluProProPheGlyGluSerAsnIleValIleGlyIleGlyAspLysAlaLeuLysIleAsnTrp>

2110   2120   2130   2140   2150   2160   2170   2180   2190   2200
GTACAAGAAGGGAAGCTCGATTGGGAAGATGTTCGAGGCCACTGCCAGAGGTGCAAGGCGCATGGCCATCTTGGGAGACACAGCCTGGGACTTTGGATCA
TyrLysLysGlySerSerIleGlyLysMetPheGluAlaThrAlaArgGlyAlaArgArgMetAlaIleLeuGlyAspThrAlaTrpAspPheGlySer>

2210   2220   2230   2240   2250   2260   2270   2280   2290   2300
GTAGGTGGTGTTTTAAATTCATTAGGAAAAATGGTGCACCAAATATTTGGAAGTGCTTACACAGCCCTATTTAGTGGAGTCTCCTGGATAATGAAAATTG
ValGlyGlyValLeuAsnSerLeuGlyLysMetValHisGlnIlePheGlySerAlaTyrThrAlaLeuPheSerGlyValSerTrpIleMetLysIle>

2310   2320   2330   2340   2350   2360   2370   2380   2390   2400
GAATAGGTGTCCTTTTAACCTGGATAGGGTTGAATTCAAAAAACACTAGTATGAGCTTTAGCTGCATTGTGATAGGAATCATTACACTCTATCTGGGAGC
GlyIleGlyValLeuLeuThrTrpIleGlyLeuAsnSerLysAsnThrSerMetSerPheSerCysIleValIleGlyIleIleThrLeuTyrLeuGlyAla>

2410   2420   2430   2440   2450   2460   2470   2480   2490   2500
CGTGGTGCAAGCTGACATGGGGTGTGTCATAAACTGGAAAGGCAAAGAACTCAAATGTGGAAGTGGAATTTTCGTCACTAATGAGGTCCACACCTGGACA
ValValGlnAlaAspMetGlyCysValIleAsnTrpLysGlyLysGluLeuLysCysGlySerGlyIlePheValThrAsnGluValHisThrTrpThr>

2510   2520   2530   2540   2550   2560   2570   2580   2590   2600
GAGCAATACAAATTTCAAGCAGACTCCCCCAAAAGACTGGCGACAGCCATTGCAGGCGCTTGGGAGAATGGAGTGTGCGGAATCAGGTCGACAACCAGAA
GluGlnTyrLysPheGlnAlaAspSerProLysArgLeuAlaThrAlaIleAlaGlyAlaTrpGluAsnGlyValCysGlyIleArgSerThrThrArg>

2610   2620   2630   2640   2650   2660   2670   2680   2690   2700
TGGAGAACCTCTTGTGGAAGCAAATAGCCAATGAACTGAACTACATATTATGGGAAAACAACATCAAATTAACGGTAGTTGTGGGTGATATAATTGGGGT
MetGluAsnLeuLeuTrpLysGlnIleAlaAsnGluLeuAsnTyrIleLeuTrpGluAsnAsnIleLysLeuThrValValValGlyAspIleIleGlyVal>

2710   2720   2730   2740   2750   2760   2770   2780   2790   2800
CTTAGAGCAAGGGAAAAGAACACTAACACCACAACCCATGGAACTAAAATATTCATGGAAAACATGGGGAAAGGCGAAGATAGTGACAGCTGAAACACAA
LeuGluGlnGlyLysArgThrLeuThrProGlnProMetGluLeuLysTyrSerTrpLysThrTrpGlyLysAlaLysIleValThrAlaGluThrGln>

2810   2820   2830   2840   2850   2860   2870   2880   2890   2900
AATTCCTCTTTCATAATAGATGGGCCAAACACACCAGAGTGTCCAAGTGCCTCAAGAGCATGGAATGTGTGGGAGGTGGAAGATTACGGGTTCGGAGTCT
AsnSerSerPheIleIleAspGlyProAsnThrProGluCysProSerAlaSerArgAlaTrpAsnValTrpGluValGluAspTyrGlyPheGlyVal>

2910   2920   2930   2940   2950   2960   2970   2980   2990   3000
TCACAACTAACATATGGCTGAAACTCCGAGAGATGTACACCCAACTATGTGACCACAGGCTAATGTCGGCAGCCGTTAAGGATGAGAGGGCCGTACACGC
PheThrThrAsnIleTrpLeuLysLeuArgGluMetTyrThrGlnLeuCysAspHisArgLeuMetSerAlaAlaValLysAspGluArgAlaValHisAla>

3010   3020   3030   3040   3050   3060   3070   3080   3090   3100
CGACATGGGCTATTGGATAGAAAGCCAAAAGAATGGAAGTTGGAAGCTAGAAAAGGCATCCCTCATAGAGGTAAAAACCTGCACATGGCCAAAATCACAC
AspMetGlyTyrTrpIleGluSerGlnLysAsnGlySerTrpLysLeuGluLysAlaSerLeuIleGluValLysThrCysThrTrpProLysSerHis>

3110   3120   3130   3140   3150   3160   3170   3180   3190   3200
ACTCTTTGGAGCAATGGTGTGCTAGAGAGTGACATGATCATCCCAAAGAGTCTGGCTGGTCCCATTTCGCAACACAACTACAGGCCCGGATACCACACCC
ThrLeuTrpSerAsnGlyValLeuGluSerAspMetIleIleProLysSerLeuAlaGlyProIleSerGlnHisAsnTyrArgProGlyTyrHisThr>

3210   3220   3230   3240   3250   3260   3270   3280   3290   3300
AAACGGCAGGACCCTGGCACTTAGGAAAATTGGAGCTGGACTTCAACTATTGTGAAGGAACAACAGTTGTCATCACAGAAAATTGTGGGACAAGAGGCCC
GlnThrAlaGlyProTrpHisLeuGlyLysLeuGluLeuAspPheAsnTyrCysGluGlyThrThrValValIleThrGluAsnCysGlyThrArgGlyPro>

3310   3320   3330   3340   3350   3360   3370   3380   3390   3400
ATCACTGAGAACAACAACAGTGTCAGGGAAGTTGATACACGAATGGTGTTGCCGCTCGTGTACACTTCCTCCCCTGCGATACATGGGAGAAGACGGCTGC
SerLeuArgThrThrThrValSerGlyLysLeuIleHisGluTrpCysCysArgSerCysThrLeuProProLeuArgTyrMetGlyGluAspGlyCys>

3410   3420   3430   3440   3450   3460   3470   3480   3490   3500
TrpTyrGlyMetGluIleArgProIleAsnGluLysGluGluAsnMetValLysSerLeuValSerAlaGlySerGlyLysValAspAsnPheThrMet>
TGGTATGGCATGGAAATTAGACCCATTAATGAGAAAGAAGAGAACATGGTAAAGTCTTTAGTCTCAGCAGGGAGTGGAAAGGTGGATAACTTCACAATGG

3510   3520   3530   3540   3550   3560   3570   3580   3590   3600
GTGTCTTGTGTTTGGCAATCCTTTTTGAAGAGGTGATGAGAGGAPAATTTGGGAPAAAGCACATGATTGCAGGGGTTCTCTTCACGTTTGTACTCCTCT
GlyValLeuCysLeuAlaIleLeuPheGluGluValMetArgGlyLysPheGlyLysLysHisMetIleAlaGlyValLeuPheThrPheValLeuLeuLeu>

3610   3620   3630   3640   3650   3660   3670   3680   3690   3700
CTCAGGGCAAATAACATGGAGAGACATGGCGCACACACTCATAATGATTGGGTCCAACGCCTCTGACAGAATGGGAATGGGCGTCACTTACCTAGCATTG
SerGlyGlnIleThrTrpArgAspMetAlaHisThrLeuIleMetIleGlySerAsnAlaSerAspArgMetGlyMetGlyValThrTyrLeuAlaLeu>

3710   3720   3730   3740   3750   3760   3770   3780   3790   3800
ATTGCAACATTTAAAATTCAGCCATTTTTGGCTTTGGGATTCTTCCTGAGGAAACTGACATCTAGAGAAAATTTATTGTTGGGAGTTGGGTTGGCCATGG
IleAlaThrPheLysIleGlnProPheLeuAlaLeuGlyPhePheLeuArgLysLeuThrSerArgGluAsnLeuLeuLeuGlyValGlyLeuAlaMet>

3810   3820   3830   3840   3850   3860   3870   3880   3890   3900
CAACAACGTTACAACTGCCAGAGGACATTGAACAAATGGCGAATGGAATAGCTTTAGGGCTCATGGCTCTTAAATTAATAACACAATTTGAAACATACCA
AlaThrThrLeuGlnLeuProGluAspIleGluGlnMetAlaAsnGlyIleAlaLeuGlyLeuMetAlaLeuLysLeuIleThrGlnPheGluThrTyrGln>

3910   3920   3930   3940   3950   3960   3970   3980   3990   4000
ACATGGACGGCATTAGTCTCCCTAATGTGTTCAAATACAATTTTCACGTTGACTGTTGCCTGGAGAACAGCCACCCTGATTTTGGCCGGAATTTCTCTT
LeuTrpThrAlaLeuValSerLeuMetCysSerAsnThrIlePheThrLeuThrValAlaTrpArgThrAlaThrLeuIleLeuAlaGlyIleSerLeu>

4010   4020   4030   4040   4050   4060   4070   4080   4090   4100
TTGCCAGTGTGCCAGTCTTCGAGCATGAGGAAAACAGATTGGCTCCCAATGGCTGTGGCAGCTATGGGAGTTCCACCCCTACCACTTTTTATTTTCAGTT
LeuProValCysGlnSerSerSerMetArgLysThrAspTrpLeuProMetAlaValAlaAlaMetGlyValProProLeuProLeuPheIlePheSer>

4110   4120   4130   4140   4150   4160   4170   4180   4190   4200
TGAAAGATACGCTCAAAAGGAGAAGCTGGCCACTGAATGAGGGGGTGATGGCTGTTGGACTTGTGAGTATTCTAGCTAGTTCTCTCCTTAGGAATGACGT
LeuLysAspThrLeuLysArgArgSerTrpProLeuAsnGluGlyValMetAlaValGlyLeuValSerIleLeuAlaSerSerLeuLeuArgAsnAspVal>

4210   4220   4230   4240   4250   4260   4270   4280   4290   4300
GCCCATGGCTGGACCATTAGTGGCTGGGGGCTTGCTGATAGCGTGCTACGTCATAACTGGCACGTCAGCAGACCTCACTGTAGAAAAAGCAGCAGATGTC
ProMetAlaGlyProLeuValAlaGlyGlyLeuLeuIleAlaCysTyrValIleThrGlyThrSerAlaAspLeuThrValGluLysAlaAlaAspVal>

4310   4320   4330   4340   4350   4360   4370   4380   4390   4400
ACATGGGAGGAAGAGGCTGAGCAAACAGGAGTGTCCCACAATTTAATGATCACAGTTGATGACGATGGAACAATGAGAATAAAAGATGATGAGACTGAGA
ThrTrpGluGluGluAlaGluGlnThrGlyValSerHisAsnLeuMetIleThrValAspAspAspGlyThrMetArgIleLysAspAspGluThrGlu>

4410   4420   4430   4440   4450   4460   4470   4480   4490   4500
ACATCTTAACAGTGCTTTTGAAAACAGCATTACTAATAGTGTCAGGCATTTTTCCATACTCCATACCCGCAACACTGTTGGTCTGGCACACTTGGCAAAA
AsnIleLeuThrValLeuLeuLysThrAlaLeuLeuIleValSerGlyIlePheProTyrSerIleProAlaThrLeuLeuValTrpHisThrTrpGlnLys>

4510   4520   4530   4540   4550   4560   4570   4580   4590   4600
GCAAACCCAAAGATCCGGTGTCCTATGGGACGTTCCCAGCCCCCCAGAGACACAGAAAGCAGAACTGGAAGAAGGGGTTTATAGGATCAAGCAGCAAGGA
GlnThrGlnArgSerGlyValLeuTrpAspValProSerProProGluThrGlnLysAlaGluLeuGluGluGlyValTyrArgIleLysGlnGlnGly>

4610   4620   4630   4640   4650   4660   4670   4680   4690   4700
ATTTTTGGGAAAACCCAAGTGGGGGTTGGAGTACAAAAAGAAGGAGTTTTCCACACCATGTGGCACGTCACAAGAGGAGCAGTGTTGACACACAATGGGA
IlePheGlyLysThrGlnValGlyValGlyValGlnLysGluGlyValPheHisThrMetTrpHisValThrArgGlyAlaValLeuThrHisAsnGly>

4710   4720   4730   4740   4750   4760   4770   4780   4790   4800
AAAGACTGGAACCAAACTGGGCTAGCGTGAAAAAAGATCTGATTTCATACGGAGGAGGATGGAAATTGAGTGCACAATGGCAAAAAGGAGAGGAGGTGCA
LysArgLeuGluProAsnTrpAlaSerValLysLysAspLeuIleSerTyrGlyGlyGlyTrpLysLeuSerAlaGlnTrpGlnLysGlyGluGluValGln>

4810   4820   4830   4840   4850   4860   4870   4880   4890   4900
GGTTATTGCCGTAGAGCCTGGGAAGAACCCAAAGAACTTTCAAACCATGCCAGGCATTTTCCAGACAACAACAGGGGGAGATAGGAGCGATTGCACTGGAC
ValIleAlaValGluProGlyLysAsnProLysAsnPheGlnThrMetProGlyIlePheGlnThrThrThrGlyGluIleGlyAlaIleAlaLeuAsp>

4910   4920   4930   4940   4950   4960   4970   4980   4990   5000
TTCAAGCCTGGAACTTCAGGATCTCCCATCATAAACAGAGAGGGAAAGGTACTGGGATTGTATGGCAATGGAGTGGTCACAAAGAATGGTGGCTATGTCA
PheLysProGlyThrSerGlySrProIleIleAsnArgGluGlyLysValLeuGlyLeuTyrGlyAsnGlyValValThrLysAsnGlyGlyTyrVal>

5010   5020   5030   5040   5050   5060   5070   5080   5090   5100
GTGGAATAGCACAAACAAATGCAGAACCAGACGGACCGACACCAGAGTTGGAAGAAGAGATGTTCAAAAAGCGAAATCTAACCATAATGGATCTCCATCC
SerGlyIleAlaGlnThrAsnAlaGluProAspGlyProThrProGluLeuGluGluGluMetPheLysLysArgAsnLeuThrIleMetAspLeuHisPro>

5110   5120   5130   5140   5150   5160   5170   5180   5190   5200
CGGGTCAGGAAAGACGCGGAAATATCTTCCAGCTATTGTTAGAGAGGCAATCAAGAGACGCTTAAGGACTCTAATTTTGGCACCAACAAGGGTAGTTGCA
GlySerGlyLysThrArgLysTyrLeuProAlaIleValArgGluAlaIleLysArgArgLeuArgThrLeuIleLeuAlaProThrArgValValAla>

5210   5220   5230   5240   5250   5260   5270   5280   5290   5300
GCTGAGATGGAAGAAGCATTGAAAGGGCTCCCAATAAGGTATCAAACAACTGCAACAAAATCTGAACACACAGGGAGAGAGATTGTTGATCTAATGTGCC
AlaGluyMetGluGluAlaLeuLysGlyLeuProIleArgTyrGlnThrThrAlaThrLysSerGluHisThrGlyArgGluIleValAspLeuMetCys>

5310   5320   5330   5340   5350   5360   5370   5380   5390   5400
ACGCAACGTTCACAATGCGTTTGCTGTCACCAGTCAGGGTTCCAAACTACAACTTGATAATAATGGATGAGGCTCATTTCACAGACCCAGCCAGTATAGC
HisAlaThrPheThrMetArgLeuLeuSerProValArgValProAsnTyrAsnLeuIleIleMetAspGluAlaHisPheThrAspProAlaSerIleAla>

5410   5420   5430   5440   5450   5460   5470   5480   5490   5500
GGCTAGAGGGTACATATCAACTCGTGTAGGAATGGGAGAGGCAGCCGCAATTTTCATGACAGCCACACCCCCTGGAACAGCTGATGCCTTTCCTCAGAGC
AlaArgGlyTyrIleSerThrArgValGlyMetGlyGluAlaAlaAlaIlePheMetThrAlaThrProProGlyThrAlaAspAlaPheProGlnSer>

5510   5520   5530   5540   5550   5560   5570   5580   5590   5600
AACGCTCCAATTCAAGATGAAGAAAGAGACATACCAGAACGCTCATGGAATTCAGGCAATGAATGGATTACCGACTTTGCCGGGAAGACGGTGTGGTTTG
AsnAlaProIleGlnAspGluGluArgAspIleProGluArgSerTrpAsnSerGlyAsnGluTrpIleThrAspPheAlaGlyLysThrValTrpPhe>

5610   5620   5630   5640   5650   5660   5670   5680   5690   5700
TCCCTAGCATCAAAGCTGGAAATGACATAGCAAACTGCTTGCGGAAAAATGGAAAAAAGGTCATTCAACTTAGTAGGAAGACTTTTGACACAGAATATCA
ValProSerIleLysAlaGlyAsnAspIleAlaAsnCysLeuArgLysAsnGlyLysLysValIleGlnLeuSerArgLysThrPheAspThrGluTyrGln>

5710   5720   5730   5740   5750   5760   5770   5780   5790   5800
AAAGACTAAACTAAATGATTGGGACTTTGTGGTGACAACAGACATTTCAGAAATGGGAGCCAATTTCAAAGCAGACAGAGTGATCGACCCAAGAAGATGT
LysThrLysLeuAsnAspTrpAspPheValValThrThrAspIleSerGluMetGlyAlaAsnPheLysAlaAspArgValIleAspProArgArgCys>

5810   5820   5830   5840   5850   5860   5870   5880   5890   5900
CTCAAGCCAGTGATTTTGACAGACGGACCCGAGCGCGTGATCCTGGCGGGACCAATGCCAGTCACCGTAGCGAGCGCTGCGCAAAGGAGAGGGAGAGTTG
LeuLysProValIleLeuThrAspGlyProGluArgValIleLeuAlaGlyProMetProValThrValAlaSerAlaAlaGlnArgArgGlyArgVal>

5910   5920   5930   5940   5950   5960   5970   5980   5990   6000
GCAGGAACCCACAAAAAGAAAATGACCAATACATATTCATGGGCCAGCCCCTCAATAATGATGAAGACCATGCTCACTGGACAGAAGCAAAAATGCTGCT
GlyArgAsnProGlnLysGluAsnAspGlnTyrIlePheMetGlyGlnProLeuAsnAsnAspGluAspHisAlaHisTrpThrGluAlaLysMetLeuLeu>

6010   6020   6030   6040   6050   6060   6070   6080   6090   6100
AGACAACATCAACACACCAGAAGGGATCATACCAGCTCTCTTTGAACCAGAAAGGGAGAAGTCAGCCGCCATAGACGGCGAATACCGCCTGAAGGGTGAG
AspAsnIleAsnThrProGluGlyIleIleProAlaLeuPheGluProGluArgGluLysSerAlaAlaIleAspGlyGluTyrArgLeuLysGlyGlu>

6110   6120   6130   6140   6150   6160   6170   6180   6190   6200
TCCAGGAAGACCTTCGTGGAACTCATGAGGAGGGGTGACCTCCCAGTTTGGCTAGCCCATAAAGTAGCATCAGAAGGGATCAAATATACAGATAGAAAGT
SerArgLysThrPheValGluLeuMetArgArgGlyAspLeuProValTrpLeuAlaHisLysValAlaSerGluGlyIleLysTyrThrAspArgLys>

6210   6220   6230   6240   6250   6260   6270   6280   6290   6300
GGTGTTTTGATGGAGAACGCAACAATCAAATTTTAGAGGAGAATATGGATGTGGAAATCTGGACAAAGGAAGGAGAAAAGAAAAAATTGAGACCTAGGTG
TrpCysPheAspGlyGluArgAsnAsnGlnIleLeuGluGluAsnMetAspValGluIleTrpThrLysGluGlyGluLysLysLysLeuArgProArgTrp>

6310   6320   6330   6340   6350   6360   6370   6380   6390   6400
GCTTGATGCCCGCACTTATTCAGATCCCTTAGCGCTCAAGGAATTCAAGGACTTTGCGGCTGGTAGAAAGTCAATTGCCCTTGATCTTGTGACAGAAATA
LeuAspAlaArgThrTyrSerAspProLeuAlaLeuLysGluPheLysAspPheAlaAlaGlyArgLysSerIleAlaLeuAspLeuValThrGluIle>

6410   6420   6430   6440   6450   6460   6470   6480   6490   6500
GGAAGAGTGCCTTCACACTTAGCTCACAGAACGAGAAACGCCCTGGACAATCTGGTGATGTTGCACACGTCAGAACATGGCGGGAGGGCCTACAGGCATG
GlyArgValProSerHisLeuAlaHisArgThrArgAsnAAlaLeuAspAsnLeuValMetLeuHisThrSerGLuHisGlyGlyArgAlaTyrArgHis>

6510   6520   6530   6540   6550   6560   6570   6580   6590   6600
CAGTGGAGGAACTACCAGAAACAATGGAAACACTCTTACTCCTGGGACTCATGATCCTGTTAACAGGTGGAGCAATGCTTTTCTTGATATCAGGTAAAGG
AlaValGluGluLeuProGluThrMetGluThrLeuLeuLeuLeuGlyLeuMetIleLeuLeuThrGlyGlyAlaMetLeuPheLeuIleSerGlyLysGly>

6610   6620   6630   6640   6650   6660   6670   6680   6690   6700
GATTGGAAAGACTTCAATAGGACTCATTTGTGTAGCTGCTTCCAGCGGTATGTTATGGATGGCTGATGTCCCACTCCAATGGATCGCGTCTGCCATAGTC
IleGlyLysThrSerIleGLyLeuIleCysValAlaAlaSerSerGlyMetLeuTrpMetAlaAspValProLeuGlnTrpIleAlaSerAlaIleVal>

6710   6720   6730   6740   6750   6760   6770   6780   6790   6800
CTGGAGTTTTTTATGATGGTGTTACTTATACCAGAACCAGAAAAGCAGAGAACTCCCCAAGACAATCAACTCGCATATGTCGTGATAGGCATACTCACAC
LeuGluPhePheMetMetValLeuLeuIleProGluProGluLysGlnArgThrProGlnAspAsnGlnLeuAlaTyrValValIleGlyIleLeuThr>

6810   6820   6830   6840   6850   6860   6870   6880   6890   6900
TGGCTGCAATAGTAGCAGCCAATGAAATGGGACTGTTGGAAACCACAAAGAGAGATTTAGGAATGTCCAAAGAACCAGGTGTTGTTTCTCCAACCAGCTA
LeuAlaAlaIleValAlaAlaAsnGluMetGlyLeuLeuGluThrThrLysArgAspLeuGlyMetSerLysGluProGlyValValSerProThrSerTyr>

6910   6920   6930   6940   6950   6960   6970   6980   6990   7000
TTTGGATGTGGACTTGCACCCAGCATCAGCCTGGACATTGTACGCTGTGGCCACAACAGTAATAACACCAATGTTGAGACATACCATAGAGAATTCCACA
LeuAspValAspLeuHisProAlaSerAlaTrpThrLeuTyrAlaValAlaThrThrValIleThrProMetLeuArgHisThrIleGluAsnSerThr>

7010   7020   7030   7040   7050   7060   7070   7080   7090   7100
GCAAATGTGTCCCTGGCAGCTATAGCCAACCAGGCAGTGGTCCTGATGGGTTTAGACAAAGGATGGCCGATATCGAAAATGGACTTAGGCGTGCCACTAT
AlaAsnValSerLeuAlaAlaIleAlaAsnGlnAlaValValLeuMetGlyLeuAspLysGlyTrpProIleSerLysMetAspLeuGLyValProLeu>

7110   7120   7130   7140   7150   7160   7170   7180   7190   7200
TGGCACTGGGTTGTTATTCACAAGTGAACCCACTAACTCTCACAGCGGCAGTTCTCCTGCTAGTCACGCATTATGCTATTATAGGTCCAGGATTGCAGGC
LeuAlaLeuGlyCysTyrSerGlnValAsnProLeuThrLeuThrAlaAlaValLeuLeuLeuValThrHisTyrAlaIleIleGlyProGlyLeuGlnAla>

7210   7220   7230   7240   7250   7260   7270   7280   7290   7300
AAAAGCCACTCGTGAAGCTCAAAAAAGGACAGCTGCTGGAATAATGAAGAATCCAACGGTGGATGGGATAATGACAATAGACCTAGATCCTGTAATATAC
LysAlaThrArgGluAlaGlnLysArgThrAlaAlaGlyIleMetLysAsnProThrValAspGlyIleMetThrIleAspLeuAspProValIleTyr>

7310   7320   7330   7340   7350   7360   7370   7380   7390   7400
GATTCAAAATTTGAAAAGCAACTAGGACAGGTTATGCTCCTGGTTCTGTGTGCAGTTCAACTTTTGTTAATGAGAACATCATGGGCTTTTTGTGAAGCTC
AspSerLysPheGluLysGlnLeuGlyGlnValMetLeuLeuValLeuCysAlaValGlnLeuLeuLeuMetArgThrSerTrpAlaPheCysGluAla>

7410   7420   7430   7440   7450   7460   7470   7480   7490   7500
TAACCCTAGCCACAGGACCAATAACAACACTCTGGGAAGGATCACCTGGGAAGTTCTGGAACACCACGATAGCTGTTTCCATGGCGAACATCTTTAGAGG
LeuThrLeuAlaThrGlyProIleThrThrLeuTrpGluGlySerProGlyLysPheTrpAsnThrThrIleAlaValSerMetAlaAsnIlePheArgGly>

7510   7520   7530   7540   7550   7560   7570   7580   7590   7600
GAGCTATTTAGCAGGAGCTGGGCTTGCTTTTTCTATCATGAAATCAGTTGGAACAGGAAAGAGAGGGACAGGGTCACAGGGTGAAACCTTGGGAGAAAAG
SerTyrLeuAlaGlyAlaGlyLeuAlaPheSerIleMetLysSerValGlyThrGlyLysArgGlyThrGlySerGlnGlyGluThrLeuGlyGluLys>

7610   7620   7630   7640   7650   7660   7670   7680   7690   7700
TGGAAAAAGAAATTGAATCAATTACCCCGGAAAGAGTTTGACCTTTACAAGAAATCCGGAATCACTGAAGTGGATAGAACAGAAGCCAAAGAAGGGTTGA
TrpLysLysLysLeuAsnGlnLeuProArgLysGluPheAspLeuTyrLysLysSerGlyIleThrGluValAspArgThrGluAlaLysGluGlyLeu>

7710   7720   7730   7740   7750   7760   7770   7780   7790   7800
AAAGAGGAGAAATAACACACCATGCCGTGTCCAGAGGCAGCGCAAAACTTCAATGGTTCGTGGAGAGAAACATGGTCATCCCCGAAGGAAGAGTCATAGA
LysArgGlyGluIleThrHisHisAlaValSerArgGlySerAlaLysLeuGlnTrpPheValGluArgAsnMetValIleProGluGlyArgValIleAsp>

7810   7820   7830   7840   7850   7860   7870   7880   7890   7900
CTTAGGCTGTGGAAGAGGAGGCTGGTCATATTATTGTGCAGGACTGAAAAAAGTTACAGAAGTGCGAGGATACACAAAAGGCGGCCCAGGACATGAAGAA
LeuGlyCysGlyArgGlyGlyTrpSerTyrTyrCysAlaGlyLeuLysLysValThrGluValArgGlyTyrThrLysGlyGlyProGlyHisGluGlu>

7910   7920   7930   7940   7950   7960   7970   7980   7990   8000
CCAGTACCTATGTCTACATACGGATGGAACATAGTCAAGTTAATGAGTGGAAAGGATGTGTTTTATCTTCCACCTGAAAAGTGTGATACTCTATTGTGTG
ProValProMetSerThrTyrGlyTrpAsnIleValLysLeuMetSerGlyLysAspValPheTyrLeuProProGluLysCysAspThrLeuLeuCys>

8010   8020   8030   8040   8050   8060   8070   8080   8090   8100
ACATTGGAGAATCTTCACCAAGCCCAACAGTGGAAGAAAGCAGAACCATAAGAGTCTTGAAGATGGTTGAACCATGGCTAAAAAATAACCAGTTTTGCAT
AspIleGlyGluSerSerProSerProThrValGluGluSerArgThrIleArgValLeuLysMetValGluProTrpLeuLysAsnAsnGlnPheCysIle>

8110   8120   8130   8140   8150   8160   8170   8180   8190   8200
TAAAGTATTGAACCCTTACATGCCAACTGTGATTGAGCACCTAGAAAGACTACAAAGGAAACATGGAGGAATGCTTGTGAGAAATCCACTCTCACGAAAC
LysValLeuAsnProTyrMetProThrValIleGluHisLeuGluArgLeuGlnArgLysHisGlyGlyMetLeuValArgAsnProLeuSerArgAsn>

8210   8220   8230   8240   8250   8260   8270   8280   8290   8300
TCCACGCACGAAATGTACTGGATATCTAATGGCACAGGCAATATCGTTTCTTCAGTCAACATGGTATCCAGATTGCTACTTAACAGATTCACAATGACAC
SerThrHisGLuMetTyrTrpIleSerAsnGlyThrGlyAsnIleValSerSerValAsnMetValSerArgLeuLeuLeuAsnArgPheThrMetThr>

8310   8320   8330   8340   8350   8360   8370   8380   8390   8400
ATAGGAGACCCACCATAGAGAAAGATGTGGATTTAGGAGCGGGGACCCGACATGTCAATGCGGAACCAGAAACACCCAACATGGATGTCATTGGGGAAAG
HisArgArgProThrIleGluLysAspValAspLeuGlyAlaGlyThrArgHisValAsnAlaGluProGluThrProAsnMetAspValIleGlyGluArg>

8410   8420   8430   8440   8450   8460   8470   8480   8490   8500
AATAAGAAGGATCAAGGAGGAGCATAGTTCAACATGGCACTATGATGATGAAAATCCTTATAAAACGTGGGCTTACCATGGATCCTATGAAGTTAAGGCC
IleArgArgIleLysGluGluHisSerSerThrTrpHisTyrAspAspGluAsnProTyrLysThrTrpAlaTyrHisGlySerTyrGluValLysAla>

8510   8520   8530   8540   8550   8560   8570   8580   8590   8600
ACAGGCTCAGCCTCCTCCATGATAAATGGAGTCGTGAAACTCCTCACGAAACCATGGGATGTGGTGCCCATGGTGACACAGATGGCAATGACGGATACAA
ThrGlySerAlaSerSerMetIleAsnGlyValValLysLeuLeuThrLysProTrpAspValValProMetValThrGlnMetAlaMetThrAspThr>

8610   8620   8630   8640   8650   8660   8670   8680   8690   8700
CCCCATTCGGCCAGCAAAGGGTTTTTAAAGAGAAAGTGGACACCAGGACACCCAGACCTATGCCAGGAACAAGAAAGGTTATGGAGATCACAGCGGAATG
ThrProPheGlyGlnGlnArgValPheLysGluLysValAspThrArgThrProArgProMetProGlyThrArgLysValMetGluIleThrAlaGluTrp>

8710   8720   8730   8740   8750   8760   8770   8780   8790   8800
GCTTTGGAGAACCCTGGGAAGGAACAAAAGACCCAGATTATGTACGAGAGAGGAGTTCACAAAAAAGGTCAGAACCAACGCAGCTATGGGCGCCGTTTTT
LeuTrpArgThrLeuGlyArgAsnLysArgProArgLeuCysThrArgGluGluPheThrLysLysValArgThrAsnAlaAlaMetGlyAlaValPhe>

8810   8820   8830   8840   8850   8860   8870   8880   8890   8900
ACAGAGGAGAACCAATGGGACAGTGCTAGAGCTGCTGTTGAGGATGAAGAATTCTGGAAACTCGTGGACAGAGAACGTGAACTCCACAAATTGGGCAAGT
ThrGluGluAsnGlnTrpAspSerAlaArgAlaAlaValGluAspGluGluPheTrpLysLeuValAspArgGluArgGluLeuHisLysLeuGlyLys

8910   8920   8930   8940   8950   8960   8970   8980   8990   9000
GTGGAAGCTGCGTTTACAACATGATGGGCAAGAGAGAGAAGAAACTTGGAGAGTTTGGCAAAGCAAAAGGCAGTAGAGCCATATGGTACATGTGGTTGGG
CysGlySerCysValTyrAsnMetMetGlyLysArgGluLysLysLeuGlyGluPheGlyLysAlaLysGlySerArgAlaIleTrpTyrMetTrpLeuGly>

9010   9020   9030   9040   9050   9060   9070   9080   9090   9100
AGCCAGATACCTTGAGTTCGAAGCACTCGGATTCTTAAATGAAGACCATTGGTTCTCGCGTGAAAACTCTTACAGTGGAGTAGAAGGAGAAGGACTGCAC
AlaArgTyrLeuGluPheGluAlaLeuGlyPheLeuAsnGluAspHisTrpPheSerArgGluAsnSerTyrSerGlyValGluGlyGluGlyLeuHis>

9110   9120   9130   9140   9150   9160   9170   9180   9190   9200
AAGCTGGGATACATCTTAAGAGACATTTCCAGATACCCGGAGGAGCTATGTATGCTGATGACACAGCTGGTTGGGACACAAGAATTAACAGAAGATGACC
LysLeuGlyTyrIleLeuArgAspIleSerLysIleProGlyGlyAlaMetTyrAlaAspAspThrAlaGlyTrpAspThrArgIleThrGluAspAsp>

9210   9220   9230   9240   9250   9260   9270   9280   9290   9300
TGCACAATGAGGAAAAAATCACACAGCAAATGGACCCTGAACACAGGCAGTTAGCAAACGCTATATTCAAGCTCACATACCAAAACAAAGTGGTCAAAGT
LeuHisAsnGluGluLysIleThrGlnGlnMetAspProGluHisArgGlnLeuAlaAsnAlaIlePheLysLeuThrTyrGlnAsnLysValValLysVal>

9310   9320   9330   9340   9350   9360   9370   9380   9390   9400
TCAACGACCAACTCCAAAGGGCACGGTAATGGACATCATATCTAGGAAAGACCAAAGAGGCAGTGGACAGGTGGGAACTTATGGTCTGAATACATTCACC
GlnArgProThrProLysGlyThrValMetAspIleIleSerArgLysAspGlnArgGlySerGlyGlnValGlyThrTyrGlyLeuAsnThrPheThr>

9410   9420   9430   9440   9450   9460   9470   9480   9490   9500
AACATGGAAGCCCAGTTAATCAGACAAATGGAAGGAGAAGGTGTGTTGTCGAAGGCAGACCTCGAGAACCCTCATCTGCTAGAGAAGAAAGTTACACAAT
AsnMetGluAlaGlnLeuIleArgGlnMetGluGlyGluGlyValLeuSerLysAlaAspLeuGluAsnProHisLeuLeuGluLysLysValThrGln>

9510   9520   9530   9540   9550   9560   9570   9580   9590   9600
GGTTGGAAACAAAAGGAGTGGAGAGGTTAAAAAGAATGGCCATCAGCGGGGATGATTGCGTGGTGAAACCAATTGATGACAGGTTCGCCAATGCCCTGCT
TrpLeuGluThrLysGlyValGluArgLeuLysArgMetAlaIleSerGlyAspAspCysValValLysProIleAspAspArgPheAlaAsnAlaLeuLeu>

9610   9620   9630   9640   9650   9660   9670   9680   9690   9700
TGCCCTGAATGACATGGGAAAAGTTAGGAAGGACATACCTCAATGGCAGCCATCAAAGGGATGGCATGATTGGCAACAGGTCCCTTTCTGCTCCCACCAC
AlaLeuAsnAspMetGlyLysValArgLysAspIleProGlnTrpGlnProSerLysGlyTrpHisAspTrpGLnGlnValProPheCysSerHisHis>

9710   9720   9730   9740   9750   9760   9770   9780   9790   9800
TTTCATGAATTGATCATGAAAGATGGAAGAAAGTTGGTAGTTCCCTGCAGACCTCAGGATGAATTAATCGGGAGAGCGAGAATCTCTCAAGGAGCAGGAT
PheHisGluLeuIleMetLysAspGlyArgLysLeuValValProCysArgProGlnAspGluLeuIleGlyArgAlaArgIleSerGlnGlyAlaGly>

9810   9820   9830   9840   9850   9860   9870   9880   9890   9900
GGAGCCTTAGAGAAACTGCATGCCTAGGGAAAGCCTACGCCCAAATGTGGACTCTCATGTACTTTCACAGAAGAGATCTTAGACTAGCATCCAACGCCAT
TrpSerLeuArgGluThrAlaCysLeuGlyLysAlaTyrAlaGlnMetTrpThrLeuMetTyrPheHisArgArgAspLeuArgLeuAlaSerAsnAlaIle>

9910   9920   9930   9940   9950   9960   9970   9980   9990   10000
ATGTTCAGCAGTACCAGTCCATTGGGTCCCCACAAGCAGAACGACGTGGTCTATTCATGCTCACCATCAGTGGATGACTACAGAAGACATGCTTACTGTT
CysSerAlaValProValHisTrpValProThrSerArgThrThrTrpSerIleHisAlaHisHisGlnTrpMetThrThrGluAspMetLeuThrVal>

10010   10020   10030   10040   10050   10060   10070   10080   10090   10100
TGGAACAGGGTGTGGATAGAGGATAATCCATGGATGGAAGACAAAACTCCAGTCAAAACCTGGGAAGATGTTCCATATCTAGGGAAGAGAGAAGACCAAT
TrpAsnArgValTrpIleGluAspAsnProTrpMetGluAspLysThrProValLysThrTrpGluAspValProTyrLeuGlyLysArgGluAspGln>

10110   10120   10130   10140   10150   10160   10170   10180   10190   10200
GGTGCGGATCACTCATTGGTCTCACTTCCAGAGCAACCTGGGCCCAGAACATACTTACGGCAATCCAACAGGTGAGAAGCCTTATAGGCAATGAAGAGTT
TrpCysGlySerLeuIleGlyLeuThrSerArgAlaThrTrpAlaGlnAsnIleLeuThrAlaIleGlnGlnValArgSerLeuIleGlyAsnGluGluPhe>

10210   10220   10230   10240   10250   10260   10270   10280   10290   10300
TCTGGACTACATGCCTTCGATGAAGAGATTCAGGAAGGAGGAGGAGTCAGAGGGAGCCATTTGGTAAACGTAGGAAGTGAAAAAGAGGCAAACTGTCAGG
LeuAspTyrMetProSerMetLysArgPheArgLysGluGluGluSerGluGlyAlaIleTrp***>

10310   10320   10330   10340   10350   10360   10370   10380   10390   10400
CCACCTTAAGCCACAGTACGGAAGAAGCTGTGCAGCCTGTGAGCCCCGTCCAAGGACGTTAAAAGAAGAAGTCAGGCCCAAAAGCCACGGTTTGAGCAAA

10410   10420   10430   10440   10450   10460   10470   10480   10490   10500
CCGTGCTGCCTGTGGCTCCGTCGTGGGGACGTAAAACCTGGGAGGCTGCAAACTGTGGAAGCTGTACGCACGGTGTAGCAGACTAGCGGTTAGAGGAGAC

10510   10520   10530   10540   10550   10560   10570   10580   10590   10600
CCCTCCCATGACACAACGCAGCAGCGGGGCCCGAGCTCTGAGGGAAGCTGTACCTCCTTGCAAAGGACTAGAGGTTAGAGGAGACCCCCCGCAAATAAAA

10610   10620   10630   10640   10650   10660   10670   10680   10690   10700
ACAGCATATTGACGCTGGGAGAGACCAGAGATCCTGCTGTCTCCTCAGCATCATTCCAGGCACAGAACGCCAGAAAATGGAATGGTGCTGTTGAATCAAC

10710   10720   10730   10740   10750   10760   10770   10780   10790   10800
AGGTTCTGGTACCGGTAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCC

10810   10820   10830   10840   10850   10860   10870   10880   10890   10900
CATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCAT

10910   10920   10930   10940   10950   10960   10970   10980   10990   11000
AATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCT

11010   11020   11030   11040   11050   11060   11070   11080   11090   11100
CTTGCCCGGCGTCAACACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGAT

11110   11120   11130   11140   11150   11160   11170   11180   11190   11200
CTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACA

11210   11220   11230   11240   11250   11260   11270   11280   11290   11300
GGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTT

11310   11320   11330   11340   11350   11360   11370   11380   11390   11400
ATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGA

11410   11420   11430   11440   11450   11460   11470   11480   11490   11500
AACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTTCAAGAATTCTCATGTTTGACAGCTTATCATCGATAAGCT

11510   11520   11530   11540   11550   11560   11570   11580   11590   11600
TTAATGCGGTAGTTTATCACAGTTAAATTGCTAACGCAGTCAGGCACCGTGTATGAAATCTAACAATGCGCTCATCGTCATCCTCGGCACCGTCACCCTG

11610   11620   11630   11640   11650   11660   11670   11680   11690   11700
GATGCTGTAGGCATAGGCTTGGTTATGCCGGTACTGCCGGGCCTCTTGCGGGATATCGTCCATTCCGACAGCATCGCCAGTCACTATGGCGTGCTGCTGG

11710   11720   11730   11740   11750   11760   11770   11780   11790   11800
CGCTATATGCGTTGATGCAATTTCTATGCGCACCCGTTCTCGGAGCACTGTCCGACCGCTTTGGCCGCCGCCCAGTCCTGCTCGCTTCGCTACTTGGAGC

11810   11820   11830   11840   11850   11860   11870   11880   11890   11900
CACTATCGACTACGCGATCATGGCGACCACACCCGTCCTGTGGATCCTCTACGCCGGACGCATCGTGGCCGGCATCACCGGCGCCACAGGTGCGGTTGCT

11910   11920   11930   11940   11950   11960   11970   11980   11990   12000
GGCGCCTATATCGCGACATCACCGATGGGGAAGATCGGGCTCGCCACTTCGGGCTCATGAGCGCTTGTTTCGGCGTGGGTATGGTTGGCAGGCCCCGTGG

12010   12020   12030   12040   12050   12060   12070   12080   12090   12100
CCGGGGGACTGTTGGGCGCCATCTCCTTGCATGCACCATTCCTTGCGGCGGCGGTGCTCAACGGCCTCAACCTACTACTGGGCTGCTTCCTAATGCAGGA

12110   12120   12130   12140   12150   12160   12170   12180   12190   12200
GTCGCATAAGGGAGAGCGTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCATGACTATCGTCGCCGCACTTATG

12210   12220   12230   12240   12250   12260   12270   12280   12290   12300
ACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGGCC

12310   12320   12330   12340   12350   12360   12370   12380   12390   12400
TGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCCCGCCACCAAACGTTCGGCGAGAAGCAGGCCATTATCGCCGG

12410   12420   12430   12440   12450   12460   12470   12480   12490   12500
CATGGCGGCCGACGCGCTGGGCTACGTCTTGCTGGCGTTCGCGACGCGAGGCTGGATGGCCTTCCCCATTATGATTCTTCTCGCTTCCGGCGGCATCGGG

12510   12520   12530   12540   12550   12560   12570   12580   12590   12600
ATGCCCGCGTTGCAGGCCATGCTGTCCAGGCAGGTAGATGACGACCATCAGGGACAGCTTCAAGGATCGCTCGCGGCTCTTACCAGCCTAACTTCGATCA

12610   12620   12630   12640   12650   12660   12670   12680   12690   12700
CTGGACCGCTGATCGTCACGGCGATTTATGCCGCCTCGGCGAGCACATGGAACGGGTTGGCATGGATTGTAGGCGCCGCCCTATACCTTGTCTGCCTCCC

12710   12720   12730   12740   12750   12760   12770   12780   12790   12800
CGCGTTGCGTCGCGGTGCATGGAGCCGGGCCACCTCGACCTGAATGGAAGCCGGCGGCACCTCGCTAACGGATTCACCACTCCAAGAATTGGAGCCAATC

12810   12820   12830   12840   12850   12860   12870   12880   12890   12900
AATTCTTGCGGAGAACTGTGAATGCGCAAACCAACCCTTGGCAGAACATATCCATCGCGTCCGCCATCTCCAGCAGCCGCACGCGGCGCATCTCGGGCAG

12910   12920   12930   12940   12950   12960   12970   12980   12990   13000
CGTTGGGTCCTGGCCACGGGTGCGCATGATCGTGCTCCTGTCGTTGAGGACCCGGCTAGGCTGGCGGGGTTGCCTTACTGGTTAGCAGAATGAATCACCG

13010   13020   13030   13040   13050   13060   13070   13080   13090   13100
ATACGCGAGCGAACGTGAAGCGACTGCTGCTGCAAAACGTCTGCGACCTGAGCAACAACATGAATGGTCTTCGGTTTCCGTGTTTCGTAAAGTCTGGAAA

13110   13120   13130   13140   13150   13160   13170   13180   13190   13200
CGCGGAAGTCAGCGCCCTGCACCATTATGTTCCGGATCTGCATCGCAGGATGCTGCTGGCTACCCTGTGGAACACCTACATCTGTATTAACGAAGCGCTG

13210   13220   13230   13240   13250   13260   13270   13280   13290   13300
GCATTGACCCTGAGTGATTTTTCTCTGGTCCCGCCGCATCCATACCGCCAGTTGTTTACCCTCACAACGTTCCAGTAACCGGGCATGTTCATCATCAGTA

13310   13320   13330   13340   13350   13360   13370   13380   13390   13400
ACCCGTATCGTGAGCATCCTCTCTCGTTTCATCGGTATCATTACCCCCATGAACAGAAATCCCCCTTACACGGAGGCATCAGTGACCAAACAGGAAAAAA

13410   13420   13430   13440   13450   13460   13470   13480   13490   13500
CCGCCCTTAACATGGCCCGCTTTATCAGAAGCCAGACATTAACGCTTCTGGAGAAACTCAACGAGCTGGACGCGGATGAACAGGCAGACATCTGTGAATC

13510   13520   13530   13540   13550   13560   13570   13580   13590   13600
GCTTCACGACCACGCTGATGAGCTTTACCGCAGCTGCCTCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCACA

13610   13620   13630   13640   13650   13660   13670   13680   13690   13700
GCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCG

13710   13720   13730   13740   13750   13760   13770   13780   13790   13800
ATAGCGGAGTGTATACTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGA

13810   13820   13830   13840   13850   13860   13870   13880   13890   13900
AAATACCGCATCAGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAA

13910   13920   13930   13940   13950   13960   13970   13980   13990   14000
TACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTT

14010   14020   14030   14040   14050   14060   14070   14080   14090   14100
TTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCC

14110   14120   14130   14140   14150   14160   14170   14180   14190   14200
CCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCT

14210   14220   14230   14240   14250   14260   14270   14280   14290   14300
CACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAA

14310   14320   14330   14340   14350   14360   14370   14380   14390   14400
CTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACA

14410   14420   14430   14440   14450   14460   14470   14480   14490   14500
GAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTA

14510   14520   14530   14540   14550   14560   14570   14580   14590   14600
GCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTT

14610   14620   14630   14640   14650   14660   14670   14680   14690   14700
GATCTTTTCTACGGGGTCTGACGCTCATTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTA

14710   14720   14730   14740   14750   14760   14770   14780   14790   14800
AATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCT

14810   14820   14830   14840   14850   14860   14870   14880   14890   14900
GTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCG

14910   14920   14930   14940   14950   14960   14970   14980   14990   15000
AGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAG

15010   15020   15030   15040   15050   15060   15070   15080   15090   15100
TCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTGCAAGATCTGGCTAGCGATGACCCT

15110   15120   15130   15140   15150
GCTGATTGGTTCGCTGACCATTTCCGGGCGCGCCGATTTAGGTGACACTATAG

Bases 1 to 10707: DEN3 virus genome cDNA
Bases 95 to 10264: DEN3 polyprotein ORF
Bases 95 to 436: C protein ORF
Bases 437 to 934: prM protein ORF
Bases 935 to 2413: E protein ORF
Bases 2414 to 3469: NS1 protein ORF
Bases 3470 to 4123: NS2A protein ORF
Bases 4124 to 4513: NS2B protein ORF
Bases 4514 to 6370: NS3 protein ORF
Bases 6371 to 6751: NS4A protein ORF
Bases 6752 to 6820: 2K protein ORF
Bases 6821 to 7564: NS4B protein ORF
Bases 7575 to 10264 NS5 protein ORF

APPENDIX 3

Nucleotide and amino acid sequence of DEN1 (Puerto Rico/94) CME chimeric region


10        20        30        40        50        60        70        80        90        100
AGTTGTTAGTCTGTGTGGACCGACAAGGACAGTTCCAAATCGGAAGCTTGCTTAACACAGTTCTAACAGTTTGTTTGAATAGAGAGCAGATCTCTGGAAA

110       120       130       140       150       160       170       180       190       200
AATGAACAACCAACGGAAAAAGACGGGTCGACCGTCTTTCAATATGCTGAAACGCGCGAGAAACCGCGTGTCAACTGGTTCACAGTTGGCGAAGAGATTC
MetAsnAsnGlnArgLysLysThrGlyArgProSerPheAsnMetLeuLysArgAlaArgAsnArgValSerThrGlySerGlnLeuAlaLysArgPhe>

210       220       230       240       250       260       270       280       290       300
TCAAAAGGATTGCTTTCAGGCCAAGGACCCATGAAATTGGTGATGGCTTTCATAGCATTTCTAAGATTTCTAGCCATACCCCCAACAGCAGGAATTTTGG
SerLysGlyLeuLeuSerGlyGlnGlyProMetLysLeuValMetAlaPheIleAlaPheLeuArgPheLeuAlaIleProProThrAlaGlyIleLeu>

310       320       330       340       350       360       370       380       390       400
CTAGATGGAGCTCATTCAAGAAGAATGGAGCGATCAAAGTGTTACGGGGTTTCAAAAAAGAGATCTCAAGCATGTTGAACATTATGAACAGGAGGAAAAA
AlaArgTrpSerSerPheLysLysAsnGlyAlaIleLysValLeuArgGlyPheLysLysGluIleSerSerMetLeuAsnIleMetAsnArgArgLysLys>

410       420       430       440       450       460       470       480       490       500
ATCTGTGACCATGCTCCTCATGCTGCTGCCCACAGCCCTGGCGTTCCATTTGACCACACGAGGGGGAGAGCCACACATGATAGTTAGTAAGCAGGAAAGA
SerValThrMetLeuLeuMetLeuLeuProThrAlaLeuAlaPheHisLeuThrThrArgGlyGlyGluProHisMetIleValSerLysGlnGluArg>

510       520       530       540       550       560       570       580       590       600
GGAAAGTCACTGTTGTTTAAGACCTCTGCAGGCATCAATATGTGCACTCTCATTGCGATGGATTTGGGAGAGTTATGCGAGGACACAATGACCTACAAAT
GlyLysSerLeuLeuPheLysThrSerAlaGlyIleAsnMetCysThrLeuIleAlaMetAspLeuGlyGluLeuCysGluAspThrMetThrTyrLys>

610       620       630       640       650       660       670       680       690       700
GCCCCCGGATCACTGAGGCGGAACCAGATGACGTTGACTGCTGGTGCAATGCCACAGACACATGGGTGACCTATGGGACGTGTTCTCAAACCGGCGAACA
CysProArgIleThrGluAlaGluProAspAspValAspCysTrpCysAsnAlaThrAspThrTrpValThrTyrGlyThrCysSerGlnThrGlyGluHis>

710       720       730       740       750       760       770       780       790       800
CCGACGAGACAAACGTTCCGTGGCACTGGCCCCACACGTGGGACTTGGTCTAGAAACAAGAACCGAAACATGGATGTCCTCTGAAGGTGCCTGGAAACAA
ArgArgAspLysArgSerValAlaLeuAlaProHisValGlyLeuGlyLeuGluThrArgThrGluThrTrpMetSerSerGluGlyAlaTrpLysGln>

810       820       830       840       850       860       870       880       890       900
GTACAAAAAGTGGAGACTTGGGCTTTGAGACACCCAGGATTCACGGTGACAGCCCTTTTTTTAGCACATGCCATAGGAACATCCATTACTCAGAAAGGGA
ValGlnLysValGluThrTrpAlaLeuArgHisProGlyPheThrValThrAlaLeuPheLeuAlaHisAlaIleGlyThrSerIleThrGlnLysGly>

910       920       930       940       950       960       970       980       990       1000
TCATTTTCATTCTGCTGATGCTAGTAACACCATCAATGGCCATGCGATGTGTGGGAATAGGCAACAGAGACTTCGTTGAAGGACTGTCAGGAGCAACGTG
IleIlePheIleLeuLeuMetLeuValThrProSerMetAlaMetArgCysValGlyIleGlyAsnArgAspPheValGluGlyLeuSerGlyAlaThrTrp>

1010      1020      1030      1040      1050      1060      1070      1080      1090      1100
GGTGGACGTGGTATTGGAGCATGGAAGCTGCGTCACCACCATGGCAAAAGATAAACCAACATTGGACATTGAACTCTTGAAGACGGAGGTCACAAACCCT
ValAspValValLeuGluHisGlySerCysValThrThrMetAlaLysAspLysProThrLeuAspIleGluLeuLeuLysThrGluValThrAsnPro>

1110      1120      1130      1140      1150      1160      1170      1180      1190      1200
GCCGTCTTGCGCAAACTGTGCATTGAAGCTAAAATATCAAACACCACCACCGATTCAAGGTGTCCAACACAAGGAGAGGCTACACTGGTGGAAGAACAGG
AlaValLeuArgLysLeuCysIleGluAlaLysIleSerAsnThrThrThrAspSerArgCysProThrGlnGlyGluAlaThrLeuValGluGluGln>

1210      1220      1230      1240      1250      1260      1270      1280      1290      1300
ACTCGAACTTTGTGTGTCGACGAACGTTTGTGGACAGAGGCTGGGGTAATGGCTGCGGACTATTTGGAAAAGGAAGCCTACTGACGTGTGCTAAGTTCAA
AspSerAsnPheValCysArgArgThrPheValAspArgGlyTrpGlyAsnGlyCysGlyLeuPheGlyLysGlySerLeuLeuThrCysAlaLysPheLys>

1310      1320      1330      1340      1350      1360      1370      1380      1390      1400
GTGTGTGACAAAACTAGAAGGAAAGATAGTTCAATATGAAAACTTAAAATATTCAGTGATAGTCACTGTCCACACTGGGGACCAGCACCAGGTGGGAAAC
CysValThrLysLeuGluGlyLysIleValGlnTyrGluAsnLeuLysTyrSerValIleValThrValHisThrGlyAspGlnHisGlnValGlyAsn>

1410      1420      1430      1440      1450      1460      1470      1480      1490      1500
GAGACTACAGAACATGGAACAATTGCAACCATAACACCTCAAGCTCCTACGTCGGAAATACAGCTGACTGACTACGGAGCCCTCACATTGGACTGCTCGC
GluThrThrGluHisGlyThrIleAlaThrIleThrProGlnAlaProThrSerGluIleGlnLeuThrAspTyrGlyAlaLeuThrLeuAspCysSer>

1510      1520      1530      1540      1550      1560      1570      1580      1590      1600
CTAGAACAGGGCTGGACTTTAATGAGATGGTTCTATTGACAATGAAAGAAAAATCATGGCTTGTCCACAAACAATGGTTTCTAGACTTACCACTGCCTTG
ProArgThrGlyLeuAspPheAsnGluMetValLeuLeuThrMetLysGluLysSerTrpLeuValHisLysGlnTrpPheLeuAspLeuProLeuProTrp>

1610      1620      1630      1640      1650      1660      1670      1680      1690      1700
GACTTCAGGAGCTTCAACATCTCAAGAGACTTGGAACAGACAAGATTTGCTGGTCACATTCAAGACAGCTCATGCAAAGAAACAGGAAGTAGTCGTACTG
ThrSerGlyAlaSerThrSerGlnGluThrTrpAsnArgGlnAspLeuLeuValThrPheLysThrAlaHisAlaLysLysGlnGluValValValLeu>

1710      1720      1730      1740      1750      1760      1770      1780      1790      1800
GGATCACAGGAAGGAGCAATGCACACTGCGTTGACTGGGGCGACAGAAATCCAGACGTCAGGAACGACAACAATCTTTGCAGGACACCTGAAATGCAGAC
GlySerGlnGluGlyAlaMetHisThrAlaLeuThrGlyAlaThrGluIleGlnThrSerGlyThrThrThrIlePheAlaGlyHisLeuLysCysArg>

1810      1820      1830      1840      1850      1860      1870      1880      1890      1900
TAAAAATGGATAAACTGACTTTAAAAGGGAGTCATATGTAATGTGCACAGGCTCATTTAAGCTAGAGAAGGAAGTGGCTGAGACCCAGCATGGAACTGT
LeuLysMetAspLysLeuThrLeuLysGlyMetSerTyrValMetCysThrGlySerPheLysLeuGluLysGluValAlaGluThrGlnHisGlyThrVal>

1910      1920      1930      1940      1950      1960      1970      1980      1990      2000
TTTAGTGCAGGTTAAATACGAAGGAACAGATGCGCCATGCAAGATCCCTTTTTCGGCCCAAGATGAGAAAGGAGTGACCCAGAATGGGAGATTGATAACA
LeuValGlnValLysTyrGluGlyThrAspAlaProCysLysIleProPheSerAlaGlnAspGluLysGlyValThrGlnAsnGlyArgLeuIleThr>

2010      2020      2030      2040      2050      2060      2070      2080      2090      2100
GCCAACCCCATAGTCACTGACAAAGAAAAACCAGTCAACATTGAGACAGAACCACCTTTTGGTGAGAGCTACATCGTGGTAGGGGCAGGTGAAAAAGCTT
AlaAsnProIleValThrAspLysGluLysProValAsnIleGluThrGluProProPheGlyGluSerTyrIleValValGlyAlaGlyGluLysAla>

2110      2120      2130      2140      2150      2160      2170      2180      2190      2200
TGAAACTGAGCTGGTTCAAGAAAGGGAGCAGCATAGGGAAAATGTTCGAAGCAACTGCCCGAGGAGCGCGAAGGATGGCTATCCTGGGAGACACCGCATG
LeuLysLeuSerTrpPheLysLysGlySerSerIleGlyLysMetPheGluAlaThrAlaArgGlyAlaArgArgMetAlaIleLeuGlyAspThrAlaTrp>

2210      2220      2230      2240      2250      2260      2270      2280      2290      2300
GGACTTTGGCTCTATAGGAGGAGTGTTCACATCAGTGGGAAAATTGGTACACCAGGTTTTTGGAGCCGCATATGGGGTTCTGTTCAGCGGTGTTTCTTGG
AspPheGlySerIleGlyGlyValPheThrSerValGlyLysLeuValHisGlnValPheGlyAlaAlaTyrGlyValLeuPheSerGlyValSerTyr>

2310      2320      2330      2340      2350      2360      2370      2380      2390      2400
ACCATGAAAATAGGAATAGGGATTCTGCTGACATGGCTAGGATTAAACTCGAGGAACACTTCAATGGCTATGACGTGCATAGCTGTTGGAGGAATCACTC
ThrMetLysIleGlyIleGlyIleLeuLeuThrTrpLeuGlyLeuAsnSerArgAsnThrSerMetAlaMetThrCysIleAlaValGlyGlyIleThr>

2410      2420
TGTTTCTGGGCTTCACAGTTCAAGCA
LeuPheLeuGlyPheThrValGlnAla>

Bases 1 to 88 (BglII): DEN4
Bases 89 (BglII) to 2348 (XhoI): DEN1
Bases 2349 (XhoI) to 2426: DEN4
Bases 102 to 443: C protein ORF
Bases 444 to 941: prM protein ORF
Bases 942 to 2426: E protein ORF

APPENDIX 4

Nucleotide and amino acid sequence of DEN1 (Puerto Rico/94) ME chimeric region


10        20        30        40        50        60        70        80        90       100
AGTTGTTAGTCTGTGTGGACCGACAAGGACAGTTCCAAATCGGAAGCTTGCTTAACACAGTTCTAACAGTTTGTTTGAATAGAGAGCAGATCTCTGGAAA

110       120       130       140       150       160       170       180       190       200
AATGAACCAACGAAAAAAGGTGGTTAGACCACCTTTCAATATGCTGAAACGCGAGAGAAACCGCGTATCAACCCCTCAAGGGTTGGTGAAGAGATTCTCA
MetAsnGlnArgLysLysValValArgProProPheAsnMetLeuLysArgGluArgAsnArgValSerThrProGlnGlyLeuValLysArgPheSer>

210       220       230       240       250       260       270       280       290       300
ACCGGACTTTTTTCTGGGAAAGGACCCTTACGGATGGTGCTAGCATTCATCACGTTTTTGCGAGTCCTTTCCATCCCACCAACAGCAGGGATTCTGAAGA
ThrGlyLeuPheSerGlyLysGlyProLeuArgMetValLeuAlaPheIleThrPheLeuArgValLeuSerIleProProThrAlaGlyIleLeuLys>

310       320       330       340       350       360       370       380       390       400
GATGGGGACAGTTGAAGAAAAATAAGGCCATCAAGATACTGATTGGATTCAGGAAGGAGATAGGCCGCATGCTGAACATCTTGAACGGGAGAAAAAGGTC
ArgTrpGlyGlnLeuLysLysAsnLysAlaIleLysIleLeuIleGlyPheArgLysGluIleGlyArgMetLeuAsnIleLeuAsnGlyArgLysArgSer>

410       420       430       440       450       460       470       480       490       500
TGCAGCCATGCTCCTCATGCTGCTGCCCACAGCCCTGGCGTTCCATTTGACCACACGAGGGGGAGAGCCACACATGATAGTTAGTAAGCAGGAAAGAGGA
AlaAlaMetLeuLeuMetLeuLeuProThrAlaLeuAlaPheHisLeuThrThrArgGlyGlyGluProHisMetIleValSerLysGlnGluArgGly>

510       520       530       540       550       560       570       580       590       600
AAGTCACTGTTGTTTAAGACCTCTGCAGGCATCAATATGTGCACTCTCATTGCGATGGATTTGGGAGAGTTATGCGAGGACACAATGACCTACAAATGCC
LysSerLeuLeuPheLysThrSerAlaGlyIleAsnMetCysThrLeuIleAlaMetAspLeuGlyGluLeuCysGluAspThrMetThrTyrLysCys>

610       620       630       640       650       660       670       680       690       700
CCCGGATCACTGAGGCGGAACCAGATGACGTTGACTGCTGGTGCAATGCCACAGACACATGGGTGACCTATGGGACGTGTTCTCAAACCGGCGAACACCG
ProArgIleThrGluAlaGluProAspAspValAspCysTrpCysAsnAlaThrAspThrTrpValThrTyrGlyThrCysSerGlnThrGlyGluHisArg>

710       720       730       740       750       760       770       780       790       800
ACGAGACAAACGTTCCGTGGCACTGGCCCCACACGTGGGACTTGGTCTAGAAACAAGAACCGAAACATGGATGTCCTCTGAAGGTGCCTGGAAACAAGTA
ArgAspLysArgSerValAlaLeuAlaProHisValGlyLeuGlyLeuGluThrArgThrGluThrTrpMetSerSerGluGlyAlaTrpLysGlnVal>

810       820       830       840       850       860       870       880       890       900
CAAAAAGTGGAGACTTGGGCTTTGAGACACCCAGGATTCACGGTGACAGCCCTTTTTTTAGCACATGCCATAGGAACATCCATTACTCAGAAAGGGATCA
GlnLysValGluThrTrpAlaLeuArgHisProGlyPheThrValThrAlaLeuPheLeuAlaHisAlaIleGlyThrSerIleThrGlnLysGlyIle>

910       920       930       940       950       960       970       980       990       1000
TTTTCATTCTGCTGATGCTAGTAACACCATCAATGGCCATGCGATGTGTGGGAATAGGCAACAGAGACTTCGTTGAAGGACTGTCAGGAGCAACGTGGGT
IlePheIleLeuLeuMetLeuValThrProSerMetAlaMetArgCysValGlyIleGlyAsnArgAspPheValGluGlyLeuSerGlyAlaThrTrpVal>

1010      1020      1030      1040      1050      1060      1070      1080      1090      1100
GGACGTGGTATTGGAGCATGGAAGCTGCGTCACCACCATGGCAAAAGATAAACCAACATTGGACATTGAACTCTTGAAGACGGAGGTCACAAACCCTGCC
AspValValLeuGluHisGlySerCysValThrThrMetAlaLysAspLysProThrLeuAspIleGluLeuLeuLysThrGluValThrAsnProAla>

1110      1120      1130      1140      1150      1160      1170      1180      1190      1200
GTCTTGCGCAAACTGTGCATTGAAGCTAAAATATCAAACACCACCACCGATTCAAGGTGTCCAACACAAGGAGAGGCTACACTGGTGGAAGAACAGGACT
ValLeuArgLysLeuCysIleGluAlaLysIleSerAsnThrThrThrAspSerArgCysProThrGlnGlyGluAlaThrLeuValGluGluGlnAsp>

1210      1220      1230      1240      1250      1260      1270      1280      1290      1300
CGAACTTTGTGTGTCGACGAACGTTTGTGGACAGAGGCTGGGGTAATGGCTGCGGACTATTTGGAAAAGGAAGCCTACTGACGTGTGCTAAGTTCAAGTG
SerAsnPheValCysArgArgThrPheValAspArgGlyTrpGlyAsnGlyCysGlyLeuPheGlyLysGlySerLeuLeuThrCysAlaLysPheLysCys>

1310      1320      1330      1340      1350      1360      1370      1380      1390      1400
TGTGACAAAACTAGAAGGAAAGATAGTTCAATATGAAAACTTAAAATATTCAGTGATAGTCACTGTCCACACTGGGGACCAGCACCAGGTGGGAAACGAG
ValThrLysLeuGluGlyLysIleValGlnTyrGluAsnLeuLysTyrSerValIleValThrValHisThrGlyAspGlnHisGlnValGlyAsnGlu>

1410      1420      1430      1440      1450      1460      1470      1480      1490      1500
ACTACAGAACATGGAACAATTGCAACCATAACACCTCAAGCTCCTACGTCGGAAATACAGCTGACTGACTACGGAGCCCTCACATTGGACTGCTCGCCTA
ThrThrGluHisGlyThrIleAlaThrIleThrProGlnAlaProThrSerGluIleGlnLeuThrAspTyrGlyAlaLeuThrLeuAspCysSerPro>

1510      1520      1530      1540      1550      1560      1570      1580      1590      1600
GAACAGGGCTGGACTTTAATGAGATGGTTCTATTGACAATGAAAGAAAAATCATGGCTTGTCCACAAACAATGGTTTCTAGACTTACCACTGCCTTGGAC
ArgThrGlyLeuAspPheAsnGluMetValLeuLeuThrMetLysGluLysSerTrpLeuValHisLysGlnTrpPheLeuAspLeuProLeuProTrpThr>

1610      1620      1630      1640      1650      1660      1670      1680      1690      1700
TTCAGGAGCTTCAACATCTCAAGAGACTTGGAACAGACAAGATTTGCTGGTCACATTCAAGACAGCTCATGCAAAGAAACAGGAAGTAGTCGTACTGGGA
SerGlyAlaSerThrSerGlnGluThrTrpAsnArgGlnAspLeuLeuValThrPheLysThrAlaHisAlaLysLysGlnGluValValValLeuGly>

1710      1720      1730      1740      1750      1760      1770      1780      1790      1800
TCACAGGAAGGAGCAATGCACACTGCGTTGACTGGGGCGACAGAAATCCAGACGTCAGGAACGACAACAATCTTTGCAGGACACCTGAAATGCAGACTAA
SerGlnGluGlyAlaMetHisThrAlaLeuThrGlyAlaThrGluIleGlnThrSerGlyThrThrThrIlePheAlaGlyHisLeuLysCysArgLeu>

1810      1820      1830      1840      1850      1860      1870      1880      1890      1900
AAATGGATAAACTGACTTTAAAAGGGATGTCATATGTAATGTGCACAGGCTCATTTAAGCTAGAGAAGGAAGTGGCTGAGACCCAGCATGGAACTGTTTT
LysMetAspLysLeuThrLeuLysGlyMetSerTyrValMetCysThrGlySerPheLysLeuGluLysGluValAlaGluThrGlnHisGlyThrValLeu>

1910      1920      1930      1940      1950      1960      1970      1980      1990      2000
AGTGCAGGTTAAATACGAAGGAACAGATGCGCCATGCAAGATCCCTTTTTCGGCCCAAGATGAGAAAGGAGTGACCCAGAATGGGAGATTGATAACAGCC
ValGlnValLysTyrGluGlyThrAspAlaProCysLysIleProPheSerAlaGlnAspGluLysGlyValThrGlnAsnGlyArgLeuIleThrAla>

2010      2020      2030      2040      2050      2060      2070      2080      2090      2100
AACCCCATAGTCACTGACAAAGAAAAACCAGTCAACATTGAGACAGAACCACCTTTTGGTGAGAGCTACATCGTGGTAGGGGCAGGTGAAAAAGCTTTGA
AsnProIleValThrAspLysGluLysProValAsnIleGluThrGluProProPheGlyGluSerTyrIleValValGlyAlaGlyGluLysAlaLeu>

2110      2120      2130      2140      2150      2160      2170      2180      2190      2200
AACTGAGCTGGTTCAAGAAAGGGAGCAGCATAGGGAAAATGTTCGAAGCAACTGCCCGAGGAGCGCGAAGGATGGCTATCCTGGGAGACACCGCATGGGA
LysLeuSerTrpPheLysLysGlySerSerIleGlyLysMetPheGluAlaThrAlaArgGlyAlaArgArgMetAlaIleLeuGlyAspThrAlaTrpAsp>

2210      2220      2230      2240      2250      2260      2270      2280      2290      2300
CTTTGGCTCTATAGGAGGAGTGTTCACATCAGTGGGAAAATTGGTACACCAGGTTTTTGGAGCCGCATATGGGGTTCTGTTCAGCGGTGTTTCTTGGACC
PheGlySerIleGlyGlyValPheThrSerValGlyLysLeuValHisGlnValPheGlyAlaAlaTyrGlyValLeuPheSerGlyValSerTrpThr>

2310      2320      2330      2340      2350      2360      2370      2380      2390      2400
ATGAAAATAGGAATAGGGATTCTGCTGACATGGCTAGGATTAAACTCGAGGAACACTTCAATGGCTATGACGTGCATAGCTGTTGGAGGAATCACTCTGT
MetLysIleGlyIleGlyIleLeuLeuThrTrpLeuGlyLeuAsnSerArgAsnThrSerMetAlaMetThrCysIleAlaValGlyGlyIleThrLeu>

2410      2420
TTCTGGGCTTCACAGTTCAAGCA
PheLeuGlyPheThrValGlnAla

Bases 1 to 404 (PstI): DEN4
Bases 405 (PstI) to 2345 (XhoI): DEN1
Bases 2346 (XhoI) to 2423: DEN4
Bases 102 to 440: C protein ORF
Bases 441 to 938: prM protein ORF
Bases 939 to 2423: E protein ORF

While the present invention has been described in some detail for purposes of clarity and understanding, one skilled in the art will appreciate that various changes in form and detail can be made without departing from the true scope of the invention. All figures, tables, appendices, patents, patent applications and publications, referred to above, are hereby incorporated by reference.

Claims

1. A tetravalent immunogenic composition comprising

a) a first attenuated virus that is immunogenic against dengue serotype 1,

b) a second attenuated virus that is immunogenic against dengue serotype 2,

c) a third attenuated virus that is immunogenic against dengue serotype 3, and

d) a fourth attenuated virus that is immunogenic against dengue serotype 4,

wherein each of a), b), c) and d) comprises a nucleic acid comprising

i) a first nucleotide sequence encoding at least one structural protein from a first dengue virus,

ii) a second nucleotide sequence encoding nonstructural proteins from the first dengue virus or a second dengue virus, and

iii) a 3′ untranslated region, wherein the 3′ untranslated region contains a deletion of about 30 nucleotides corresponding to the TL2 stem-loop structure, and wherein both the 3′ untranslated region and the second nucleotide sequence encoding nonstructural proteins are from either the first dengue virus or the second dengue virus;

wherein the tetravalent immunogenic composition is not rDEN1/4Δ30, rDEN2/4Δ30, rDEN3/4Δ30, rDEN4Δ30.

2. The tetravalent immunogenic composition of claim 1, wherein the nucleic acid of at least one of a), b), c) or d) further comprises a mutation that confers a phenotype wherein the phenotype is temperature sensitivity in Vero cells or the human liver cell line HuH-7, host-cell restriction in mosquito cells or the human liver cell line HuH-7, host-cell adaptation for improved replication in Vero cells, or attenuation in mice or monkeys.

3. The composition of claim 1, wherein the first nucleotide sequence encoding at least one structural protein and the second nucleotide sequence encoding nonstructural proteins of at least one of a), b), c) and d) are from the first dengue virus.

4. The composition of claim 3, wherein the deletion of a) is a deletion of about 30 nucleotides from the 3′ untranslated region of the dengue type 1 genome corresponding to the TL2 stem-loop structure between about nucleotides 10562-10591.

5. The composition of claim 3, wherein the deletion of b) is a deletion of about 30 nucleotides from the 3′ untranslated region of the dengue type 2 genome corresponding to the TL2 stem-loop structure between about nucleotides 10541-10570.

6. The composition of claim 3, wherein the deletion of c) is by a deletion of about 30 nucleotides from the 3′ untranslated region of the dengue type 3 genome corresponding to the TL2 stem-loop structure between about nucleotides 10535-10565.

7. The composition of claim 3, herein the deletion of d) is a deletion of about 30 nucleotides from the 3′ untranslated region of the dengue type 4 genome corresponding to the TL2 stem-loop structure between about nucleotides 10478-10507.

8. The composition of claim 1, wherein the first nucleotide sequence encoding at least one structural protein of at least one of a), b), c), and d) is from the first dengue virus and the second nucleotide sequence encoding nonstructural proteins of at least one of a), b), c), and d) is from the second dengue virus, wherein the serotype of the first dengue virus and the second dengue virus are different.

9. The composition of claim 8, wherein the serotype of the second dengue virus having the deletion is type 1.

10. The composition of claim 9, wherein the serotype of the first dengue virus of b) is type 2.

11. The composition of claim 9, wherein the serotype of the first dengue virus of c) is type 3.

12. The composition of claim 9, wherein the serotype of the first dengue virus of d) is type 4.

13. The composition of claim 9, wherein the first nucleotide sequence encodes at least two structural proteins of the first dengue virus.

14. The composition of claim 13, wherein the structural proteins are prM and E proteins.

15. The composition of claim 9, wherein the deletion of a) is a deletion of about 30 nucleotides from the 3′ untranslated region of the dengue type 1 genome corresponding to the TL2 stem-loop structure between about nucleotides 10562 and 10591.

16. The composition of claim 8, wherein the serotype of the second dengue virus having the deletion is type 2.

17. The composition of claim 16, wherein the serotype of the first dengue virus of a) is type 1.

18. The composition of claim 16, wherein the serotype of the first dengue virus of c) is type 3.

19. The composition of claim 16, wherein the serotype of the first dengue of d) virus is type 4.

20. The composition of claim 16, wherein the first nucleotide sequence encodes at least two structural proteins of the first dengue virus.

21. The composition of claim 20, wherein the structural proteins are prM and E proteins.

22. The composition of claim 16, wherein the deletion is a deletion of about 30 nucleotides from the 3′ untranslated region of the dengue type 2 genome corresponding to the TL2 stem-loop structure between about nucleotides 10541 and 10570.

23. The composition of claim 8, wherein the serotype of the second dengue virus having the deletion is type 3.

24. The composition of claim 23, wherein the serotype of the first dengue virus of a) is type 1.

25. The composition of claim 23, wherein the serotype of the first dengue virus of b) is type 2.

26. The composition of claim 23, wherein the serotype of the first dengue virus of d) is type 4.

27. The composition of claim 23, wherein the first nucleotide sequence encodes at least two structural proteins of the first dengue virus.

28. The composition of claim 27, wherein the structural proteins are prM and E proteins.

29. The composition of claim 23, wherein the deletion is a deletion of about 30 nucleotides from the 3′ untranslated region of the dengue type 3 genome corresponding to the TL2 stem-loop structure between about nucleotides 10535 and 10565.

30. The composition of claim 8, wherein the serotype of the second dengue virus having the deletion is type 4.

31. The composition of claim 30, wherein the serotype of the first dengue virus of a) is type 1.

32. The composition of claim 30, wherein the serotype of the first dengue virus of b) is type 2.

33. The composition of claim 30, wherein the serotype of the first dengue virus of c) is type 3.

34. The composition of claim 30, wherein the first nucleotide sequence encodes at least two structural proteins of the first dengue virus.

35. The composition of claim 34, wherein the structural proteins are prM and E proteins.

36. The composition of claim 30, wherein the deletion is a deletion of about 30 nucleotides from the 3′ untranslated region of the dengue type 4 genome corresponding to the TL2 stem-loop structure between about nucleotides 10478 and 10507.

37. A method of inducing an immune response in a subject comprising administering an effective amount of the composition of claim 1 to the subject.

38. The method of claim 37 wherein the subject is a human.

39. A tetravalent vaccine comprising the composition of claim 1.

40. A method of preventing disease caused by dengue virus in a subject comprising administering an effective amount of the vaccine of claim 39 to the subject.

41. The method of claim 40 wherein the subject is a human.

42. The tetravalent immunogenic composition defined in claim 1, selected from the group consisting of:

(1) rDEN1Δ30, rDEN2Δ30, rDEN3Δ30, rDEN4Δ30,

(2) rDEN1Δ30, rDEN2Δ30, rDEN3Δ30, rDEN4/1Δ30,

(3) rDEN1Δ30, rDEN2Δ30, rDEN3Δ30, rDEN4/2Δ30,

(4) rDEN1Δ30, rDEN2Δ30, rDEN3Δ30, rDEN4/3Δ30,

(5) rDEN1Δ30, rDEN2Δ30, rDEN3/1Δ30, rDEN4Δ30,

(6) rDEN1Δ30, rDEN2Δ30, rDEN3/1Δ30, rDEN4/1Δ30,

(7) rDEN1Δ30, rDEN2Δ30, rDEN3/1Δ30, rDEN4/2Δ30,

(8) rDEN1Δ30, rDEN2Δ30, rDEN3/1Δ30, rDEN4/3Δ30,

(9) rDEN1Δ30, rDEN2Δ30, rDEN3/2Δ30, rDEN4Δ30,

(10) rDEN1Δ30, rDEN2Δ30, rDEN3/2Δ30, rDEN4/1Δ30,

(11) rDEN1Δ30, rDEN2Δ30, rDEN3/2Δ30, rDEN4/2Δ30,

(12) rDEN1Δ30, rDEN2Δ30, rDEN3/2Δ30, rDEN4/3Δ30,

(13) rDEN1Δ30, rDEN2Δ30, rDEN3/4Δ30, rDEN4Δ30,

(14) rDEN1Δ30, rDEN2Δ30, rDEN3/4Δ30, rDEN4/1Δ30,

(15) rDEN1Δ30, rDEN2Δ30, rDEN3/4Δ30, rDEN4/2Δ30,

(16) rDEN1Δ30, rDEN2Δ30, rDEN3/4Δ30, rDEN4/3Δ30,

(17) rDEN1Δ30, rDEN2/1Δ30, rDEN3Δ30, rDEN4Δ30,

(18) rDEN1Δ30, rDEN2/1Δ30, rDEN3Δ30, rDEN4/1Δ30,

(19) rDEN1Δ30, rDEN2/1Δ30, rDEN3Δ30, rDEN4/2Δ30,

(20) rDEN1Δ30, rDEN2/1Δ30, rDEN3Δ30, rDEN4/3Δ30,

(21) rDEN1Δ30, rDEN2/1Δ30, rDEN3/1Δ30, rDEN4Δ30,

(22) rDEN1Δ30, rDEN2/1Δ30, rDEN3/1Δ30, rDEN4/1Δ30,

(23) rDEN1Δ30, rDEN2/1Δ30, rDEN3/1Δ30, rDEN4/2Δ30,

(24) rDEN1Δ30, rDEN2/1Δ30, rDEN3/1Δ30, rDEN4/3Δ30,

(25) rDEN1Δ30, rDEN2/1Δ30, rDEN3/2Δ30, rDEN4Δ30,

(26) rDEN1Δ30, rDEN2/1Δ30, rDEN3/2Δ30, rDEN4/1Δ30,

(27) rDEN1Δ30, rDEN2/1Δ30, rDEN3/2Δ30, rDEN4/2Δ30,

(28) rDEN1Δ30, rDEN2/1Δ30, rDEN3/2Δ30, rDEN4/3Δ30,

(29) rDEN1Δ30, rDEN2/1Δ30, rDEN3/4Δ30, rDEN4Δ30,

(30) rDEN1Δ30, rDEN2/1Δ30, rDEN3/4Δ30, rDEN4/1Δ30,

(31) rDEN1Δ30, rDEN2/1Δ30, rDEN3/4Δ30, rDEN4/2Δ30,

(32) rDEN1Δ30, rDEN2/1Δ30, rDEN3/4Δ30, rDEN4/3Δ30,

(33) rDEN1Δ30, rDEN2/3Δ30, rDEN3Δ30, rDEN4Δ30,

(34) rDEN1Δ30, rDEN2/3Δ30, rDEN3Δ30, rDEN4/1Δ30,

(35) rDEN1Δ30, rDEN2/3Δ30, rDEN3Δ30, rDEN4/2Δ30,

(36) rDEN1Δ30, rDEN2/3Δ30, rDEN3Δ30, rDEN4/3Δ30,

(37) rDEN1Δ30, rDEN2/3Δ30, rDEN3/1Δ30, rDEN4Δ30,

(38) rDEN1Δ30, rDEN2/3Δ30, rDEN3/1Δ30, rDEN4/1Δ30,

(39) rDEN1Δ30, rDEN2/3Δ30, rDEN3/1Δ30, rDEN4/2Δ30,

(40) rDEN1Δ30, rDEN2/3Δ30, rDEN3/1Δ30, rDEN4/3Δ30,

(41) rDEN1Δ30, rDEN2/3Δ30, rDEN3/2Δ30, rDEN4Δ30,

(42) rDEN1Δ30, rDEN2/3Δ30, rDEN3/2Δ30, rDEN4/1Δ30,

(43) rDEN1Δ30, rDEN2/3Δ30, rDEN3/2Δ30, rDEN4/2Δ30,

(44) rDEN1Δ30, rDEN2/3Δ30, rDEN3/2Δ30, rDEN4/3Δ30,

(45) rDEN1Δ30, rDEN2/3Δ30, rDEN3/4Δ30, rDEN4Δ30,

(46) rDEN1Δ30, rDEN2/3Δ30, rDEN3/4Δ30, rDEN4/1Δ30,

(47) rDEN1Δ30, rDEN2/3Δ30, rDEN3/4Δ30, rDEN4/2Δ30,

(48) rDEN1Δ30, rDEN2/3Δ30, rDEN3/4Δ30, rDEN4/3Δ30,

(49) rDEN1Δ30, rDEN2/4Δ30, rDEN3Δ30, rDEN4Δ30,

(50) rDEN1Δ30, rDEN2/4Δ30, rDEN3Δ30, rDEN4/1Δ30,

(51) rDEN1Δ30, rDEN2/4Δ30, rDEN3Δ30, rDEN4/2Δ30,

(52) rDEN1Δ30, rDEN2/4Δ30, rDEN3Δ30, rDEN4/3Δ30,

(53) rDEN1Δ30, rDEN2/4Δ30, rDEN3/1Δ30, rDEN4Δ30,

(54) rDEN1Δ30, rDEN2/4Δ30, rDEN3/1Δ30, rDEN4/1Δ30,

(55) rDEN1Δ30, rDEN2/4Δ30, rDEN3/1Δ30, rDEN4/2Δ30,

(56) rDEN1Δ30, rDEN2/4Δ30, rDEN3/1Δ30, rDEN4/3Δ30,

(57) rDEN1Δ30, rDEN2/4Δ30, rDEN3/2Δ30, rDEN4Δ30,

(58) rDEN1Δ30, rDEN2/4Δ30, rDEN3/2Δ30, rDEN4/1Δ30,

(59) rDEN1Δ30, rDEN2/4Δ30, rDEN3/2Δ30, rDEN4/2Δ30,

(60) rDEN1Δ30, rDEN2/4Δ30, rDEN3/2Δ30, rDEN4/3Δ30,

(61) rDEN1Δ30, rDEN2/4Δ30, rDEN3/4Δ30, rDEN4Δ30,

(62) rDEN1Δ30, rDEN2/4Δ30, rDEN3/4Δ30, rDEN4/1Δ30,

(63) rDEN1Δ30, rDEN2/4Δ30, rDEN3/4Δ30, rDEN4/2Δ30,

(64) rDEN1Δ30, rDEN2/4Δ30, rDEN3/4Δ30, rDEN4/3Δ30,

(65) rDEN1/2Δ30, rDEN2Δ30, rDEN3Δ30, rDEN4Δ30,

(66) rDEN1/2Δ30, rDEN2Δ30, rDEN3Δ30, rDEN4/1Δ30,

(67) rDEN1/2Δ30, rDEN2Δ30, rDEN3Δ30, rDEN4/2Δ30,

(68) rDEN1/2Δ30, rDEN2Δ30, rDEN3Δ30, rDEN4/3Δ30,

(69) rDEN1/2Δ30, rDEN2Δ30, rDEN3/1Δ30, rDEN4Δ30,

(70) rDEN1/2Δ30, rDEN2Δ30, rDEN3/1Δ30, rDEN4/1Δ30,

(71) rDEN1/2Δ30, rDEN2Δ30, rDEN3/1Δ30, rDEN4/2Δ30,

(72) rDEN1/2Δ30, rDEN2Δ30, rDEN3/1Δ30, rDEN4/3Δ30,

(73) rDEN1/2Δ30, rDEN2Δ30, rDEN3/2Δ30, rDEN4Δ30,

(74) rDEN1/2Δ30, rDEN2Δ30, rDEN3/2Δ30, rDEN4/1Δ30,

(75) rDEN1/2Δ30, rDEN2Δ30, rDEN3/2Δ30, rDEN4/2Δ30,

(76) rDEN1/2Δ30, rDEN2Δ30, rDEN3/2Δ30, rDEN4/3Δ30,

(77) rDEN1/2Δ30, rDEN2Δ30, rDEN3/4Δ30, rDEN4Δ30,

(78) rDEN1/2Δ30, rDEN2Δ30, rDEN3/4Δ30, rDEN4/1Δ30,

(79) rDEN1/2Δ30, rDEN2Δ30, rDEN3/4Δ30, rDEN4/2Δ30,

(80) rDEN1/2Δ30, rDEN2Δ30, rDEN3/4Δ30, rDEN4/3Δ30,

(81) rDEN1/2Δ30, rDEN2/1Δ30, rDEN3Δ30, rDEN4Δ30,

(82) rDEN1/2Δ30, rDEN2/1Δ30, rDEN3Δ30, rDEN4/1Δ30,

(83) rDEN1/2Δ30, rDEN2/1Δ30, rDEN3Δ30, rDEN4/2Δ30,

(84) rDEN1/2Δ30, rDEN2/1Δ30, rDEN3Δ30, rDEN4/3Δ30,

(85) rDEN1/2Δ30, rDEN2/1Δ30, rDEN3/1Δ30, rDEN4Δ30,

(86) rDEN1/2Δ30, rDEN2/1Δ30, rDEN3/1Δ30, rDEN4/1Δ30,

(87) rDEN1/2Δ30, rDEN2/1Δ30, rDEN3/1Δ30, rDEN4/2Δ30,

(88) rDEN1/2Δ30, rDEN2/1Δ30, rDEN3/1Δ30, rDEN4/3Δ30,

(89) rDEN1/2Δ30, rDEN2/1Δ30, rDEN3/2Δ30, rDEN4Δ30,

(90) rDEN1/2Δ30, rDEN2/1Δ30, rDEN3/2Δ30, rDEN4/1Δ30,

(91) rDEN1/2Δ30, rDEN2/1Δ30, rDEN3/2Δ30, rDEN4/2Δ30,

(92) rDEN1/2Δ30, rDEN2/1Δ30, rDEN3/2Δ30, rDEN4/3Δ30,

(93) rDEN1/2Δ30, rDEN2/1Δ30, rDEN3/4Δ30, rDEN4Δ30,

(94) rDEN1/2Δ30, rDEN2/1Δ30, rDEN3/4Δ30, rDEN4/1Δ30,

(95) rDEN1/2Δ30, rDEN2/1Δ30, rDEN3/4Δ30, rDEN4/2Δ30,

(96) rDEN1/2Δ30, rDEN2/1Δ30, rDEN3/4Δ30, rDEN4/3Δ30,

(97) rDEN1/2Δ30, rDEN2/3Δ30, rDEN3Δ30, rDEN4Δ30,

(98) rDEN1/2Δ30, rDEN2/3Δ30, rDEN3Δ30, rDEN4/1Δ30,

(99) rDEN1/2Δ30, rDEN2/3Δ30, rDEN3Δ30, rDEN4/2Δ30,

(100) rDEN1/2Δ30, rDEN2/3Δ30, rDEN3Δ30, rDEN4/3Δ30,

(101) rDEN1/2Δ30, rDEN2/3Δ30, rDEN3/1Δ30, rDEN4Δ30,

(102) rDEN1/2Δ30, rDEN2/3Δ30, rDEN3/1Δ30, rDEN4/1Δ30,

(103) rDEN1/2Δ30, rDEN2/3Δ30, rDEN3/1Δ30, rDEN4/2Δ30,

(104) rDEN1/2Δ30, rDEN2/3Δ30, rDEN3/1Δ30, rDEN4/3Δ30,

(105) rDEN1/2Δ30, rDEN2/3Δ30, rDEN3/2Δ30, rDEN4Δ30,

(106) rDEN1/2Δ30, rDEN2/3Δ30, rDEN3/2Δ30, rDEN4/1Δ30,

(107) rDEN1/2Δ30, rDEN2/3Δ30, rDEN3/2Δ30, rDEN4/2Δ30,

(108) rDEN1/2Δ30, rDEN2/3Δ30, rDEN3/2Δ30, rDEN4/3Δ30,

(109) rDEN1/2Δ30, rDEN2/3Δ30, rDEN3/4Δ30, rDEN4Δ30,

(110) rDEN1/2Δ30, rDEN2/3Δ30, rDEN3/4Δ30, rDEN4/1Δ30,

(111) rDEN1/2Δ30, rDEN2/3Δ30, rDEN3/4Δ30, rDEN4/2Δ30,

(112) rDEN1/2Δ30, rDEN2/3Δ30, rDEN3/4Δ30, rDEN4/3Δ30,

(113) rDEN1/2Δ30, rDEN2/4Δ30, rDEN3Δ30, rDEN4Δ30,

(114) rDEN1/2Δ30, rDEN2/4Δ30, rDEN3Δ30, rDEN4/1Δ30,

(115) rDEN1/2Δ30, rDEN2/4Δ30, rDEN3Δ30, rDEN4/2Δ30,

(116) rDEN1/2Δ30, rDEN2/4Δ30, rDEN3Δ30, rDEN4/3Δ30,

(117) rDEN1/2Δ30, rDEN2/4Δ30, rDEN3/1Δ30, rDEN4Δ30,

(118) rDEN1/2Δ30, rDEN2/4Δ30, rDEN3/1Δ30, rDEN4/1Δ30,

(119) rDEN1/2Δ30, rDEN2/4Δ30, rDEN3/1Δ30, rDEN4/2Δ30,

(120) rDEN1/2Δ30, rDEN2/4Δ30, rDEN3/1Δ30, rDEN4/3Δ30,

(121) rDEN1/2Δ30, rDEN2/4Δ30, rDEN3/2Δ30, rDEN4Δ30,

(122) rDEN1/2Δ30, rDEN2/4Δ30, rDEN3/2Δ30, rDEN4/1Δ30,

(123) rDEN1/2Δ30, rDEN2/4Δ30, rDEN3/2Δ30, rDEN4/2Δ30,

(124) rDEN1/2Δ30, rDEN2/4Δ30, rDEN3/2Δ30, rDEN4/3Δ30,

(125) rDEN1/2Δ30, rDEN2/4Δ30, rDEN3/4Δ30, rDEN4Δ30,

(126) rDEN1/2Δ30, rDEN2/4Δ30, rDEN3/4Δ30, rDEN4/1Δ30,

(127) rDEN1/2Δ30, rDEN2/4Δ30, rDEN3/4Δ30, rDEN4/2Δ30,

(128) rDEN1/2Δ30, rDEN2/4Δ30, rDEN3/4Δ30, rDEN4/3Δ30,

(129) rDEN1/3Δ30, rDEN2Δ30, rDEN3Δ30, rDEN4Δ30,

(130) rDEN1/3Δ30, rDEN2Δ30, rDEN3Δ30, rDEN4/1Δ30,

(131) rDEN1/3Δ30, rDEN2Δ30, rDEN3Δ30, rDEN4/2Δ30,

(132) rDEN1/3Δ30, rDEN2Δ30, rDEN3Δ30, rDEN4/3Δ30,

(133) rDEN1/3Δ30, rDEN2Δ30, rDEN3/1Δ30, rDEN4Δ30,

(134) rDEN1/3Δ30, rDEN2Δ30, rDEN3/1Δ30, rDEN4/1Δ30,

(135) rDEN1/3Δ30, rDEN2Δ30, rDEN3/1Δ30, rDEN4/2Δ30,

(136) rDEN1/3Δ30, rDEN2Δ30, rDEN3/1Δ30, rDEN4/3Δ30,

(137) rDEN1/3Δ30, rDEN2Δ30, rDEN3/2Δ30, rDEN4Δ30,

(138) rDEN1/3Δ30, rDEN2Δ30, rDEN3/2Δ30, rDEN4/1Δ30,

(139) rDEN1/3Δ30, rDEN2Δ30, rDEN3/2Δ30, rDEN4/2Δ30,

(140) rDEN1/3Δ30, rDEN2Δ30, rDEN3/2Δ30, rDEN4/3Δ30,

(141) rDEN1/3Δ30, rDEN2Δ30, rDEN3/4Δ30, rDEN4Δ30,

(142) rDEN1/3Δ30, rDEN2Δ30, rDEN3/4Δ30, rDEN4/1Δ30,

(143) rDEN1/3Δ30, rDEN2Δ30, rDEN3/4Δ30, rDEN4/2Δ30,

(144) rDEN1/3Δ30, rDEN2Δ30, rDEN3/4Δ30, rDEN4/3Δ30,

(145) rDEN1/3Δ30, rDEN2/1Δ30, rDEN3Δ30, rDEN4Δ30,

(146) rDEN1/3Δ30, rDEN2/1Δ30, rDEN3Δ30, rDEN4/1Δ30,

(147) rDEN1/3Δ30, rDEN2/1Δ30, rDEN3Δ30, rDEN4/2Δ30,

(148) rDEN1/3Δ30, rDEN2/1Δ30, rDEN3Δ30, rDEN4/3Δ30,

(149) rDEN1/3Δ30, rDEN2/1Δ30, rDEN3/1Δ30, rDEN4Δ30,

(150) rDEN1/3Δ30, rDEN2/1Δ30, rDEN3/1Δ30, rDEN4/1Δ30,

(151) rDEN1/3Δ30, rDEN2/1Δ30, rDEN3/1Δ30, rDEN4/2Δ30,

(152) rDEN1/3Δ30, rDEN2/1Δ30, rDEN3/1Δ30, rDEN4/3Δ30,

(153) rDEN1/3Δ30, rDEN2/1Δ30, rDEN3/2Δ30, rDEN4Δ30,

(154) rDEN1/3Δ30, rDEN2/1Δ30, rDEN3/2Δ30, rDEN4/1Δ30,

(155) rDEN1/3Δ30, rDEN2/1Δ30, rDEN3/2Δ30, rDEN4/2Δ30,

(156) rDEN1/3Δ30, rDEN2/1Δ30, rDEN3/2Δ30, rDEN4/3Δ30,

(157) rDEN1/3Δ30, rDEN2/1Δ30, rDEN3/4Δ30, rDEN4Δ30,

(158) rDEN1/3Δ30, rDEN2/1Δ30, rDEN3/4Δ30, rDEN4/1Δ30,

(159) rDEN1/3Δ30, rDEN2/1Δ30, rDEN3/4Δ30, rDEN4/2Δ30,

(160) rDEN1/3Δ30, rDEN2/1Δ30, rDEN3/4Δ30, rDEN4/3Δ30,

(161) rDEN1/3Δ30, rDEN2/3Δ30, rDEN3Δ30, rDEN4Δ30,

(162) rDEN1/3Δ30, rDEN2/3Δ30, rDEN3Δ30, rDEN4/1Δ30,

(163) rDEN1/3Δ30, rDEN2/3Δ30, rDEN3Δ30, rDEN4/2Δ30,

(164) rDEN1/3Δ30, rDEN2/3Δ30, rDEN3Δ30, rDEN4/3Δ30,

(165) rDEN1/3Δ30, rDEN2/3Δ30, rDEN3/1Δ30, rDEN4Δ30,

(166) rDEN1/3Δ30, rDEN2/3Δ30, rDEN3/1Δ30, rDEN4/1Δ30,

(167) rDEN1/3Δ30, rDEN2/3Δ30, rDEN3/1Δ30, rDEN4/2Δ30,

(168) rDEN1/3Δ30, rDEN2/3Δ30, rDEN3/1Δ30, rDEN4/3Δ30,

(169) rDEN1/3Δ30, rDEN2/3Δ30, rDEN3/2Δ30, rDEN4Δ30,

(170) rDEN1/3Δ30, rDEN2/3Δ30, rDEN3/2Δ30, rDEN4/1Δ30,

(171) rDEN1/3Δ30, rDEN2/3Δ30, rDEN3/2Δ30, rDEN4/2Δ30,

(172) rDEN1/3Δ30, rDEN2/3Δ30, rDEN3/2Δ30, rDEN4/3Δ30,

(173) rDEN1/3Δ30, rDEN2/3Δ30, rDEN3/4Δ30, rDEN4Δ30,

(174) rDEN1/3Δ30, rDEN2/3Δ30, rDEN3/4Δ30, rDEN4/1Δ30,

(175) rDEN1/3Δ30, rDEN2/3Δ30, rDEN3/4Δ30, rDEN4/2Δ30,

(176) rDEN1/3Δ30, rDEN2/3Δ30, rDEN3/4Δ30, rDEN4/3Δ30,

(177) rDEN1/3Δ30, rDEN2/4Δ30, rDEN3Δ30, rDEN4Δ30,

(178) rDEN1/3Δ30, rDEN2/4Δ30, rDEN3Δ30, rDEN4/1Δ30,

(179) rDEN1/3Δ30, rDEN2/4Δ30, rDEN3Δ30, rDEN4/2Δ30,

(180) rDEN1/3Δ30, rDEN2/4Δ30, rDEN3Δ30, rDEN4/3Δ30,

(181) rDEN1/3Δ30, rDEN2/4Δ30, rDEN3/1Δ30, rDEN4Δ30,

(182) rDEN1/3Δ30, rDEN2/4Δ30, rDEN3/1Δ30, rDEN4/1Δ30,

(183) rDEN1/3Δ30, rDEN2/4Δ30, rDEN3/1Δ30, rDEN4/2Δ30,

(184) rDEN1/3Δ30, rDEN2/4Δ30, rDEN3/1Δ30, rDEN4/3Δ30,

(185) rDEN1/3Δ30, rDEN2/4Δ30, rDEN3/2Δ30, rDEN4Δ30,

(186) rDEN1/3Δ30, rDEN2/4Δ30, rDEN3/2Δ30, rDEN4/1Δ30,

(187) rDEN1/3Δ30, rDEN2/4Δ30, rDEN3/2Δ30, rDEN4/2Δ30,

(188) rDEN1/3Δ30, rDEN2/4Δ30, rDEN3/2Δ30, rDEN4/3Δ30,

(189) rDEN1/3Δ30, rDEN2/4Δ30, rDEN3/4Δ30, rDEN4Δ30,

(190) rDEN1/3Δ30, rDEN2/4Δ30, rDEN3/4Δ30, rDEN4/1Δ30,

(191) rDEN1/3Δ30, rDEN2/4Δ30, rDEN3/4Δ30, rDEN4/2Δ30,

(192) rDEN1/3Δ30, rDEN2/4Δ30, rDEN3/4Δ30, rDEN4/3Δ30,

(193) rDEN1/4Δ30, rDEN2Δ30, rDEN3Δ30, rDEN4Δ30,

(194) rDEN1/4Δ30, rDEN2Δ30, rDEN3Δ30, rDEN4/1Δ30,

(195) rDEN1/4Δ30, rDEN2Δ30, rDEN3Δ30, rDEN4/2Δ30,

(196) rDEN1/4Δ30, rDEN2Δ30, rDEN3Δ30, rDEN4/3Δ30,

(197) rDEN1/4Δ30, rDEN2Δ30, rDEN3/1Δ30, rDEN4Δ30,

(198) rDEN1/4Δ30, rDEN2Δ30, rDEN3/1Δ30, rDEN4/1Δ30,

(199) rDEN1/4Δ30, rDEN2Δ30, rDEN3/1Δ30, rDEN4/2Δ30,

(200) rDEN1/4Δ30, rDEN2Δ30, rDEN3/1Δ30, rDEN4/3Δ30,

(201) rDEN1/4Δ30, rDEN2Δ30, rDEN3/2Δ30, rDEN4Δ30,

(202) rDEN1/4Δ30, rDEN2Δ30, rDEN3/2Δ30, rDEN4/1Δ30,

(203) rDEN1/4Δ30, rDEN2Δ30, rDEN3/2Δ30, rDEN4/2Δ30,

(204) rDEN1/4Δ30, rDEN2Δ30, rDEN3/2Δ30, rDEN4/3Δ30,

(205) rDEN1/4Δ30, rDEN2Δ30, rDEN3/4Δ30, rDEN4Δ30,

(206) rDEN1/4Δ30, rDEN2Δ30, rDEN3/4Δ30, rDEN4/1Δ30,

(207) rDEN1/4Δ30, rDEN2Δ30, rDEN3/4Δ30, rDEN4/2Δ30,

(208) rDEN1/4Δ30, rDEN2Δ30, rDEN3/4Δ30, rDEN4/3Δ30,

(209) rDEN1/4Δ30, rDEN2/1Δ30, rDEN3Δ30, rDEN4Δ30,

(210) rDEN1/4Δ30, rDEN2/1Δ30, rDEN3Δ30, rDEN4/1Δ30,

(211) rDEN1/4Δ30, rDEN2/1Δ30, rDEN3Δ30, rDEN4/2Δ30,

(212) rDEN1/4Δ30, rDEN2/1Δ30, rDEN3Δ30, rDEN4/3Δ30,

(213) rDEN1/4Δ30, rDEN2/1Δ30, rDEN3/1Δ30, rDEN4Δ30,

(214) rDEN1/4Δ30, rDEN2/1Δ30, rDEN3/1Δ30, rDEN4/1Δ30,

(215) rDEN1/4Δ30, rDEN2/1Δ30, rDEN3/1Δ30, rDEN4/2Δ30,

(216) rDEN1/4Δ30, rDEN2/1Δ30, rDEN3/1Δ30, rDEN4/3Δ30,

(217) rDEN1/4Δ30, rDEN2/1Δ30, rDEN3/2Δ30, rDEN4Δ30,

(218) rDEN1/4Δ30, rDEN2/1Δ30, rDEN3/2Δ30, rDEN4/1Δ30,

(219) rDEN1/4Δ30, rDEN2/1Δ30, rDEN3/2Δ30, rDEN4/2Δ30,

(220) rDEN1/4Δ30, rDEN2/1Δ30, rDEN3/2Δ30, rDEN4/3Δ30,

(221) rDEN1/4Δ30, rDEN2/1Δ30, rDEN3/4Δ30, rDEN4Δ30,

(222) rDEN1/4Δ30, rDEN2/1Δ30, rDEN3/4Δ30, rDEN4/1Δ30,

(223) rDEN1/4Δ30, rDEN2/1Δ30, rDEN3/4Δ30, rDEN4/2Δ30,

(224) rDEN1/4Δ30, rDEN2/1Δ30, rDEN3/4Δ30, rDEN4/3Δ30,

(225) rDEN1/4Δ30, rDEN2/3Δ30, rDEN3Δ30, rDEN4Δ30,

(226) rDEN1/4Δ30, rDEN2/3Δ30, rDEN3Δ30, rDEN4/1Δ30,

(227) rDEN1/4Δ30, rDEN2/3Δ30, rDEN3Δ30, rDEN4/2Δ30,

(228) rDEN1/4Δ30, rDEN2/3Δ30, rDEN3Δ30, rDEN4/3Δ30,

(229) rDEN1/4Δ30, rDEN2/3Δ30, rDEN3/1Δ30, rDEN4Δ30,

(230) rDEN1/4Δ30, rDEN2/3Δ30, rDEN3/1Δ30, rDEN4/1Δ30,

(231) rDEN1/4Δ30, rDEN2/3Δ30, rDEN3/1Δ30, rDEN4/2Δ30,

(232) rDEN1/4Δ30, rDEN2/3Δ30, rDEN3/1Δ30, rDEN4/3Δ30,

(233) rDEN1/4Δ30, rDEN2/3Δ30, rDEN3/2Δ30, rDEN4Δ30,

(234) rDEN1/4Δ30, rDEN2/3Δ30, rDEN3/2Δ30, rDEN4/1Δ30,

(235) rDEN1/4Δ30, rDEN2/3Δ30, rDEN3/2Δ30, rDEN4/2Δ30,

(236) rDEN1/4Δ30, rDEN2/3Δ30, rDEN3/2Δ30, rDEN4/3Δ30,

(237) rDEN1/4Δ30, rDEN2/3Δ30, rDEN3/4Δ30, rDEN4Δ30,

(238) rDEN1/4Δ30, rDEN2/3Δ30, rDEN3/4Δ30, rDEN4/1Δ30,

(239) rDEN1/4Δ30, rDEN2/3Δ30, rDEN3/4Δ30, rDEN4/2Δ30,

(240) rDEN1/4Δ30, rDEN2/3Δ30, rDEN3/4Δ30, rDEN4/3Δ30,

(241) rDEN1/4Δ30, rDEN2/4Δ30, rDEN3Δ30, rDEN4Δ30,

(242) rDEN1/4Δ30, rDEN2/4Δ30, rDEN3Δ30, rDEN4/1Δ30,

(243) rDEN1/4Δ30, rDEN2/4Δ30, rDEN3Δ30, rDEN4/2Δ30,

(244) rDEN1/4Δ30, rDEN2/4Δ30, rDEN3Δ30, rDEN4/3Δ30,

(245) rDEN1/4Δ30, rDEN2/4Δ30, rDEN3/1Δ30, rDEN4Δ30,

(246) rDEN1/4Δ30, rDEN2/4Δ30, rDEN3/1Δ30, rDEN4/1Δ30,

(247) rDEN1/4Δ30, rDEN2/4Δ30, rDEN3/1Δ30, rDEN4/2Δ30,

(248) rDEN1/4Δ30, rDEN2/4Δ30, rDEN3/1Δ30, rDEN4/3Δ30,

(249) rDEN1/4Δ30, rDEN2/4Δ30, rDEN3/2Δ30, rDEN4Δ30,

(250) rDEN1/4Δ30, rDEN2/4Δ30, rDEN3/2Δ30, rDEN4/1Δ30,

(251) rDEN1/4Δ30, rDEN2/4Δ30, rDEN3/2Δ30, rDEN4/2Δ30,

(252) rDEN1/4Δ30, rDEN2/4Δ30, rDEN3/2Δ30, rDEN4/3Δ30,

(254) rDEN1/4Δ30, rDEN2/4Δ30, rDEN3/4Δ30, rDEN4/1Δ30,

(255) rDEN1/4Δ30, rDEN2/4Δ30, rDEN3/4Δ30, rDEN4/2Δ30, and

(256) rDEN1/4Δ30, rDEN2/4Δ30, rDEN3/4Δ30, rDEN4/3Δ30.