Disclosed herein are antisense compounds and methods for decreasing cd40. Examples of disease conditions that can be ameliorated with the administration of antisense compounds targeted to cd40 include hyperproliferative disorders, graft versus host disease (GVHD), graft rejection, asthma, airway hyperresponsiveness, chronic obstructive pulmonary disease (COPD), multiple sclerosis (MS), systemic lupus erythematosus (SLE), and certain forms of arthritis.

Patent
   RE47320
Priority
Nov 20 2007
Filed
Dec 21 2016
Issued
Mar 26 2019
Expiry
Nov 20 2028
Assg.orig
Entity
Large
0
265
currently ok
4. A modified antisense compound 20 nucleobases in length and consisting of the nucleobase sequence of SEQ ID NO: 208.
18. An antisense oligonucleotide 20 nucleobases in length having the sequence of nucleobases as set forth in SEQ ID NO:208, wherein each cytosine is a 5-methylcytosine, each internucleoside linkage is a phosphorothioate linkage, nucleotides 1-5 and 16-20 are 2′-O-methoxyethyl nucleotides, and nucleotides 6-15 are 2′-deoxynucleotides.
1. A modified antisense compound 12 to 30 nucleobases in length and having a nucleobase sequence that is at least 90% complementary to an equal length portion of the human cd40 gene but not to other sequences throughout the human genome, selected from the following regions of SEQ ID NO: 4:
(a) positions 11250-12685, corresponding to intron 6 11801-12591;
(b) positions 2943-6367, corresponding to intron 1;
(c) positions 6447-6780, corresponding to intron 2;
(d) positions 6907-7157, corresponding to intron 3;
(e) positions 7305-7673, corresponding to intron 4; #20#
(f) positions 7768-11187, corresponding to intron 5;
(g) positions 12773-12877, corresponding to intron 7;
(h) positions 12907-13429, corresponding to intron 8; and
(i) positions 13662-16001, which forms part of exon 9 or a region 3′ to exon 9.
0. 2. The antisense compound of claim 1, wherein the nucleobase sequence is at least 90% complementary to an equal length portion of positions 12527-12685 of SEQ ID NO: 4.
3. The antisense compound of claim 2 1, having a nucleobase sequence comprising at least 8 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 208, wherein the nucleobase sequence of the compound is at least 95% complementary to the sequence shown in SEQ ID NO: 4.
5. The antisense compound of claim 1, wherein said antisense compound is an antisense oligonucleotide.
6. The antisense compound of claim 5, wherein at least one internucleoside linkage is a modified internucleoside linkage.
7. The antisense compound of claim 6, wherein each internucleoside linkage is a phosphorothioate internucleoside linkage.
8. The antisense compound of claim 5, wherein at least one nucleoside comprises a modified sugar.
9. The antisense compound of claim 8, wherein at least one modified sugar is a bicyclic sugar.
10. The antisense compound of claim 9, wherein the at least one bicyclic sugar comprises a 4′-CH(CH3)—O-2′ bridge.
11. The antisense compound of claim 8, wherein at least one modified sugar comprises a 2′-O-methoxyethyl.
12. The antisense compound of claim 1, wherein at least one said nucleobase is a modified nucleobase.
13. The antisense compound of claim 12, wherein the modified nucleobase is a 5-methylcytosine.
14. The antisense compound of claim 1, wherein the compound is an oligonucleotide comprising:
a gap segment consisting of linked deoxynucleosides;
a 5′ wing segment consisting of linked nucleosides;
a 3′ wing segment consisting of linked nucleosides;
wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.
15. The antisense compound of claim 14, wherein the oligonucleotide comprises:
a gap segment consisting of ten linked deoxynucleosides;
a 5′ wing segment consisting of five linked nucleosides;
a 3′ wing segment consisting of five linked nucleosides;
wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment, wherein each nucleoside of each wing segment comprises a 2′-O-methoxyethyl sugar;
and wherein each internucleoside linkage of said antisense compound is a phosphorothioate linkage.
16. The antisense compound of claim 14, wherein the oligonucleotide comprises:
a gap segment consisting of fifteen linked deoxynucleosides;
a 5′ wing segment consisting of two linked nucleosides;
a 3′ wing segment consisting of three linked nucleosides;
wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment, wherein each nucleoside of each wing segment comprises a 2′-O-methoxyethyl sugar;
and wherein each internucleoside linkage of said antisense compound is a phosphorothioate linkage.
17. The antisense compound of claim 15 or 16, wherein every cytosine is a 5-methylcytosine.
19. A composition comprising an antisense compound of claim 1 or 18 or a salt thereof and a pharmaceutically acceptable carrier or diluent.
20. A method comprising administering to an animal an antisense compound of claim 1 or an oligonucleotide of claim 18.
0. 21. The antisense compound of claim 1, wherein said antisense compound is 15, 16, 17, 18, 19, 20 or 21 nucleobases in length.
0. 22. The antisense compound of claim 21, wherein the nucleobase sequence of the compound is at least 95% complementary to the sequence shown in SEQ ID NO: 4.
0. 23. The antisense compound of claim 21, wherein the nucleobase sequence of the compound is 100% complementary to the sequence shown in SEQ ID NO: 4.

This application is a 35 U.S.C §371 national phase application of international application serial no. PCT/US2008/012998, filed on Nov. 20, 2008, which is a non-provisional of and claims priority to U.S. patent application Ser. No. 60/989421, filed on Nov. 20, 2007, the disclosure of each of which is incorporated herein by reference in its entirety.

The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled 33841-513SEQLIST.txt, created Nov. 19, 2008, which is 67 Kb in size. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety. This sequence listing is identical to the sequence listing filed on Nov. 20, 2007, with the exception of the addition of SEQ ID NO: 237.

The present invention provides methods and compositions for lowing levels of CD40 in an animal. Such methods and compositions are useful as anti-inflammatory compounds and anti-tumor compounds.

The immune system serves a vital role in protecting the body against infectious agents. It is well established, however, that a number of disease states and/or disorders are a result of either abnormal or undesirable activation of immune responses. Common examples include graft versus host disease (GVHD) and graft rejection, and autoimmune linked diseases such as multiple sclerosis (MS), systemic lupus erythematosus (SLE), and certain forms of arthritis.

In general, an immune response is activated as a result of either tissue injury or infection. Both cases involve the recruitment and activation of a number of immune system effector cells (e.g., B- and T-lymphocytes, macrophages, eosinophils, neutrophils) in a process coordinated through a series of complex cell-cell interactions. A typical scenario by which an immune response is mounted against a foreign protein is as follows: foreign proteins captured by antigen presenting cells (APC's) such as macrophages or dendritic cells are processed and displayed on the cell surface of the APC. Circulating T-helper cells which express an immunoglobulin that recognizes (i.e. binds) the displayed antigen undergo activation by the APC. These activated T-helpers in turn activate appropriate B-cell clones to proliferate and differentiate into plasma cells that produce and secrete humoral antibodies targeted against the foreign antigen. The secreted humoral antibodies are free to circulate and bind to any cells expressing the foreign protein on their cell surface, in effect marking the cell for destruction by other immune effector cells. In each of the stages described above, direct cell-cell contact between the involved cell types is required in order for activation to occur. (Gruss et al., Leuk. Lymphoma 1989, 24:393). In recent years, a number of cell surface receptors that mediate these cell-cell contact dependent activation events have been identified. Among these cell surface receptors is CD40 and its physiological ligand, CD40 Ligand (CD40L) which is also known as CD154.

CD40 was first characterized as a receptor expressed on B-lymphocytes. It was later found that engagement of B-cell CD40 with CD40L expressed on activated T-cells is essential for T-cell dependent B-cell activation (i.e. proliferation, immunoglobulin secretion, and class switching). It was subsequently revealed that functional CD40 is expressed on a variety of cell types other than B-cells, including macrophages, dendritic cells, thymic epithelial cells, Langerhans cells, and endothelial cells. These studies have led to the current belief that CD40 plays a broad role in immune regulation by mediating interactions of T-cells with B-cells as well as other cell types. In support of this notion, it has been shown that stimulation of CD40 in macrophages and dendritic results is required for T-cell activation during antigen presentation. (Gruss et al., Leuk. Lymphoma, 1997, 24:393). Recent evidence points to a role for CD40 in tissue inflammation as well. Production of the inflammatory mediators IL-12 and nitric oxide by macrophages have been shown to be CD40 dependent. (Buhlmann and Noelle, J. Clin. Immunol., 1996, 16:83). In endothelial cells, stimulation of CD40 by CD40L has been found to induce surface expression of E-selectin, ICAM-1, and VCAM-1, promoting adhesion of leukocytes to sites of inflammation (Buhlmann and Noelle, J. Clin. Immunol., 1996, 16:83); Gruss et al., Leuk. Lymphoma, 1997, 24:393). Finally, a number of reports have documented overexpression of CD40 in epithelial and hematopoietic tumors as well as tumor infiltrating endothelial cells, indicating that CD40 may play a role in tumor growth and/or angiogenesis as well (Gruss et al., Leuk. Lymphoma, 1997, 24:393; Kluth et al., Cancer Res., 1997, 57:891).

Due to the pivotal role that CD40 plays in humoral immunity, the potential exists that therapeutic strategies aimed at downregulating CD40 or interfering with CD40 signaling may provide a novel class of agents useful in treating a number of immune associated disorders, including but not limited to graft-versus-host disease (GVHD), graft rejection, and autoimmune diseases such as multiple sclerosis (MS), systemic lupus erythematosus (SLE), and certain forms of arthritis. Inhibitors of CD40 may also prove useful as anti-inflammatory compounds, and could therefore be useful as treatment for a variety of inflammatory and allergic conditions such as asthma, rheumatoid arthritis, allograft rejections, inflammatory bowel disease, autoimmune encephalomyelitis, thyroiditis, various dermatological conditions, and psoriasis. Recently, both CD40 and CD154 have been shown to be expressed on vascular endothelial cells, vascular smooth muscle cells and macrophages present in atherosclerotic plaques, suggesting that inflammation and immunity contribute to the atherogenic process. That this process involves CD40 signaling is suggested by several studies in mouse models in which disruption of CD154 (by knockout or by monoclonal antibody) reduced the progression or size of atherosclerotic lesions. (Mach et al., Nature, 1998, 394:200-3; Lutgens et al., 1999, Nat. Med. 5:1313-6).

Finally, as more is learned of the association between CD40 overexpression and tumor growth, inhibitors of CD40 may prove useful as anti-tumor agents and inhibitors of other hyperproliferative conditions as well.

Currently, there are no known therapeutic agents which effectively inhibit the synthesis of CD40. To date, strategies aimed at inhibiting CD40 function have involved the use of a variety of agents that disrupt CD40/CD40L binding. These include monoclonal antibodies directed against either CD40 or CD40L, soluble forms of CD40, and synthetic peptides derived from a second CD40 binding protein, A20. The use of neutralizing antibodies against CD40 and/or CD40L in animal models has provided evidence that inhibition of CD40 signaling would have therapeutic benefit for GVHD, allograft rejection, rheumatoid arthritis, SLE, MS, and B-cell lymphoma. (Buhlmann and Noelle, J. Clin. Immunol, 1996, 16:83). Clinical investigations were initiated using anti-CD154 monoclonal antibody in patients with lupus nephritis. However, studies were terminated due to the development of thrombotic events. (Boumpas et al., 2003, Arthritis Rheum. 2003, 48:719-27).

Due to the problems associated with the use of large proteins as therapeutic agents, there is a long-felt need for additional agents capable of effectively inhibiting CD40 function. Antisense oligonucleotides avoid many of the pitfalls of current agents used to block CD40/CD40L interactions and may therefore prove to be uniquely useful in a number of therapeutic, diagnostic and research applications. U.S. Pat. No. 6,197,584 (Bennett and Cowsert) discloses antisense compounds targeted to CD40.

Provided herein are antisense compounds, compositions, and methods for the treatment and prevention of inflammatory conditions and cancer.

Antisense compounds described herein may be 12 to 30 nucleobases in length targeted to a CD40 nucleic acid. In certain embodiments, the CD40 nucleic acid may be any of the sequences as set forth in GENBANK® Accession No. X60592.1, incorporated herein as SEQ ID NO: 1; GENBANK® Accession No. H50598.1, incorporated herein as SEQ ID NO: 2; GENBANK® Accession No. AA203290.1, incorporated herein as SEQ ID NO: 3; and nucleotides 9797000 to nucleotide 9813000 of GENBANK Accession No. NT_011362.9, incorporated herein as SEQ ID NO: 4, or GENBANK® Accession No. BC064518.1, incorporated herein as SEQ ID NO: 237.

The antisense compound may be 12 to 30 nucleobases in length and may have a nucleobase sequence comprising at least 8 contiguous nucleobases complementary to an equal length portion of an intron region of the CD40 gene, selected from the following regions of SEQ ID NO: 4:

(a) positions 11250-12685, corresponding to intron 6;

(b) positions 2943-6367, corresponding to intron 1,

(c) positions 6447-6780, corresponding to intron 2,

(d) positions 6907-7157, corresponding to intron 3,

(e) positions 7305-7673, corresponding to intron 4,

(f) positions 7768-11187, corresponding to intron 5,

(g) positions 12773-12877, corresponding to intron 7, or

(h) positions 12907-13429, corresponding to intron 8,

wherein the remaining part or parts of the antisense compound are at least 70% complementary to the sequence shown in SEQ ID NO: 4. Preferably, the remaining parts of the antisense compound are at least 75%, 80%, 85%, 90%, 95%, 98%, 99%, or, most preferably, 100% complementary to the sequence shown in SEQ ID NO: 4.

Preferably, the antisense compound may comprise at least 8 contiguous nucleobases complementary to an equal length portion of positions 12527 to 12685 of SEQ ID NO: 4, which is a region that can be either part of intron 6, or can be part of an alternative version of exon 7 when a different splice acceptor site is selected. Preferably, the antisense compound has a nucleobase sequence comprising at least 8 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 208, wherein the nucleobase sequence of the compound is at least 70% complementary to the sequence shown in SEQ ID NO: 4. Preferably, the antisense compound is at least 75%, 80%, 85%, 90%, 95%, 98%, 99%, or, most preferably, 100% complementary to the sequence shown in SEQ ID NO: 4. More preferably, the antisense compound has the sequence of SEQ ID NO: 208. Even more preferably, the antisense compound is 20 nucleobases in length and consists of the nucleobase sequence of SEQ ID NO: 208. Most preferably, the antisense compound is an antisense oligonucleotide 20 nucleotides in length having the sequence of nucleotides as set forth in SEQ ID NO:208, wherein each cytosine is a 5-methylcytosine, each internucleoside linkage is a phosphorothioate linkage, nucleotides 1-5 and 16-20 are 2′-O-methoxyethyl nucleotides, and nucleotides 6-15 are 2′-deoxynucleotides; most preferably the antisense compound is ISIS 396236.

In an alternative embodiment, the antisense compound may be 12 to 30 nucleobases in length and have a nucleobase sequence comprising at least 8 contiguous nucleobases complementary to an equal length portion of a region of the CD40 gene, corresponding to positions 13662-16001 of SEQ ID NO: 4, which forms part of exon 9 or a region 3′ to exon 9, wherein the remaining parts of the antisense compound are at least 70% complementary to the sequence shown in SEQ ID NO: 4. Preferably, the target region of the CD40 gene corresponds to positions 13877-14084, even more preferably to positions 13937-13996, of SEQ ID NO: 4. Preferably, the remaining parts of the antisense compound are at least 75%, 80%, 85%, 90%, 95%, 98%, 99%, or, most preferably, 100% complementary to the sequence shown in SEQ ID NO: 4.

In yet another alternative embodiment, the antisense compound is 12 to 30 nucleobases in length and has a nucleobase sequence complementary to the sequence shown in SEQ ID NO: 1, starting at position 69 or 70 of SEQ ID NO: 1, wherein the nucleobase sequence is at least 95% complementary to the sequence shown in SEQ ID NO: 1. Preferably, the nucleobase sequence is essentially complementary to the sequence shown in SEQ ID NO: 1. More preferably, the nucleobase sequence is selected from the sequences of SEQ ID Nos: 90 and 163. Even more preferably, the antisense compound has a nucleobase sequence of SEQ ID NO: 90. Even more preferably, the antisense compound is 18 or 20 nucleobases in length and consists of the nucleobase sequence of SEQ ID NO: 90 or SEQ ID NO: 163. The antisense compound may be ISIS26163, ISIS396201 or ISIS396278. Preferably, the antisense compound is an antisense oligonucleotide 18 nucleotides in length having the sequence of nucleotides as set forth in SEQ ID NO: 90, wherein each cytosine is a 5-methylcytosine, each internucleoside linkage is a phosphorothioate linkage, nucleotides 1-4 and 15-18 are 2′-O-methoxyethyl nucleotides, and nucleotides 5 to 14 are 2′-deoxynucleotides. Most preferably, the antisense compound is ISIS26163.

An antisense compound according to the invention may comprise a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12 contiguous nucleobases of a nucleobase sequence selected from among the nucleobase sequences recited in SEQ ID NOs: 5 to 236. Preferably, the compound consists of a single-stranded modified oligonucleotide. Preferably, the nucleobase sequence of the modified oligonucleotide is 100% complementary to a nucleobase sequence of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, or SEQ ID NO: 237.

The antisense compound may comprise linked nucleosides. Preferably, the antisense compound is an antisense oligonucleotide.

The antisense compound may be a single-stranded or double-stranded oligonucleotide. Preferably, the antisense compound is a single-stranded oligonucleotide.

The antisense oligonucleotide may be modified, wherein at least one internucleoside linkage is a modified internucleoside linkage. The internucleoside linkage may be a phosphorothioate internucleoside linkage.

The antisense oligonucleotide may be modified, wherein at least one nucleoside comprises a modified sugar. The modified sugar may be a bicyclic sugar. Preferably, the at least one bicyclic sugar comprises a 4′-CH(CH3)—O-2′ bridge. The modified sugar may comprise a 2′-O-methoxyethyl. The antisense compound may comprise at least one tetrahydropyran modified nucleoside, wherein a tetrahydropyran ring replaces the furanose ring. Preferably, each of the at least one tetrahydropyran modified nucleoside has the structure

##STR00001##
wherein Bx is an optionally protected heterocyclic base moiety.

The antisense compound may comprise a modified nucleobase. The modified nucleobase may be a 5-methylcytosine. Preferably, every cytosine is a 5-methylcytosine.

The antisense compound may be a gapmer, for example an oligonucleotide comprising:

a gap segment consisting of linked deoxynucleosides;

a 5′ wing segment consisting of linked nucleosides;

a 3′ wing segment consisting of linked nucleosides;

wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar. Preferably, each nucleoside of each wing segment comprises a 2′-O-methoxyethyl sugar; and preferably each internucleoside linkage is a phosphorothioate linkage.

The antisense oligonucleotide may be a 5-10-5 MOE gapmer or a 2-15-3 MOE gapmer. The antisense oligonucleotide may consist of 20 linked nucleosides.

The antisense oligonucleotide may be a 4-10-4 MOE gapmer. The antisense oligonucleotide may consist of 18 linked nucleosides.

Compositions described herein may comprise an oligonucleotide consisting of 12 to 30 linked nucleosides, targeted to a CD40 nucleic acid or a salt thereof and a pharmaceutically acceptable carrier or diluent.

The composition may comprise a single-stranded or double-stranded oligonucleotide.

Another embodiment of the invention is a pharmaceutical composition comprising an antisense compound as described above and a liposome or a lipid based delivery system. Preferably, said liposome is an amphoteric liposome. Preferably, said amphoteric liposome is formed from a lipid phase comprising an amphoteric lipid or a mixture of lipid components with amphoteric properties. Said amphoteric liposome may further comprise one or more neutral or zwitterionic lipids. More preferably, said amphoteric liposome is formed from a lipid phase comprising

A further embodiment of the invention is an antisense compound or composition as described above for medical use. Yet a further embodiment of the invention is an antisense compound or a composition as described above for the treatment of cancer or an inflammatory or immune associated condition. The treatment may further comprise administering a second drug, which may be administered separately or concomitantly with the antisense compound of the invention.

Methods described herein may comprise administering to an animal an antisense compound as described above, preferably an antisense compound comprising an oligonucleotide consisting of 12 to 30 linked nucleosides targeted to a CD40 nucleic acid, or a composition comprising said antisense compound. Preferably, the animal is a human.

Administration of the antisense compound and/or the second drug may be by parenteral administration, topical administration, oral administration or aerosol administration. Parenteral administration may be any of subcutaneous or intravenous administration.

It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the invention, as claimed. Herein, the use of the singular includes the plural unless specifically stated otherwise. As used herein, the use of “or” means “and/or” unless stated otherwise. Furthermore, the use of the term “including” as well as other forms, such as “includes” and “included”, is not limiting. Also, terms such as “element” or “component” encompass both elements and components comprising one unit and elements and components that comprise more than one subunit, unless specifically stated otherwise.

The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application, including, but not limited to, patents, patent applications, articles, books, and treatises, are hereby expressly incorporated by reference in their entirety for any purpose.

Definitions

Unless specific definitions are provided, the nomenclature utilized in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well known and commonly used in the art. Standard techniques may be used for chemical synthesis, and chemical analysis. Where permitted, all patents, applications, published applications and other publications, GENBANK Accession Numbers and associated sequence information obtainable through databases such as National Center for Biotechnology Information (NCBI) and other data referred to throughout in the disclosure herein are incorporated by reference in their entirety.

Unless otherwise indicated, the following terms have the following meanings:

“2′-O-methoxyethyl” (also 2′-MOE and 2′-O(CH2)2—OCH3) refers to an O-methoxy-ethyl modification of the 2′ position of a furosyl ring. A 2′-O-methoxyethyl modified sugar is a modified sugar.

“2′-O-methoxyethyl nucleotide” means a nucleotide comprising a 2′-O-methoxyethyl modified sugar moiety.

“5-methylcytosine” means a cytosine modified with a methyl group attached to the 5′ position. A 5-methylcytosine is a modified nucleobase.

“Acceptable safety profile” means a pattern of side effects that is within clinically acceptable limits.

“Active pharmaceutical ingredient” means the substance or substances in a pharmaceutical composition that provides a desired effect.

“Active target region” means a target region to which one or more active antisense compounds is targeted. “Active antisense compounds” means antisense compounds that reduce target nucleic acid levels.

“Administered concomitantly” refers to the co-administration of two agents in any manner in which the pharmacological effects of both are manifest in the patient at the same time. Concomitant administration does not require that both agents be administered in a single pharmaceutical composition, in the same dosage form, or by the same route of administration.

“Administering” means providing a pharmaceutical agent to an individual, and includes, but is not limited to administering by a medical professional and self-administering.

“Antisense compound” means an oligomeric compound that is capable of undergoing hybridization to a target nucleic acid through hydrogen bonding.

“Antisense inhibition” means reduction of target nucleic acid levels in the presence of an antisense compound complementary to a target nucleic acid compared to target nucleic acid levels in the absence of the antisense compound.

“Antisense oligonucleotide” means a single-stranded oligonucleotide having a nucleobase sequence that permits hybridization to a corresponding region or segment of a target nucleic acid.

“Bicyclic sugar” means a furosyl ring modified by the bridging of two non-geminal ring atoms. A bicyclic sugar is a modified sugar.

“Bicyclic nucleic acid” or “BNA” or “bicyclic nucleoside” or “bicyclic nucleotide” refers to a nucleoside or nucleotide wherein the furanose portion of the nucleoside includes a bridge connecting two carbon atoms on the furanose ring, thereby forming a bicyclic ring system. As used herein, unless otherwise indicated, the term “methyleneoxy BNA” alone refers to β-D-methyleneoxy BNA.

“Cap structure” or “terminal cap moiety” means chemical modifications, which have been incorporated at either terminus of an antisense compound.

“Chimeric antisense compounds” means antisense compounds that have at least 2 chemically distinct regions, each position having a plurality of subunits. A “gapmer” means an antisense compound in which an internal position having a plurality of nucleotides that supports RNaseH cleavage is positioned between external regions having one or more nucleotides that are chemically distinct from the nucleosides of the internal region. A “gap segment” means the plurality of nucleotides that make up the internal region of a gapmer. A “wing segment” means the external region of a gapmer.

“Co-administration” means administration of two or more pharmaceutical agents to an individual. The two or more pharmaceutical agents may be in a single pharmaceutical composition, or may be in separate pharmaceutical compositions. Each of the two or more pharmaceutical agents may be administered through the same or different routes of administration. Co-administration encompasses administration in parallel or sequentially.

“Complementarity” means the capacity for pairing between nucleobases of a first nucleic acid and a second nucleic acid.

“Comply” means the adherence with a recommended therapy by a individual.

“Contiguous nucleobases” means nucleobases immediately adjacent to each other.

“Diluent” means an ingredient in a composition that lacks pharmacological activity, but is pharmaceutically necessary or desirable. For example, in drugs that are injected the diluent may be a liquid, e.g. saline solution.

“Dose” means a specified quantity of a pharmaceutical agent provided in a single administration, or in a specified time period. In certain embodiments, a dose may be administered in two or more boluses, tablets, or injections. For example, in certain embodiments, where subcutaneous administration is desired, the desired dose requires a volume not easily accommodated by a single injection. In such embodiments, two or more injections may be used to achieve the desired dose. In certain embodiments, a dose may be administered in two or more injections to minimize injection site reaction in a individual. In other embodiments, the pharmaceutical agent is administered by infusion over an extended period of time or continuously. Doses may be stated as the amount of pharmaceutical agent per hour, day, week or month.

“Dosage unit” means a form in which a pharmaceutical agent is provided, e.g. pill, tablet, or other dosage unit known in the art. In certain embodiments, a dosage unit is a vial containing lyophilized antisense oligonucleotide. In certain embodiments, a dosage unit is a vial containing reconstituted antisense oligonucleotide.

“Duration” means the period of time during which an activity or event continues. In certain embodiments, the duration of treatment is the period of time during which doses of a pharmaceutical agent are administered.

“Efficacy” means the ability to produce a desired effect.

“CD40 nucleic acid” means any nucleic acid encoding CD40. For example, in certain embodiments, a CD40 nucleic acid includes, without limitation, a DNA sequence encoding CD40, an RNA sequence transcribed from DNA encoding CD40, and an mRNA sequence encoding CD40. “CD40 mRNA” means an mRNA encoding a CD40 protein.

“Fully complementary” means each nucleobase of a first nucleic acid has a complementary nucleobase in a second nucleic acid. In certain embodiments, a first nucleic acid is an antisense compound and a target nucleic acid is a second nucleic acid. In certain such embodiments, an antisense oligonucleotide is a first nucleic acid and a target nucleic acid is a second nucleic acid.

“Gap-widened” means an antisense compound has a gap segment of 12 or more contiguous 2′-deoxyribonucleotides positioned between and immediately adjacent to 5′ and 3′ wing segments having from one to six nucleotides having modified sugar moieties. “Immediately adjacent” means there are no intervening nucleotides between the immediately adjacent elements.

“Hybridization” means the annealing of complementary nucleic acid molecules. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, an antisense compound and a nucleic acid target. In certain such embodiments, complementary nucleic acid molecules include, but are not limited to, an antisense oligonucleotide and a nucleic acid target

“Individual” means a human or non-human animal selected for treatment or therapy.

“Individual compliance” means adherence to a recommended or prescribed therapy by a individual.

“Injection site reaction” means inflammation or abnormal redness of skin at a site of injection in a individual.

“Internucleoside linkage” refers to the chemical bond between nucleosides.

“Linked nucleosides” means adjacent nucleosides which are bonded together.

“Modified internucleoside linkage” refers to a substitution and/or any change from a naturally occurring internucleoside bond (i.e. a phosphodiester internucleoside bond).

“Modified oligonucleotide” means an oligonucleotide comprising a modified internucleoside linkage, a modified sugar, and/or a modified nucleobase.

“Modified sugar” refers to a substitution and/or any change from a natural sugar.

“Modified nucleobase” means any nucleobase other than adenine, cytosine, guanine, thymidine, or uracil. An “unmodified nucleobase” means the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U).

“Modified nucleotide” means a nucleotide having, independently, a modified sugar moiety, modified internucleoside linkage, or modified nucleobase. A “modified nucleoside” means a nucleotide having, independently, a modified sugar moiety or modified nucleobase.

“Modified sugar moiety” means a sugar moiety having any substitution and/or change from a natural sugar moiety.

“Motif” means the pattern of unmodified and modified nucleosides in an antisense compound.

“Naturally occurring internucleoside linkage” means a 3′ to 5′ phosphodiester linkage.

“Natural sugar moiety” means a sugar moiety found in DNA (2′-H) or RNA (2′-OH).

“Non-complementary nucleobase” or “mismatch” means a nucleobase of a first nucleic acid that is not capable of pairing with the corresponding nucleobase of a second or target nucleic acid.

“Nucleoside” means a nucleobase linked to a sugar.

As used herein the term “nucleoside mimetic” is intended to include those structures used to replace the sugar or the sugar and the base and not necessarily the linkage at one or more positions of an oligomeric compound such as for example nucleoside mimetics having morpholino, cyclohexenyl, cyclohexyl, tetrahydropyranyl, bicyclo or tricyclo sugar mimetics e.g. non furanose sugar units.

“Nucleobase” means a heterocyclic moiety capable of pairing with a base of another nucleic acid.

“Nucleobase sequence” means the order of contiguous nucleobases independent of any sugar, linkage, and/or nucleobase modification.

“Nucleotide” means a nucleoside having a phosphate group covalently linked to the sugar portion of the nucleoside.

The term “nucleotide mimetic” is intended to include those structures used to replace the nucleoside and the linkage at one or more positions of an oligomeric compound such as for example peptide nucleic acids or morpholinos (morpholinos linked by —N(H)—C(═O)—O— or other non-phosphodiester linkage).

“Oligomeric compound” means a polymer or oligomer of linked monomeric subunits which is capable of hybridizing to at least a region of a nucleic acid molecule.

“Oligonucleotide” means an oligonucleotide in which the internucleoside linkages do not contain a phosphorus atom.

“Oligonucleotide” means a polymer or oligomer of linked nucleosides each of which can be modified or unmodified, independent one from another.

“Parenteral administration,” means administration through injection or infusion. Parenteral administration includes, but is not limited to, subcutaneous administration, intravenous administration, or intramuscular administration.

“Pharmaceutical agent” means a substance that provides a therapeutic benefit when administered to a individual. For example, in certain embodiments, an antisense oligonucleotide targeted to CD40 is pharmaceutical agent.

“Pharmaceutically acceptable salts” means physiologically and pharmaceutically acceptable salts of antisense compounds, i.e., salts that retain the desired biological activity of the parent oligonucleotide and do not impart undesired toxicological effects thereto.

“Pharmaceutical composition” means a mixture of substances suitable for administering to an individual. For example, a pharmaceutical composition may comprise one or more antisense oligonucleotides or a combination of antisense oligonucleotides and non-antisense active agents and a sterile aqueous solution or other pharmaceutically acceptable additive.

“Phosphorothioate linkage” means a linkage between nucleosides where the phosphodiester bond is modified by replacing one of the non-bridging oxygen atoms with a sulfur atom. A phosphorothioate linkage is a modified internucleoside linkage.

“Portion” means a defined number of contiguous (i.e. linked) nucleobases of a nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of a target nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of an antisense compound.

“Prodrug” means a therapeutic agent that is prepared in an inactive form that is converted to an active form (i.e., drug) within the body or cells thereof by the action of endogenous enzymes or other chemicals and/or conditions.

“Recommended therapy” means a therapeutic regimen recommended by a medical professional for the treatment, amelioration, or prevention of a disease.

“Side effects” means physiological responses attributable to a treatment other than desired effects. In certain embodiments, side effects include, without limitation, injection site reactions, liver function test abnormalities, renal function abnormalities, liver toxicity, renal toxicity, central nervous system abnormalities, and myopathies. For example, increased aminotransferase levels in serum may indicate liver toxicity or liver function abnormality. For example, increased bilirubin may indicate liver toxicity or liver function abnormality.

“Single-stranded modified oligonucleotide” means a modified oligonucleotide which is not hybridized to a complementary strand.

“Specifically hybridizable” means an antisense compound that hybridizes to a target nucleic acid to induce a desired effect, while exhibiting minimal or no effects on non-target nucleic acids.

The term “sugar surrogate” overlaps with the slightly broader term “nucleoside mimetic” but is intended to indicate replacement of the sugar unit (furanose ring) only. The tetrahydropyranyl rings provided herein are illustrative of an example of a sugar surrogate wherein the furanose sugar group has been replaced with a tetrahydropyranyl ring system.

“Stringent hybridization conditions” means conditions under which a nucleic acid molecule, such as an antisense compound, will hybridize to a target nucleic acid sequence, but to a minimal number of other sequences. Stringent conditions are sequence-dependent and will vary in different circumstances. In the context of this invention, “stringent conditions” under which oligomeric compounds hybridize to a target sequence are determined by the nature and composition of the oligomeric compounds and the assays in which they are being investigated.

“Subcutaneous administration” means administration just below the skin. “Intravenous administration” means administration into a vein.

“Targeted” or “targeted to” means having a nucleobase sequence that will allow specific hybridization of an antisense compound to a target nucleic acid to induce a desired effect. In certain embodiments, a desired effect is reduction of a target nucleic acid. In certain such embodiments, a desired effect is reduction of a CD40 mRNA.

“Targeting” means the process of design and selection of an antisense compound that will specifically hybridize to a target nucleic acid and induce a desired effect.

“Target nucleic acid,” “target RNA,” “target RNA transcript” and “nucleic acid target” all mean a nucleic acid capable of being targeted by antisense compounds. Target nucleic acids may include, but are not limited to, DNA, RNA (including, but not limited to pre-mRNA and mRNA or portions thereof) transcribed from DNA encoding a target, and also miRNA.

“Target region” means a portion of a target nucleic acid to which one or more antisense compounds is targeted.

“Target segment” means the sequence of nucleotides of a target nucleic acid to which an antisense compound is targeted. “5′ target site” refers to the 5′-most nucleotide of a target segment. “3′ target site” refers to the 3′-most nucleotide of a target segment.

“Therapeutically effective amount” means an amount of a pharmaceutical agent that provides a therapeutic benefit to an individual.

“Unmodified nucleotide” means a nucleotide composed of naturally occurring nucleobases, sugar moieties and internucleoside linkages. In certain embodiments, an unmodified nucleotide is an RNA nucleotide (i.e., β-D-ribonucleosides) or a DNA nucleotide (i.e., β-D-deoxyribonucleoside).

Antisense Compounds

Antisense compounds include, but are not limited to, oligonucleotides, oligonucleosides, oligonucleotide analogs, oligonucleotide mimetics, antisense oligonucleotides, and siRNAs. An oligomeric compound may be “antisense” to a target nucleic acid, meaning that is capable of undergoing hybridization to a target nucleic acid through hydrogen bonding.

In certain embodiments, an antisense compound has a nucleobase sequence that, when written in the 5′ to 3′ direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted. In certain such embodiments, an antisense oligonucleotide has a nucleobase sequence that, when written in the 5′ to 3′ direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted.

In certain embodiments, an antisense compound targeted to a CD40 nucleic acid is 12 to 30 subunits in length. In other words, antisense compounds are from 12 to 30 linked subunits. In other embodiments, the antisense compound is 8 to 80, 12 to 50, 15 to 30, 18 to 24, 19 to 22, or 20 linked subunits. In certain such embodiments, the antisense compounds are 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 linked subunits in length, or a range defined by any two of the above values. In some embodiments the antisense compound is an antisense oligonucleotide, and the linked subunits are nucleotides.

In certain embodiments, a shortened or truncated antisense compound targeted to a CD40 nucleic acid has a single subunit deleted from the 5′ end (5′ truncation), or alternatively from the 3′ end (3′ truncation). A shortened or truncated antisense compound targeted to a CD40 nucleic acid may have two subunits deleted from the 5′ end, or alternatively may have two subunits deleted from the 3′ end, of the antisense compound. Alternatively, the deleted nucleosides may be dispersed throughout the antisense compound, for example, in an antisense compound having one nucleoside deleted from the 5′ end and one nucleoside deleted from the 3′ end.

When a single additional subunit is present in a lengthened antisense compound, the additional subunit may be located at the 5′ or 3′ end of the antisense compound. When two are more additional subunits are present, the added subunits may be adjacent to each other, for example, in an antisense compound having two subunits added to the 5′ end (5′ addition), or alternatively to the 3′ end (3′ addition), of the antisense compound. Alternatively, the added subunits may be dispersed throughout the antisense compound, for example, in an antisense compound having one subunit added to the 5′ end and one subunit added to the 3′ end.

It is possible to increase or decrease the length of an antisense compound, such as an antisense oligonucleotide, and/or introduce mismatch bases without eliminating activity. For example, in Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992), a series of antisense oligonucleotides 13-25 nucleobases in length were tested for their ability to induce cleavage of a target RNA in an oocyte injection model. Antisense oligonucleotides 25 nucleobases in length with 8 or 11 mismatch bases near the ends of the antisense oligonucleotides were able to direct specific cleavage of the target mRNA, albeit to a lesser extent than the antisense oligonucleotides that contained no mismatches. Similarly, target specific cleavage was achieved using 13 nucleobase antisense oligonucleotides, including those with 1 or 3 mismatches.

Gautschi et al (J. Natl. Cancer Inst. 93:463-471, March 2001) demonstrated the ability of an oligonucleotide having 100% complementarity to the bcl-2 mRNA and having 3 mismatches to the bcl-xL mRNA to reduce the expression of both bcl-2 and bcl-xL in vitro and in vivo. Furthermore, this oligonucleotide demonstrated potent anti-tumor activity in vivo.

Maher and Dolnick (Nuc. Acid. Res. 16:3341-3358, 1988) tested a series of tandem 14 nucleobase antisense oligonucleotides, and a 28 and 42 nucleobase antisense oligonucleotides comprised of the sequence of two or three of the tandem antisense oligonucleotides, respectively, for their ability to arrest translation of human DHFR in a rabbit reticulocyte assay. Each of the three 14 nucleobase antisense oligonucleotides alone was able to inhibit translation, albeit at a more modest level than the 28 or 42 nucleobase antisense oligonucleotides.

Bhanot et al. (PCT/US2007/068401) provided short antisense compounds, including compounds comprising chemically-modified high-affinity monomers 8 to 16 monomers in length. These short antisense compounds were shown to be useful for reducing target nucleic acids and/or proteins in cells, tissues, and animals with increased potency and improved therapeutic index. Short antisense compounds were effective at lower doses than previously described antisense compounds, allowing for a reduction in toxicity and cost of treatment. In addition, the described short antisense compounds have greater potential for oral dosing.

Antisense Compound Motifs

In certain embodiments, antisense compounds targeted to a CD40 nucleic acid have chemically modified subunits arranged in patterns, or motifs, to confer to the antisense compounds properties such as enhanced the inhibitory activity, increased binding affinity for a target nucleic acid, or resistance to degradation by in vivo nucleases.

Chimeric antisense compounds typically contain at least one region modified so as to confer increased resistance to nuclease degradation, increased cellular uptake, increased binding affinity for the target nucleic acid, and/or increased inhibitory activity. A second region of a chimeric antisense compound may optionally serve as a substrate for the cellular endonuclease RNase H, which cleaves the RNA strand of an RNA:DNA duplex.

Antisense compounds having a gapmer motif are considered chimeric antisense compounds. In a gapmer an internal region having a plurality of nucleotides that supports RNaseH cleavage is positioned between external regions having a plurality of nucleotides that are chemically distinct from the nucleosides of the internal region. In the case of an antisense oligonucleotide having a gapmer motif, the gap segment generally serves as the substrate for endonuclease cleavage, while the wing segments comprise modified nucleosides. In a preferred embodiment, the regions of a gapmer are differentiated by the types of sugar moieties comprising each distinct region. The types of sugar moieties that are used to differentiate the regions of a gapmer may in some embodiments include β-D-ribonucleosides, β-D-deoxyribonucleosides, 2′-modified nucleosides (such 2′-modified nucleosides may include 2′-MOE, and 2′-O—CH3, among others), and bicyclic sugar modified nucleosides (such bicyclic sugar modified nucleosides may include those having a 4′-(CH2)n-O-2′ bridge, where n=1 or n=2). Preferably, each distinct region comprises uniform sugar moieties. The wing-gap-wing motif is frequently described as “X-Y-Z”, where “X” represents the length of the 5′ wing region, “Y” represents the length of the gap region, and “Z” represents the length of the 3′ wing region. Any of the antisense compounds described herein can have a gapmer motif. In some embodiments, X and Z are the same, in other embodiments they are different. In a preferred embodiment, Y is between 8 and 15 nucleotides. X, Y or Z can be any of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30 or more nucleotides. Thus, gapmers of the present invention include, but are not limited to, for example 5-10-5, 4-8-4, 4-10-4, 2-15-3, 4-12-3, 4-12-4, 3-14-3, 2-16-2, 1-18-1, 3-10-3, 2-10-2, 1-10-1 or 2-8-2.

In some embodiments, the antisense compound as a “wingmer” motif, having a wing-gap or gap-wing configuration, i.e. an X-Y or Y-Z configuration as described above for the gapmer configuration. Thus, wingmer configurations of the present invention include, but are not limited to, for example 5-10, 8-4, 4-12, 12-4, 3-14, 16-2, 18-1, 10-3, 2-10, 1-10 or 8-2.

In one embodiment, antisense compounds targeted to a CD40 nucleic acid possess a 5-10-5 gapmer motif.

In some embodiments, an antisense compound targeted to a CD40 nucleic acid has a gap-widened motif. In other embodiments, an antisense oligonucleotide targeted to a CD40 nucleic acid has a gap-widened motif.

In one embodiment, a gap-widened antisense oligonucleotide targeted to a CD40 nucleic acid has a gap segment of fourteen 2′-deoxyribonucleotides positioned between wing segments of three chemically modified nucleosides. In one embodiment, the chemical modification comprises a 2′-sugar modification. In another embodiment, the chemical modification comprises a 2′-MOE sugar modification.

Target Nucleic Acids, Target Regions and Nucleotide Sequences

Nucleotide sequences that encode CD40 include, without limitation, the following: GENBANK Accession No. X60592.1, first deposited with GENBANK® on Apr. 21, 1993 and incorporated herein as SEQ ID NO: 1; GENBANK® Accession No. H50598.1, first deposited with GENBANK® on Sep. 19, 1995, and incorporated herein as SEQ ID NO: 2; GENBANK Accession No. AA203290.1, first deposited with GENBANK® on Jan. 25, 1997, and incorporated herein as SEQ ID NO: 3; and nucleotides 9797000 to 9813000 of GENBANK Accession No. NT_011362.9, first deposited with GENBANK® on Nov. 29, 2000, and incorporated herein as SEQ ID NO: 4, and GENBANK® Accession No. BC064518.1, incorporated herein as SEQ ID NO: 237.

It is understood that the sequence set forth in each SEQ ID NO in the Examples contained herein is independent of any modification to a sugar moiety, an internucleoside linkage, or a nucleobase. As such, antisense compounds defined by a SEQ ID NO may comprise, independently, one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase. Antisense compounds described by Isis Number (Isis No) indicate a combination of nucleobase sequence and motif.

In one embodiment, a target region is a structurally defined region of the nucleic acid. For example, a target region may encompass a 3′ UTR, a 5′ UTR, an exon, an intron, a coding region, a translation initiation region, translation termination region, or other defined nucleic acid region. The structurally defined regions for CD40 can be obtained by accession number from sequence databases such as NCBI and such information is incorporated herein by reference. In other embodiments, a target region may encompass the sequence from a 5′ target site of one target segment within the target region to a 3′ target site of another target segment within the target region.

Targeting includes determination of at least one target segment to which an antisense compound hybridizes, such that a desired effect occurs. In certain embodiments, the desired effect is a reduction in mRNA target nucleic acid levels. In other embodiments, the desired effect is reduction of levels of protein encoded by the target nucleic acid or a phenotypic change associated with the target nucleic acid.

A target region may contain one or more target segments. Multiple target segments within a target region may be overlapping. Alternatively, they may be non-overlapping. In one embodiment, target segments within a target region are separated by no more than about 300 nucleotides. In other embodiments, target segments within a target region are separated by no more than about, 250, 200, 150, 100, 90, 80, 70, 60, 50, 40, 30, 20, or 10 nucleotides on the target nucleic acid. In another embodiment, target segments within a target region are separated by no more than about 5 nucleotides on the target nucleic acid. In additional embodiments, target segments are contiguous.

Suitable target segments may be found within a 5′ UTR, a coding region, a 3′ UTR, an intron, or an exon. Target segments containing a start codon or a stop codon are also suitable target segments. A suitable target segment may specifically exclude a certain structurally defined region such as the start codon or stop codon.

The determination of suitable target segments may include a comparison of the sequence of a target nucleic acid to other sequences throughout the genome. For example, the BLAST algorithm may be used to identify regions of similarity amongst different nucleic acids. This comparison can prevent the selection of antisense compound sequences that may hybridize in a non-specific manner to sequences other than a selected target nucleic acid (i.e., non-target or off-target sequences).

There may be variation in activity (e.g., as defined by percent reduction of target nucleic acid levels) of the antisense compounds within an active target region. In one embodiment, reductions in CD40 mRNA levels are indicative of inhibition of CD40 expression. Reductions in levels of a CD40 protein are also indicative of inhibition of target mRNA expression. Further, phenotypic changes are indicative of inhibition of CD40 expression. For example, changes in cell morphology over time or treatment dose as well as changes in levels of cellular components such as proteins, lipids, nucleic acids, hormones, saccharides, or metals is indicative of inhibition of CD40 expression. Reduction of eosinophils is indicative of inhibition of CD40 expression. Measurements of cellular status which include pH, stage of cell cycle, intake or excretion of biological indicators by the cell are also endpoints of interest.

Analysis of the genotype of the cell (measurement of the expression of one or more of the genes of the cell) after treatment is also used as an indicator of the efficacy or potency of the CD40 inhibitors. Hallmark genes, or those genes suspected to be associated with a specific disease state, condition, or phenotype, are measured in both treated and untreated cells.

Genomic Structure, Exons and Introns

Although some eukaryotic mRNA transcripts are directly translated, many contain one or more regions, known as “introns,” which are excised from a transcript before it is translated. The remaining (and therefore translated) regions are known as “exons” and are spliced together to form a continuous mRNA sequence. Targeting splice sites, i.e., intron-exon junctions or exon-intron junctions, may also be particularly useful in situations where aberrant splicing is implicated in disease, or where an overproduction of a particular splice product is implicated in disease. Aberrant fusion junctions due to rearrangements or deletions are also preferred target sites. mRNA transcripts produced via the process of splicing of two (or more) mRNAs from different gene sources are known as “fusion transcripts”. It is also known that introns can be effectively targeted using antisense compounds targeted to, for example, DNA or pre-mRNA.

It is also known in the art that alternative RNA transcripts can be produced from the same genomic region of DNA. These alternative transcripts are generally known as “variants”. More specifically, “pre-mRNA variants” are transcripts produced from the same genomic DNA that differ from other transcripts produced from the same genomic DNA in either their start or stop position and contain both intronic and exonic sequence.

Upon excision of one or more exon or intron regions, or portions thereof during splicing, pre-mRNA variants produce smaller “mRNA variants”. Consequently, mRNA variants are processed pre-mRNA variants and each unique pre-mRNA variant must always produce a unique mRNA variant as a result of splicing. These mRNA variants are also known as “alternative splice variants”. If no splicing of the pre-mRNA variant occurs then the pre-mRNA variant is identical to the mRNA variant.

Hybridization

In some embodiments, hybridization occurs between an antisense compound disclosed herein and a CD40 nucleic acid. The most common mechanism of hybridization involves hydrogen bonding (e.g., Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding) between complementary nucleobases of the nucleic acid molecules.

Hybridization can occur under varying conditions. Stringent conditions are sequence-dependent and are determined by the nature and composition of the nucleic acid molecules to be hybridized.

Methods of determining whether a sequence is specifically hybridizable to a target nucleic acid are well known in the art. In one embodiment, the antisense compounds provided herein are specifically hybridizable with a CD40 nucleic acid.

Complementarity

An antisense compound and a target nucleic acid are complementary to each other when a sufficient number of nucleobases of the antisense compound can hydrogen bond with the corresponding nucleobases of the target nucleic acid, such that a desired effect will occur (e.g., antisense inhibition of a target nucleic acid, such as a CD40 nucleic acid).

Non-complementary nucleobases between an antisense compound and a CD40 nucleic acid may be tolerated provided that the antisense compound remains able to specifically hybridize to a target nucleic acid. Moreover, an antisense compound may hybridize over one or more segments of a CD40 nucleic acid such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure, mismatch or hairpin structure).

In some embodiments, the antisense compounds provided herein are at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% complementary to a CD40 nucleic acid. Percent complementarity of an antisense compound with a target nucleic acid can be determined using routine methods. For example, an antisense compound in which 18 of 20 nucleobases of the antisense compound are complementary to a target region, and would therefore specifically hybridize, would represent 90 percent complementarity. In this example, the remaining noncomplementary nucleobases may be clustered or interspersed with complementary nucleobases and need not be contiguous to each other or to complementary nucleobases. As such, an antisense compound which is 18 nucleobases in length having 4 (four) noncomplementary nucleobases which are flanked by two regions of complete complementarity with the target nucleic acid would have 77.8% overall complementarity with the target nucleic acid and would thus fall within the scope of the present invention. Percent complementarity of an antisense compound with a region of a target nucleic acid can be determined routinely using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et al., J. Mol. Biol., 1990, 215, 403 410; Zhang and Madden, Genome Res., 1997, 7, 649 656). Percent homology, sequence identity or complementarity, can be determined by, for example, the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.), using default settings, which uses the algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482 489).

In other embodiments, the antisense compounds provided herein are fully complementary (i.e, 100% complementary) to a target nucleic acid. For example, an antisense compound may be fully complementary to a CD40 nucleic acid, or a target region, or a target segment or target sequence thereof. As used herein, “fully complementary” means each nucleobase of an antisense compound is capable of precise base pairing with the corresponding nucleobases of a target nucleic acid.

The location of a non-complementary nucleobase may be at the 5′ end or 3′ end of the antisense compound. Alternatively, the non-complementary nucleobase or nucleobases may be at an internal position of the antisense compound. When two or more non-complementary nucleobases are present, they may be contiguous (i.e. linked) or non-contiguous. In one embodiment, a non-complementary nucleobase is located in the wing segment of a gapmer antisense oligonucleotide.

In one embodiment, antisense compounds up to 20 nucleobases in length comprise no more than 4, no more than 3, no more than 2 or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, such as a CD40 nucleic acid.

In another embodiment, antisense compounds up to 30 nucleobases in length comprise no more than 6, no more than 5, no more than 4, no more than 3, no more than 2 or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, such as a CD40 nucleic acid.

The antisense compounds provided herein also include those which are complementary to a portion of a target nucleic acid. As used herein, “portion” refers to a defined number of contiguous (i.e. linked) nucleobases within a region or segment of a target nucleic acid. A “portion” can also refer to a defined number of contiguous nucleobases of an antisense compound. In one embodiment, the antisense compounds are complementary to at least an 8 nucleobase portion of a target segment. In another embodiment, the antisense compounds are complementary to at least a 12 nucleobase portion of a target segment. In yet another embodiment, the antisense compounds are complementary to at least a 15 nucleobase portion of a target segment. Also contemplated are antisense compounds that are complementary to at least a 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more nucleobase portion of a target segment, or a range defined by any two of these values.

Identity

The antisense compounds provided herein may also have a defined percent identity to a particular nucleotide sequence, SEQ ID NO, or compound represented by a specific Isis number. As used herein, an antisense compound is identical to the sequence disclosed herein if it has the same nucleobase pairing ability. For example, a RNA which contains uracil in place of thymidine in a disclosed DNA sequence would be considered identical to the DNA sequence since both uracil and thymidine pair with adenine. Shortened and lengthened versions of the antisense compounds described herein as well as compounds having non-identical bases relative to the antisense compounds provided herein also are contemplated. The non-identical bases may be adjacent to each other or dispersed throughout the antisense compound. Percent identity of an antisense compound is calculated according to the number of bases that have identical base pairing relative to the sequence to which it is being compared.

In one embodiment, the antisense compounds are at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to one or more of the antisense compounds or SEQ ID NOs, or a portion thereof, disclosed herein.

Modifications

A nucleoside is a base-sugar combination. The nucleobase (also known as base) portion of the nucleoside is normally a heterocyclic base moiety. Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to the 2′, 3′ or 5′ hydroxyl moiety of the sugar. Oligonucleotides are formed through the covalent linkage of adjacent nucleosides to one another, to form a linear polymeric oligonucleotide. Within the oligonucleotide structure, the phosphate groups are commonly referred to as forming the internucleoside linkages of the oligonucleotide.

Modifications to antisense compounds encompass substitutions or changes to internucleoside linkages, sugar moieties, or nucleobases. Modified antisense compounds are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid target, increased stability in the presence of nucleases, or increased inhibitory activity.

Chemically modified nucleosides may also be employed to increase the binding affinity of a shortened or truncated antisense oligonucleotide for its target nucleic acid. Consequently, comparable results can often be obtained with shorter antisense compounds that have such chemically modified nucleosides.

Modified Internucleoside Linkages

The naturally occurring internucleoside linkage of RNA and DNA is a 3′ to 5′ phosphodiester linkage. Antisense compounds having one or more modified, i.e. non-naturally occurring, internucleoside linkages are often selected over antisense compounds having naturally occurring internucleoside linkages because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for target nucleic acids, and increased stability in the presence of nucleases.

Oligonucleotides having modified internucleoside linkages include internucleoside linkages that retain a phosphorus atom as well as internucleoside linkages that do not have a phosphorus atom. Representative phosphorus containing internucleoside linkages include, but are not limited to, phosphodiesters, phosphotriesters, methylphosphonates, phosphonoacetates, phosphoramidate, and phosphorothioates or phosphorodithioates. Internucleoside linkages that do not have a phosphorus atom include, amongst others, methylene(methylimino) or MMI linkages, morpholino linkages or amide linkages. In peptide nucleic acids (PNA) the sugar backbone is replaced with an amide containing backbone.

Methods of preparation of phosphorous-containing and non-phosphorous-containing linkages are well known.

Representative United States patents that teach the preparation of phosphorus-containing linkages include, but are not limited to, U.S. Pat. Nos. 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306; 5,550,111; 5,563,253; 5,571,799; 5,587,361; 5,194,599; 5,565,555; 5,527,899; 5,721,218; 5,672,697; 5,625,050 and U.S. Pat. No. 6,693,187, each of which is herein incorporated by reference.

Representative United States patents that teach the preparation of non-phosphorous-containing linkages include, but are not limited to, U.S. Pat. Nos. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,264,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; 5,792,608; 5,646,269 and 5,677,439, each of which is herein incorporated by reference.

In one embodiment, antisense compounds targeted to a CD40 nucleic acid comprise one or more modified internucleoside linkages. In some embodiments, the modified internucleoside linkages are phosphorothioate linkages. In other embodiments, each internucleoside linkage of an antisense compound is a phosphorothioate internucleoside linkage.

Modified Sugar Moieties

Antisense compounds of the invention can optionally contain one or more nucleosides wherein the sugar group has been modified. Such sugar modified nucleosides may impart enhanced nuclease stability, increased binding affinity or some other beneficial biological property to the antisense compounds. In certain embodiments, nucleosides are modified by modification of the ribofuranose ring. Such modifications include without limitation, addition of substituent groups, bridging of non-geminal ring atoms to form a bicyclic nucleic acid (BNA), as in locked nucleic acids (LNA), replacement of the ribosyl ring oxygen atom with S, N(R), or C(R1)(R)2 (R═H, C1-C12 alkyl or a protecting group) and combinations thereof. Examples of chemically modified sugars include 2′-F-5′-methyl substituted nucleoside (see PCT International Application WO 2008/101157 published on Aug. 21, 2008 for other disclosed 5′,2′-bis substituted nucleosides) or replacement of the ribosyl ring oxygen atom with S with further substitution at the 2′-position (see published U.S. Patent Application US2005-0130923, published on Jun. 16, 2005) or alternatively 5′-substitution of a BNA (see PCT International Application WO 2007/134181 Published on Nov. 22, 2007 wherein LNA is substituted with for example a 5′-methyl or a 5′-vinyl group).

Examples of nucleosides having modified sugar moieties include without limitation nucleosides comprising 5′-vinyl, 5′-methyl (R or S), 4′-S, 2′-F, 2′-OCH3 (known as 2′-OMe) and 2′-O(CH2)2OCH3 (known as 2′MOE) substituent groups. The substituent at the 2′ position can also be selected from allyl, amino, azido, thio, O-allyl, O—C1-C10 alkyl, OCF3, O—CH2CH2CH2NH2, O(CH2)2SCH3, O(CH2)2—O—N(Rm)(Rn) such as 2′-dimethylaminooxyethoxy (2′-O—(CH2)2ON(CH3)2 or 2′-DMAOE), O(CH2)2—O—(CH2)2—N(Rm)(Rn) such as 2′-dimethylaminoethoxyethoxy (2′-O—(CH2)2—O—(CH2)2—N(CH3)2 or 2′-DMAEOE and O—CH2—C(═O)—N(Rm)(Rn), where each Rm and Rn is, independently, H or substituted or unsubstituted C1-C10 alkyl.

Examples of bicyclic nucleic acids (BNAs) include without limitation nucleosides comprising a bridge between the 4′ and the 2′ ribosyl ring atoms, e.g. a 4′-(CH2)n—O-2′ bridge, where n=1 or n=2. In certain embodiments, antisense compounds provided herein include one or more BNA nucleosides wherein the bridge comprises one of the formulas: 4′-(CH2)—O-2′ (LNA); 4′-(CH2)—S-2′; 4′-(CH2)—O-2′ (LNA); 4′-(CH2)2—O-2′ (ENA); 4′-C(CH3)2—O-2′ (see PCT/US2008/068922); 4′-CH(CH3)—O-2′ and 4′CH(CH2OCH3)—O-2′ (see U.S. Pat. No. 7,399,845, issued on Jul. 15, 2008); 4′-CH2—N(OCH3)-2′ (see PCT/US2008/064591); 4′-CH2—O—N(CH3)-2′ (see published U.S. Patent Application US2004-0171570, published Sep. 2, 2004); 4′-CH2—N(R)—O-2′ (see U.S. Pat. No. 7,427,672, issued on Sep. 23, 2008); 4′-CH2—C(CH3)-2′ and 4′-CH2—C(═CH2)-2′ (see PCT/US2008/066154); and wherein R is, independently, H, C1-C12 alkyl, or a protecting group. Each of the foregoing BNAs include various stereochemical sugar configurations including for example α-L-ribofuranose and β-D-ribofuranose (See PCT international application PCT/DK98/00393, published on Mar. 25, 1999 as WO99/14226).

In certain embodiments, nucleosides are modified by replacement of the ribosyl ring with a sugar surrogate. Such modification includes without limitation, replacement of the ribosyl ring with a surrogate ring system (sometimes referred to as DNA analogs) such as a morpholino ring, a cyclohexenyl ring, a cyclohexyl ring or a tetrahydropyranyl ring such as one having one of the formula:

##STR00002##
wherein Bx is an optionally protected heterocyclic base moiety.

Many other bicyclo and tricyclo sugar surrogate ring systems are also know in the art that can be used to modify nucleosides for incorporation into antisense compounds (see for example Leumann, C. J., Bioorg. Med. Chem. 10, (2002), 841-854). Such ring systems can undergo various additional substitutions to enhance activity.

Methods for the preparations of modified sugars are well known to those skilled in the art. Representative United States patents that teach the preparation of modified sugars include, but are not limited to U.S. Pat. No. 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; and 5,700,920, each of which is herein incorporated by reference.

In certain embodiments, a 2′-modified nucleoside has a bicyclic sugar moiety. In certain such embodiments, the bicyclic sugar moiety is a D sugar in the alpha configuration. In certain such embodiments, the bicyclic sugar moiety is a D sugar in the beta configuration. In certain such embodiments, the bicyclic sugar moiety is an L sugar in the alpha configuration. In certain such embodiments, the bicyclic sugar moiety is an L sugar in the beta configuration.

In certain embodiments, the bicyclic sugar moiety comprises a bridge group between the 2′ and the 4′-carbon atoms. In certain such embodiments, the bridge group comprises from 1 to 8 linked biradical groups. In certain embodiments, the bicyclic sugar moiety comprises from 1 to 4 linked biradical groups. In certain embodiments, the bicyclic sugar moiety comprises 2 or 3 linked biradical groups. In certain embodiments, the bicyclic sugar moiety comprises 2 linked biradical groups. In certain embodiments, a linked biradical group is selected from —O—, —S—, —N(R1)-, —C(R1)(R2)-, —C(R1)=C(R1)-, —C(R1)=N—, —C(═NR1)-, —Si(R1)(R2)-, —S(═O)2—, —S(═O)—, —C(═O)— and —C(═S)—; where each R1 and R2 is, independently, H, hydroxyl, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5-C20 aryl, a heterocycle radical, a substituted hetero-cycle radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclic radical, substituted C5-C7 alicyclic radical, halogen, substituted oxy (—O—), amino, substituted amino, azido, carboxyl, substituted carboxyl, acyl, substituted acyl, CN, thiol, substituted thiol, sulfonyl (S(═O)2—H), substituted sulfonyl, sulfoxyl (S(═O)—H) or substituted sulfoxyl; and each substituent group is, independently, halogen, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, amino, substituted amino, acyl, substituted acyl, C1-C12 aminoalkyl, C1-C12 aminoalkoxy, substituted C1-C12 aminoalkyl, substituted C1-C12 aminoalkoxy or a protecting group.

In some embodiments, the bicyclic sugar moiety is bridged between the 2′ and 4′ carbon atoms with a biradical group selected from —O—(CH2)p-, —O—CH2—, —O—CH2CH2, —O—CH(alkyl)-, —NH—(CH2)p-, —N(alkyl)-(CH2)p-, —O—CH(alkyl)-, —(CH(alkyl))(CH2)p-, —NH—O—(CH2)p-, —N(alkyl)-O—(CH2)p-, or —O—N(alkyl)-(CH2)p-, wherein p is 1, 2, 3, 4 or 5 and each alkyl group can be further substituted. In certain embodiments, p is 1, 2 or 3.

In one aspect, each of said bridges is, independently, —[C(R1)(R2)]n-, —[C(R1)(R2)]n-O—, —C(R1R2)-N(R1)-O— or —C(R1R2)-O—N(R1)-. In another aspect, each of said bridges is, independently, 4′-(CH2)3-2′,4′-(CH2)2-2′,4′-CH2—O-2′,4′-(CH2)2—O-2′,4′-CH2—O—N(R1)-2′ and 4′-CH2—N(R1)-O-2′- wherein each R1 is, independently, H, a protecting group or C1-C12 alkyl.

In nucleotides having modified sugar moieties, the nucleobase moieties (natural, modified or a combination thereof) are maintained for hybridization with an appropriate nucleic acid target.

In one embodiment, antisense compounds targeted to a CD40 nucleic acid comprise one or more nucleotides having modified sugar moieties. In a preferred embodiment, the modified sugar moiety is 2′-MOE. In other embodiments, the 2′-MOE modified nucleotides are arranged in a gapmer motif.

Modified Nucleobases

Nucleobase (or base) modifications or substitutions are structurally distinguishable from, yet functionally interchangeable with, naturally occurring or synthetic unmodified nucleobases. Both natural and modified nucleobases are capable of participating in hydrogen bonding. Such nucleobase modifications may impart nuclease stability, binding affinity or some other beneficial biological property to antisense compounds. Modified nucleobases include synthetic and natural nucleobases such as, for example, 5-methylcytosine (5-me-C). Certain nucleobase substitutions, including 5-methylcytosine substitutions, are particularly useful for increasing the binding affinity of an antisense compound for a target nucleic acid. For example, 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2° C. (Sanghvi, Y. S., Crooke, S. T. and Lebleu, B., eds., Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278).

Additional unmodified nucleobases include 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl (—C≡C—CH3) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine and 3-deazaadenine.

Heterocyclic base moieties may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Nucleobases that are particularly useful for increasing the binding affinity of antisense compounds include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines, including 2 aminopropyladenine, 5-propynyluracil and 5-propynylcytosine.

Methods for the preparations of modified nucleobases are well known to those skilled in the art. Representative United States patents that teach the preparation of modified nucleobases include, but are not limited to U.S. Pat. No. 3,687,808, as well as U.S. Pat. Nos. 4,845,205; 5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594,121, 5,596,091; 5,614,617; 5,645,985; 5,830,653; 5,763,588; 6,005,096; 5,750,692 and 5,681,941 each of which is herein incorporated by reference.

In one embodiment, antisense compounds targeted to a CD40 nucleic acid comprise one or more modified nucleobases. In an additional embodiment, gap-widened antisense oligonucleotides targeted to a CD40 nucleic acid comprise one or more modified nucleobases. In some embodiments, the modified nucleobase is 5-methylcytosine. In further embodiments, each cytosine is a 5-methylcytosine.

Conjugated Antisense Compounds

Antisense compounds may be covalently linked to one or more moieties or conjugates which enhance the activity, cellular distribution or cellular uptake of the resulting antisense oligonucleotides. Typical conjugate groups include cholesterol moieties and lipid moieties. Additional conjugate groups include carbohydrates, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes.

Antisense compounds can also be modified to have one or more stabilizing groups that are generally attached to one or both termini of antisense compounds to enhance properties such as, for example, nuclease stability. Included in stabilizing groups are cap structures. These terminal modifications protect the antisense compound having terminal nucleic acid from exonuclease degradation, and can help in delivery and/or localization within a cell. The cap can be present at the 5′-terminus (5′-cap), or at the 3′-terminus (3′-cap), or can be present on both termini. Cap structures are well known in the art and include, for example, inverted deoxy abasic caps. Further 3′ and 5′-stabilizing groups that can be used to cap one or both ends of an antisense compound to impart nuclease stability include those disclosed in WO 03/004602 published on Jan. 16, 2003.

Compositions and Methods for Formulating Pharmaceutical Compositions

Antisense oligonucleotides may be admixed with pharmaceutically acceptable active and/or inert substances for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.

Antisense compound targeted to a CD40 nucleic acid can be utilized in pharmaceutical compositions by combining the antisense compound with a suitable pharmaceutically acceptable diluent or carrier. A pharmaceutically acceptable diluent includes for example phosphate-buffered saline (PBS). PBS is a diluent suitable for use in compositions to be delivered parenterally. Accordingly, in one embodiment, employed in the methods described herein is a pharmaceutical composition comprising an antisense compound targeted to a CD40 nucleic acid and a pharmaceutically acceptable diluent. In one embodiment, the pharmaceutically acceptable diluent is PBS. In other embodiments, the antisense compound is an antisense oligonucleotide.

Pharmaceutical compositions comprising antisense compounds encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other oligonucleotide which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of antisense compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.

A prodrug can include the incorporation of additional nucleosides at one or both ends of an antisense compound which are cleaved by endogenous nucleases within the body, to form the active antisense compound.

The present invention also includes pharmaceutical compositions and formulations which include the antisense compounds of the invention. The pharmaceutical compositions of the present invention may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration may be topical (including ophthalmic and to mucous membranes including vaginal and rectal delivery), pulmonary, e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer; intratracheal, intranasal, epidermal and transdermal), oral or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial, e.g., intrathecal or intraventricular, administration. Oligonucleotides with at least one 2′-O-methoxyethyl modification are believed to be particularly useful for oral administration.

Pharmaceutical compositions and formulations for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders. Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable. Coated condoms, gloves and the like may also be useful.

The pharmaceutical formulations of the present invention, which may conveniently be presented in unit dosage form, may be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s). In general, the formulations are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.

The compositions of the present invention may be formulated into any of many possible dosage forms such as, but not limited to, tablets, capsules, gel capsules, liquid syrups, soft gels, suppositories, and enemas. The compositions of the present invention may also be formulated as suspensions in aqueous, non-aqueous or mixed media. Aqueous suspensions may further contain substances which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran. The suspension may also contain stabilizers.

Pharmaceutical compositions of the present invention include, but are not limited to, solutions, emulsions, foams and liposome-containing formulations. The pharmaceutical compositions and formulations of the present invention may comprise one or more penetration enhancers, carriers, excipients or other active or inactive ingredients.

Emulsions are typically heterogenous systems of one liquid dispersed in another in the form of droplets usually exceeding 0.1 μm in diameter. Emulsions may contain additional components in addition to the dispersed phases, and the active drug which may be present as a solution in either the aqueous phase, oily phase or itself as a separate phase. Microemulsions are included as an embodiment of the present invention. Emulsions and their uses are well known in the art and are further described in U.S. Pat. No. 6,287,860, which is incorporated herein in its entirety.

Formulations of the present invention include liposomal formulations. As used in the present invention, the term “liposome” means a vesicle composed of amphiphilic lipids arranged in a spherical bilayer or bilayers. Liposomes are unilamellar or multilamellar vesicles which have a membrane formed from a lipophilic material and an aqueous interior that contains the composition to be delivered. Cationic liposomes are positively charged liposomes which are believed to interact with negatively charged DNA molecules to form a stable complex. Liposomes that are pH-sensitive or negatively-charged are believed to entrap DNA rather than complex with it. Both cationic and noncationic liposomes have been used to deliver DNA to cells.

Liposomes also include “sterically stabilized” liposomes, a term which, as used herein, refers to liposomes comprising one or more specialized lipids that, when incorporated into liposomes, result in enhanced circulation lifetimes relative to liposomes lacking such specialized lipids. Examples of sterically stabilized liposomes are those in which part of the vesicle-forming lipid portion of the liposome comprises one or more glycolipids or is derivatized with one or more hydrophilic polymers, such as a polyethylene glycol (PEG) moiety. Liposomes and their uses are further described in U.S. Pat. No. 6,287,860, which is incorporated herein in its entirety.

Other liposomes or lipid based delivery systems known in the art are described for example in WO 05/105152; WO 06/069782; Morrissey et al., Nature Biotechnology, 23 (8), 1002-1007, 2005; WO 05/007196; Wheeler et al., Gene Therapy, 6 (2), 271-281, 1999; WO 02/34236; Budker et al., Nature Biotechnology, 14 (6), 760-764, 1996; U.S. Pat. No. 5,965,434; U.S. Pat. No. 5,635,487; Spagnou et al., Biochemistry, 43 (42), 13348-13356, 2004; U.S. Pat. No. 6,756,054; WO 06/016097 and U.S. Pat. No. 5,785,992; WO 04/035523, each of which is herein incorporated by reference.

In a preferred embodiment of the invention amphoteric liposomes may be used as formulations which include the inventive antisense compounds. Amphoteric liposomes are a class of liposomes having an anionic or neutral charge at pH 7.5 and a cationic charge at pH 4. Reference is made to WO 02/066012 by Panzner et al. which is incorporated herein by reference. The use, selection and manufacturing of amphoteric liposomes for the transfection of cells is further described in WO 05/094783 of Ended et al., WO 07/031,333 of Panzner et al., WO 07/107,304 of Panzner et al. and WO 08/043,575 of Panzner et al. Amphoteric liposomes have an excellent bio-distribution and are well tolerated in animals. They can encapsulate nucleic acid molecules with high efficiency. WO 06/048329 of Panzner et al., which is incorporated herein by reference in its entirety, describes pharmaceutical compositions comprising amphoteric liposomes and oligonucleotides which are adapted to target nucleic acids encoding CD40.

By “amphoteric” is meant herein that the liposomes comprise charged groups of both anionic and cationic character wherein:

(i) at least one of the charged groups has a pKa between 4 and 7.4,

(ii) the cationic charge prevails at pH 4 and

(iii) the anionic charge prevails at pH 7.4;

whereby the liposomes have an isoelectric point of zero net charge between pH 4 and pH 7.4. Amphoteric character, by this definition, is different from “zwitterionic character”, because zwitterions do not have a pK in the range mentioned above. In consequence, zwitterions are essentially neutral over a range of pH values. Phosphatidylcholine or phosphatidylethanolamines, for example, are neutral lipids with zwitterionic character.

Amphoteric liposomes may be formed from a lipid phase comprising an amphoteric lipid. In some embodiments said lipid phase may comprise 5 to 30 mol. % of said amphoteric lipid, preferably 10 to 25 mol. %.

Suitable amphoteric lipids are disclosed in WO 02/066489 and WO 03/070735 by Panzner et al. Preferably, said amphoteric lipid is selected from the group consisting of HistChol, HistDG, isoHistSuccDG, Acylcarnosin and HCChol. (A glossary of such abbreviated forms of the names of the lipids referred to herein is included below for ease of reference. A number of such abbreviations are those that are commonly used by those skilled in the art.)

Alternatively, said amphoteric liposomes may be formed from a lipid phase comprising a mixture of lipid components with amphoteric properties. Such amphoteric liposomes may be formed from pH-responsive anionic and/or cationic components, as disclosed for example in WO 02/066012. Cationic lipids sensitive to pH are disclosed in WO 02/066489 and WO 03/070220 and in the references made therein, in particular in Budker, et al. 1996, Nat Biotechnol. 14 (6):760-4, and can be used in combination with constitutively charged anionic lipids or with anionic lipids that are sensitive to pH.

Alternatively, the cationic charge may be introduced from constitutively charged lipids that are known to those skilled in the art in combination with a pH sensitive anionic lipid. Combinations of constitutively charged anionic and cationic lipids, e.g. DOTAP and DPPG, are not preferred. Thus, in some presently preferred embodiments of the invention, said mixture of lipid components may comprise (i) a stable cationic lipid and a chargeable anionic lipid, (ii) a chargeable cationic lipid and chargeable anionic lipid or (iii) a stable anionic lipid and a chargeable cationic lipid.

Preferred cationic components include DMTAP, DPTAP, DOTAP, DC-Chol, MoChol, HisChol, DPIM, CHIM, DOME, DDAB, DAC-Chol, TC-Chol, DOTMA, DOGS, (C18)2Gly+ N,N-dioctadecylamido-glycin, CTAB, CPyC, DODAP and DOEPC.

Preferred anionic lipids for use with the invention include DOGSucc, POGSucc, DMGSucc, DPGSucc, DMPS, DPPS, DOPS, POPS, DMPG, DPPG, DOPG, POPG, DMPA, DPPA, DOPA, POPA, CHEMS and CetylP.

Preferably, such an amphoteric mixture of lipids does not constitute more than about 70 mol. % of the lipid phase. In some embodiments, said mixture may constitute not more than 50 mol. % of the lipid phase; preferably said lipid phase comprises about 20 to about 40 mol. % of such a mixture.

In some embodiments, said lipid phase may further comprise a neutral lipid, preferably a neutral phospholipid, such as a phosphatidylcholine. Presently preferred phosphatidylcholines include POPC, natural or hydrogenated soy bean PC, natural or hydrogenated egg PC, DMPC, DPPC, DSPC and DOPC. More preferably, said phosphatidylcholine comprises POPC, non-hydrogenated soy bean PC or non-hydrogenated egg PC.

The lipid phase may comprise at least 15 mol. % of said phosphatidylcholine, preferably at least 20 mol. %. In some embodiments, said lipid phase may comprise no less than about 25 mol. % phosphatidylcholine. Alternatively, said lipid phase may comprise no less than about 40 mol. % phosphatidylcholine.

A presently preferred formulation in accordance with the present invention comprises a liposome having about 60 mol. % POPC, about 10 mol. % DOTAP and about 30 mol. % CHEMS.

In some embodiments said neutral lipid may comprise a phosphatidylethanolamine or a mixture of phosphatidylcholine and phosphatidylethanolamine. Said neutral phosphatidylcholines or phosphatidylethanolamines or mixtures of the two may be present in the lipid phase in the molar amount (mol. %) not constituted by the other components of the lipid phase, but to at least 20 mol. % (the total for the lipid phase being 100 mol. %).

Preferred phosphatidylethanolamines include DOPE, DMPE and DPPE.

In some embodiments said neutral lipid may comprise POPC and DOPE.

Advantageously, said lipid phase may comprise a mixture of anionic and cationic lipids with amphoteric properties, phosphatidylcholine and phosphatidylethanolamine. Amphoteric liposomes formed from such a lipid phase may be serum-stable and therefore suitable for systemic delivery. Preferably said lipid phase comprises MoChol as a cationic lipid and CHEMS or DMG-Succ as an anionic lipid.

Further presently preferred amphoteric liposomes for use as formulations which include antisense compounds of the present invention may be selected from the group consisting of:

Alternatively, said lipid phase may comprise a mixture of anionic and cationic lipids with amphoteric properties a neutral phosphatidylcholine and cholesterol. Such liposomes may also be serum-stable. In some embodiments, said lipid phase may comprise from 30 mol. % to 50 mol. % cholesterol, preferably from about 35 mol. % to about 45 mol. %. Alternatively, said lipid phase may comprise phosphatidylcholine and from 10 mol. % to 25 mol. % cholesterol, preferably from about 15 mol. % to about 25 mol. %.

A presently preferred formulation comprises 10 to 25 mol. % amphoteric lipid, e.g. HistChol, HistDG or Acylcarnosin, 15 to 25 mol. % cholesterol and the remainder being POPC, soy bean PC, egg PC, DMPC, DPPC or DOPC, preferably POPC; for example about 60 mol. % POPC, about 20 mol. % HistChol and about 20 mol. % Chol.

Another presently preferred formulation in accordance with the present invention comprises a liposome including a mix of lipid components with amphoteric properties and having about 30 mol. % POPC, about 10 mol. % DOTAP, about 20 mol. % CHEMS and about 40 mol. % Chol.

The amphoteric liposomes may have a size in the range 50 to 500 nm, preferably 100 to 500 nm, more preferably 150 and 300 nm.

The amphoteric liposome formulations of the present invention may be formulated for use as a colloid in a suitable pharmacologically acceptable vehicle. Vehicles such as water, saline, phosphate buffered saline and the like are well known to those skilled in the art for this purpose.

In some embodiments, the amphoteric liposome formulations of the present invention may be administered at a physiological pH of between about 7 and about 8. To this end, the formulation comprising the antisense compound, excipient and vehicle may be formulated to have a pH in this range.

The amphoteric liposome formulations of the invention may be manufactured using suitable methods that are known to those skilled in the art. Such methods include, but are not limited to, extrusion through membranes of defined pore size, injection of lipid solutions in ethanol into a water phase containing the cargo to be encapsulated, or high pressure homogenisation.

A solution of the oligonucleotide may be contacted with said excipient at a neutral pH, thereby resulting in volume inclusion of a certain percentage of the solution. An high concentrations of the excipient, ranging from about 50 mM to about 150 mM, is preferred to achieve substantial encapsulation of the active agent.

Amphoteric liposomes used as formulations in accordance with the present invention offer the distinct advantage of binding oligonucleotides at or below their isoelectric point, thereby concentrating said active agent at the liposome surface. This process is described in more detail in WO 02/066012.

Irrespective of the actual production process used to make the amphoteric liposome formulations, in some embodiments, non-encapsulated oligonucleotide may be removed from the liposomes after the initial production step in which the liposomes are formed as tight containers. Again, the technical literature and the references included herein describe such methodology in detail and suitable process steps may include, but are not limited to, size exclusion chromatography, sedimentation, dialysis, ultrafiltration and diafiltration.

However, the removal of any non-encapsulated oligonucleotide is not required for performance of the invention, and in some embodiments the composition may comprise free as well as entrapped drug.

In some aspects of the invention the amphoteric liposome formulations which include the inventive antisense compounds may be used as pharmaceutical compositions for the prevention or treatment of an inflammatory, immune or autoimmune disorder of a human or non-human animal such as graft rejection, graft-versus-host disease, multiple sclerosis, systemic lupus erythematosous, rheumatoid arthritis, asthma, inflammatory bowel disease, psoriasis or thyroiditis, Morbus Crohn and Colitis ulcerosa.

The pharmaceutical formulations and compositions of the present invention may also include surfactants. The use of surfactants in drug products, formulations and in emulsions is well known in the art. Surfactants and their uses are further described in U.S. Pat. No. 6,287,860, which is incorporated herein in its entirety. In one embodiment, the present invention employs various penetration enhancers to effect the efficient delivery of nucleic acids, particularly oligonucleotides. In addition to aiding the diffusion of non-lipophilic drugs across cell membranes, penetration enhancers also enhance the permeability of lipophilic drugs. Penetration enhancers may be classified as belonging to one of five broad categories, i.e., surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactants. Penetration enhancers and their uses are further described in U.S. Pat. No. 6,287,860, which is incorporated herein in its entirety.

One of skill in the art will recognize that formulations are routinely designed according to their intended use, i.e. route of administration.

Preferred formulations for topical administration include those in which the oligonucleotides of the invention are in admixture with a topical delivery agent such as lipids, liposomes, fatty acids, fatty acid esters, steroids, chelating agents and surfactants. Preferred lipids and liposomes include neutral (e.g. dioleoylphosphatidyl DOPE ethanolamine, dimyristoylphosphatidyl choline DMPC, distearolyphosphatidyl choline) negative (e.g. dimyristoylphosphatidyl glycerol DMPG); cationic (e.g. dioleoyltetramethylaminopropyl DOTAP and dioleoylphosphatidyl ethanolamine DOTMA) or amphoteric lipids or lipid mixtures wherein a mixture of cationic and anionic lipids displays amphoteric properties. For topical or other administration, oligonucleotides of the invention may be encapsulated within liposomes or may form complexes thereto, in particular to cationic liposomes. Alternatively, oligonucleotides may be complexed to lipids, in particular to cationic lipids. Preferred fatty acids and esters, pharmaceutically acceptable salts thereof, and their uses are further described in U.S. Pat. No. 6,287,860, which is incorporated herein in its entirety. Topical formulations are described in detail in U.S. patent application Ser. No. 09/315,298 filed on May 20, 1999, which is incorporated herein by reference in its entirety.

Compositions and formulations for oral administration include powders or granules, microparticulates, nanoparticulates, suspensions or solutions in water or non-aqueous media, capsules, gel capsules, sachets, tablets or minitablets. Thickeners, flavoring agents, diluents, emulsifiers, dispersing aids or binders may be desirable. Preferred oral formulations are those in which oligonucleotides of the invention are administered in conjunction with one or more penetration enhancers surfactants and chelators. Preferred surfactants include fatty acids and/or esters or salts thereof, bile acids and/or salts thereof. Preferred bile acids/salts and fatty acids and their uses are further described in U.S. Pat. No. 6,287,860, which is incorporated herein in its entirety. Also preferred are combinations of penetration enhancers, for example, fatty acids/salts in combination with bile acids/salts. A particularly preferred combination is the sodium salt of lauric acid, capric acid and UDCA. Further penetration enhancers include polyoxyethylene-9-lauryl ether, polyoxyethylene-20-cetyl ether. Oligonucleotides of the invention may be delivered orally, in granular form including sprayed dried particles, or complexed to form micro or nanoparticles. Oligonucleotide complexing agents and their uses are further described in U.S. Pat. No. 6,287,860, which is incorporated herein in its entirety. Oral formulations for oligonucleotides and their preparation are described in detail in U.S. application Ser. Nos. 09/108,673 (filed Jul. 1, 1998), 09/315,298 (filed May 20, 1999) and 10/071,822, filed Feb. 8, 2002, each of which is incorporated herein by reference in their entirety.

Compositions and formulations for parenteral, intrathecal or intraventricular administration may include sterile aqueous solutions which may also contain buffers, diluents and other suitable additives such as, but not limited to, penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients.

Certain embodiments of the invention provide pharmaceutical compositions containing one or more oligomeric compounds and one or more other active agents which function by a non-antisense mechanism, such as for example chemotherapeutic agents or antiinflammatory drugs. Examples of such chemotherapeutic agents include but are not limited to cancer chemotherapeutic drugs such as daunorubicin, daunomycin, dactinomycin, doxorubicin, epirubicin, idarubicin, esorubicin, bleomycin, mafosfamide, ifosfamide, cytosine arabinoside, bis-chloroethylnitrosurea, busulfan, mitomycin C, actinomycin D, mithramycin, prednisone, hydroxyprogesterone, testosterone, tamoxifen, dacarbazine, procarbazine, hexamethylmelamine, pentamethylmelamine, mitoxantrone, amsacrine, chlorambucil, methylcyclohexylnitrosurea, nitrogen mustards, melphalan, cyclophosphamide, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-azacytidine, hydroxyurea, deoxycoformycin, 4-hydroxyperoxycyclophosphoramide, 5-fluorouracil (5-FU), 5-fluorodeoxyuridine (5-FUdR), methotrexate (MTX), colchicine, taxol, vincristine, vinblastine, etoposide (VP-16), trimetrexate, irinotecan, topotecan, gemcitabine, teniposide, cisplatin and diethylstilbestrol (DES). When used with the compounds of the invention, such chemotherapeutic agents may be used individually (e.g., 5-FU and oligonucleotide), sequentially (e.g., 5-FU and oligonucleotide for a period of time followed by MTX and oligonucleotide), or in combination with one or more other such chemotherapeutic agents (e.g., 5-FU, MTX and oligonucleotide, or 5-FU, radiotherapy and oligonucleotide).

Anti-inflammatory drugs, including but not limited to non-steroidal anti-inflammatory drugs and corticosteroids, and antiviral drugs, including but not limited to ribivirin, vidarabine, acyclovir and ganciclovir, may also be combined in compositions of the invention. Combinations of antisense compounds and other non-antisense drugs are also within the scope of this invention. Two or more combined compounds may be used together or sequentially.

In another related embodiment, compositions of the invention may contain one or more antisense compounds, particularly oligonucleotides, targeted to a first nucleic acid and one or more additional antisense compounds targeted to a second nucleic acid target. Alternatively, compositions of the invention may contain two or more antisense compounds targeted to different regions of the same nucleic acid target. Numerous examples of antisense compounds are known in the art. Two or more combined compounds may be used together or sequentially.

Cell Culture and Antisense Compounds Treatment

The effects of antisense compounds on the level, activity or expression of CD40 nucleic acids can be tested in vitro in a variety of cell types. Cell types used for such analyses are available from commercial vendors (e.g. American Type Culture Collection, Manassas, Va.; Zen-Bio, Inc., Research Triangle Park, N.C.; Clonetics Corporation, Walkersville, Md.) and cells are cultured according to the vendor's instructions using commercially available reagents (e.g. Invitrogen Life Technologies, Carlsbad, Calif.). Illustrative cell types include, but are not limited to, HepG2 cells, Hep3B cells, HuVEC cells, T24, A549, and primary hepatocytes.

In vitro Testing of Antisense Oligonucleotides

Described herein are methods for treatment of cells with antisense oligonucleotides, which can be modified appropriately for treatment with other antisense compounds.

In general, cells are treated with antisense oligonucleotides when the cells reach approximately 60-80% confluency in culture.

One reagent commonly used to introduce antisense oligonucleotides into cultured cells includes the cationic lipid transfection reagent LIPOFECTIN® (Invitrogen, Carlsbad, Calif.). Antisense oligonucleotides are mixed with LIPOFECTIN® in OPTI-MEM® 1 (Invitrogen, Carlsbad, Calif.) to achieve the desired final concentration of antisense oligonucleotide and a LIPOFECTIN® concentration that typically ranges 2 to 12 ug/mL per 100 nM antisense oligonucleotide.

Another reagent used to introduce antisense oligonucleotides into cultured cells includes LIPOFECTAMINE® (Invitrogen, Carlsbad, Calif.). Antisense oligonucleotide is mixed with LIPOFECTAMINE® in OPTI-MEM® 1 reduced serum medium (Invitrogen, Carlsbad, Calif.) to achieve the desired concentration of antisense oligonucleotide and a LIPOFECTAMINE® concentration that typically ranges 2 to 12 ug/mL per 100 nM antisense oligonucleotide.

Cells are treated with antisense oligonucleotides by routine methods. Cells are typically harvested 16-24 hours after antisense oligonucleotide treatment, at which time RNA or protein levels of target nucleic acids are measured by methods known in the art and described herein. In general, when treatments are performed in multiple replicates, the data are presented as the average of the replicate treatments.

The concentration of antisense oligonucleotide used varies from cell line to cell line. Methods to determine the optimal antisense oligonucleotide concentration for a particular cell line are well known in the art. Antisense oligonucleotides are typically used at concentrations ranging from 1 nM to 300 nM.

RNA Isolation

RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA. Methods of RNA isolation are well known in the art. RNA is prepared using methods well known in the art, for example, using the TRIZOL® Reagent (Invitrogen, Carlsbad, Calif.) according to the manufacturer's recommended protocols.

Analysis of Inhibition of Target Levels or Expression

Inhibition of levels or expression of a CD40 nucleic acid can be assayed in a variety of ways known in the art. For example, target nucleic acid levels can be quantitated by, e.g., Northern blot analysis, competitive polymerase chain reaction (PCR), or quantitative real-time PCR. RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA. Methods of RNA isolation are well known in the art. Northern blot analysis is also routine in the art. Quantitative real-time PCR can be conveniently accomplished using the commercially available ABI PRISM® 7600, 7700, or 7900 Sequence Detection System, available from PE-Applied Biosystems, Foster City, Calif. and used according to manufacturer's instructions.

Quantitative Real-Time PCR Analysis of Target RNA Levels

Quantitation of target RNA levels may be accomplished by quantitative real-time PCR using the ABI PRISM® 7600, 7700, or 7900 Sequence Detection System (PE-Applied Biosystems, Foster City, Calif.) according to manufacturer's instructions. Methods of quantitative real-time PCR are well known in the art.

Prior to real-time PCR, the isolated RNA is subjected to a reverse transcriptase (RT) reaction, which produces complementary DNA (cDNA) that is then used as the substrate for the real-time PCR amplification. The RT and real-time PCR reactions are performed sequentially in the same sample well. RT and real-time PCR reagents are obtained from Invitrogen (Carlsbad, Calif.). RT, real-time-PCR reactions are carried out by methods well known to those skilled in the art.

Gene (or RNA) target quantities obtained by real time PCR are normalized using either the expression level of a gene whose expression is constant, such as GAPDH or by quantifying total RNA using RIBOGREEN® (Invitrogen, Inc. Carlsbad, Calif.). GAPDH expression is quantified by real time PCR, by being run simultaneously with the target, multiplexing, or separately. Total RNA is quantified using RIBOGREEN® RNA quantification reagent (Invetrogen, Inc. Eugene, Oreg.). Methods of RNA quantification by RIBOGREEN® are taught in Jones, L. J., et al, (Analytical Biochemistry, 1998, 265, 368-374). A CYTOFLUOR® 4000 instrument (PE Applied Biosystems) is used to measure RIBOGREEN® fluorescence.

Probes and primers are designed to hybridize to a CD40 nucleic acid. Methods for designing real-time PCR probes and primers are well known in the art, and may include the use of software such as PRIMER EXPRESS® Software (Applied Biosystems, Foster City, Calif.).

Analysis of Protein Levels

Antisense inhibition of CD40 nucleic acids can be assessed by measuring CD40 protein levels. Protein levels of CD40 can be evaluated or quantitated in a variety of ways well known in the art, such as immunoprecipitation, Western blot analysis (immunoblotting), enzyme-linked immunosorbent assay (ELISA), quantitative protein assays, protein activity assays (for example, caspase activity assays), immunohistochemistry, immunocytochemistry or fluorescence-activated cell sorting (FACS). Antibodies directed to a target can be identified and obtained from a variety of sources, such as the MSRS catalog of antibodies (Aerie Corporation, Birmingham, Mich.), or can be prepared via conventional monoclonal or polyclonal antibody generation methods well known in the art. Antibodies useful for the detection of human and rat CD40 are commercially available.

In vivo Testing of Antisense Compounds

Antisense compounds, for example, antisense oligonucleotides, are tested in animals to assess their ability to inhibit expression of CD40 and produce phenotypic changes, such as changes in cell morphology over time or treatment dose as well as changes in levels of cellular components such as proteins, nucleic acids, hormones, cytokines, and eosinophils. Testing may be performed in normal animals, or in experimental disease models. For administration to animals, antisense oligonucleotides are formulated in a pharmaceutically acceptable diluent, such as phosphate-buffered saline. Administration includes pulmonary administration, aerosol administration, topical administration, and parenteral routes of administration, such as intraperitoneal, intravenous, and subcutaneous. Calculation of antisense oligonucleotide dosage and dosing frequency is within the abilities of those skilled in the art, and depends upon factors such as route of administration and animal body weight. Following a period of treatment with antisense oligonucleotides, RNA is isolated from liver tissue and changes in CD40 nucleic acid expression are measured.

Certain Indications

In certain embodiments, the invention provides methods of treating an individual comprising administering one or more pharmaceutical compositions of the present invention. In certain embodiments, the individual has an inflammatory or hyperproliferative disorder. In certain embodiments the invention provides methods for prophylactically reducing CD40 expression in an individual. Certain embodiments include treating an individual in need thereof by administering to an individual a therapeutically effective amount of an antisense compound targeted to a CD40 nucleic acid.

In one embodiment, administration of a therapeutically effective amount of an antisense compound targeted to a CD40 nucleic acid is accompanied by monitoring of eosinophils in an individual, to determine an individual's response to administration of the antisense compound. An individual's response to administration of the antisense compound is used by a physician to determine the amount and duration of therapeutic intervention.

In one embodiment, administration of an antisense compound targeted to a CD40 nucleic acid results in reduction of CD40 expression by at least 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 99%, or a range defined by any two of these values. In some embodiments, administration of a CD40 antisense compound increases the measure by at least 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 99%, or a range defined by any two of these values. In some embodiments, administration of a CD40 antisense compound decreases the measure by at least 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 99%, or a range defined by any two of these values.

In certain embodiments pharmaceutical composition comprising an antisense compound targeted to CD40 is used for the preparation of a medicament for treating a patient suffering or susceptible to an inflammatory condition or a hyperproliferative disorder.

The formulation of therapeutic compositions and their subsequent administration (dosing) is believed to be within the skill of those in the art. Dosing is dependent on severity and responsiveness of the disease state to be treated, with the course of treatment lasting from several days to several months, or until a cure is effected or a diminution of the disease state is achieved. Optimal dosing schedules can be calculated from measurements of drug accumulation in the body of the patient. Persons of ordinary skill can easily determine optimum dosages, dosing methodologies and repetition rates. Optimum dosages may vary depending on the relative potency of individual oligonucleotides, and can generally be estimated based on EC50s found to be effective in in vitro and in vivo animal models. In general, dosage is from 0.01 ug to 100 g per kg of body weight, and may be given once or more daily, weekly, monthly or yearly, or even once every 2 to 20 years. Persons of ordinary skill in the art can easily estimate repetition rates for dosing based on measured residence times and concentrations of the drug in bodily fluids or tissues. Following successful treatment, it may be desirable to have the patient undergo maintenance therapy to prevent the recurrence of the disease state, wherein the oligonucleotide is administered in maintenance doses, ranging from 0.01 ug to 100 g per kg of body weight, once or more daily, to once every 20 years.

Certain Combination Therapies

In certain embodiments, one or more pharmaceutical compositions of the present invention are co-administered with one or more other pharmaceutical agents. In certain embodiments, such one or more other pharmaceutical agents are designed to treat the same disease or condition as the one or more pharmaceutical compositions of the present invention. In certain embodiments, such one or more other pharmaceutical agents are designed to treat a different disease or condition as the one or more pharmaceutical compositions of the present invention. In certain embodiments, such one or more other pharmaceutical agents are designed to treat an undesired effect of one or more pharmaceutical compositions of the present invention. In certain embodiments, one or more pharmaceutical compositions of the present invention are co-administered with another pharmaceutical agent to treat an undesired effect of that other pharmaceutical agent. In certain embodiments, one or more pharmaceutical compositions of the present invention and one or more other pharmaceutical agents are administered at the same time. In certain embodiments, one or more pharmaceutical compositions of the present invention and one or more other pharmaceutical agents are administered at different times. In certain embodiments, one or more pharmaceutical compositions of the present invention and one or more other pharmaceutical agents are prepared together in a single formulation. In certain embodiments, one or more pharmaceutical compositions of the present invention and one or more other pharmaceutical agents are prepared separately.

In certain embodiments, pharmaceutical agents that may be co-administered with a pharmaceutical composition of the present invention include steroids and/or chemotherapeutic agents. In certain such embodiments, pharmaceutical agents that may be co-administered with a pharmaceutical composition of the present invention include, but are not limited to prednisone, corticosteroids, and paclitaxel. In certain such embodiments, the agent is administered prior to administration of a pharmaceutical composition of the present invention. In certain such embodiments, the agent is administered following administration of a pharmaceutical composition of the present invention. In certain such embodiments the agent is administered at the same time as a pharmaceutical composition of the present invention. In certain such embodiments the dose of a co-administered agent is the same as the dose that would be administered if the agent was administered alone. In certain such embodiments the dose of a co-administered agent is lower than the dose that would be administered if the agent was administered alone. In certain such embodiments the dose of a co-administered agent is greater than the dose that would be administered if the agent was administered alone.

In certain embodiments, the co-administration of a second compound enhances the effect of a first compound, such that co-administration of the compounds results in an effect that is greater than the effect of administering the first compound alone. In other embodiments, the co-administration results in effects that are additive of the effects of the compounds when administered alone. In other embodiments, the co-administration results in effects that are supra-additive of the effects of the compounds when administered alone. In some embodiments, the first compound is an antisense compound. In some embodiments, the second compound is an antisense compound.

Nonlimiting Disclosure and Incorporation by Reference

While certain compounds, compositions and methods described herein have been described with specificity in accordance with certain embodiments, the following examples serve only to illustrate the compounds described herein and are not intended to limit the same. Each of the references recited in the present application is incorporated herein by reference in its entirety.

Antisense oligonucleotides targeted to a CD40 nucleic acid were tested for their effects on CD40 mRNA in vitro. When cultured cells, grown in a 96-well plate, reached 80% confluency, they were treated with 150 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and CD40 mRNA levels were measured by quantitative real-time PCR, as described herein. CD40 mRNA levels were adjusted according to total RNA content as measured by normalization to RIBOGREEN®. Results are presented as percent inhibition of CD40, relative to untreated control cells in Table 1.

The antisense oligonucleotides were designed as 18-mers with phosphorothioate backbones (internucleoside linkages) throughout. “5′ target site” indicates the 5′-most nucleotide which the antisense oligonucleotide is targeted to SEQ ID NO: 1 (GENBANK® Accession No X60592.1). Data are averages from three experiments.

TABLE 1
Inhibition of human CD40 mRNA levels by fully phosphorothioate oligodeoxynucleotides
Target
SEQ Target Target SEQ
Oligo ID Start Stop Target % ID
ID NO Site Site Region Sequence (5′ to 3′) Inhibition NO
18623 1 18 35 5′ UTR CCAGGCGGCAGGACCACT 31 5
18624 1 20 37 5′ UTR GACCAGGCGGCAGGACCA 28 6
18625 1 26 43 5′ UTR AGGTGAGACCAGGCGGCA 22 7
18626 1 48 65 AUG CAGAGGCAGACGAACCAT 0 8
18627 1 49 66 Coding GCAGAGGCAGACGAACCA 0 9
18628 1 73 90 Coding GCAAGCAGCCCCAGAGGA 0 10
18629 1 78 95 Coding GGTCAGCAAGCAGCCCCA 30 11
18630 1 84 101 Coding GACAGCGGTCAGCAAGCA 0 12
18631 1 88 105 Coding GATGGACAGCGGTCAGCA 0 13
18632 1 92 109 Coding TCTGGATGGACAGCGGTC 0 14
18633 1 98 115 Coding GGTGGTTCTGGATGGACA 0 15
18634 1 101 118 Coding GTGGGTGGTTCTGGATGG 0 16
18635 1 104 121 Coding GCAGTGGGTGGTTCTGGA 0 17
18636 1 152 169 Coding CACAAAGAACAGCACTGA 0 18
18637 1 156 173 Coding CTGGCACAAAGAACAGCA 0 19
18638 1 162 179 Coding TCCTGGCTGGCACAAAGA 0 20
18639 1 165 182 Coding CTGTCCTGGCTGGCACAA 5 21
18640 1 176 193 Coding CTCACCAGTTTCTGTCCT 0 22
18641 1 179 196 Coding TCACTCACCAGTTTCTGT 0 23
18642 1 185 202 Coding GTGCAGTCACTCACCAGT 0 24
18643 1 190 207 Coding ACTCTGTGCAGTCACTCA 0 25
18644 1 196 213 Coding CAGTGAACTCTGTGCAGT 5 26
18645 1 205 222 Coding ATTCCGTTTCAGTGAACT 0 27
18646 1 211 228 Coding GAAGGCATTCCGTTTCAG 9 28
18647 1 222 239 Coding TTCACCGCAAGGAAGGCA 0 29
18648 1 250 267 Coding CTCTGTTCCAGGTGTCTA 0 30
18649 1 267 284 Coding CTGGTGGCAGTGTGTCTC 0 31
18650 1 286 303 Coding TGGGGTCGCAGTATTTGT 0 32
18651 1 289 306 Coding GGTTGGGGTCGCAGTATT 0 33
18652 1 292 309 Coding CTAGGTTGGGGTCGCAGT 0 34
18653 1 318 335 Coding GGTGCCCTTCTGCTGGAC 20 35
18654 1 322 339 Coding CTGAGGTGCCCTTCTGCT 16 36
18655 1 332 349 Coding GTGTCTGTTTCTGAGGTG 0 37
18656 1 334 351 Coding TGGTGTCTGTTTCTGAGG 0 38
18657 1 345 362 Coding ACAGGTGCAGATGGTGTC 0 39
18658 1 348 365 Coding TTCACAGGTGCAGATGGT 0 40
18659 1 360 377 Coding GTGCCAGCCTTCTTCACA 6 41
18660 1 364 381 Coding TACAGTGCCAGCCTTCTT 8 42
18661 1 391 408 Coding GGACACAGCTCTCACAGG 0 43
18662 1 395 412 Coding TGCAGGACACAGCTCTCA 0 44
18663 1 401 418 Coding GAGCGGTGCAGGACACAG 0 45
18664 1 416 433 Coding AAGCCGGGCGAGCATGAG 0 46
18665 1 432 449 Coding AATCTGCTTGACCCCAAA 6 47
18666 1 446 463 Coding GAAACCCCTGTAGCAATC 0 48
18667 1 452 469 Coding GTATCAGAAACCCCTGTA 0 49
18668 1 463 480 Coding GCTCGCAGATGGTATCAG 0 50
18669 1 468 485 Coding GCAGGGCTCGCAGATGGT 34 51
18670 1 471 488 Coding TGGGCAGGGCTCGCAGAT 0 52
18671 1 474 491 Coding GACTGGGCAGGGCTCGCA 3 53
18672 1 490 507 Coding CATTGGAGAAGAAGCCGA 0 54
18673 1 497 514 Coding GATGACACATTGGAGAAG 0 55
18674 1 500 517 Coding GCAGATGACACATTGGAG 0 56
18675 1 506 523 Coding TCGAAAGCAGATGACACA 0 57
18676 1 524 541 Coding GTCCAAGGGTGACATTTT 8 58
18677 1 532 549 Coding CACAGCTTGTCCAAGGGT 0 59
18678 1 539 556 Coding TTGGTCTCACAGCTTGTC 0 60
18679 1 546 563 Coding CAGGTCTTTGGTCTCACA 7 61
18680 1 558 575 Coding CTGTTGCACAACCAGGTC 19 62
18681 1 570 587 Coding GTTTGTGCCTGCCTGTTG 2 63
18682 1 575 592 Coding GTCTTGTTTGTGCCTGCC 0 64
18683 1 590 607 Coding CCACAGACAACATCAGTC 0 65
18684 1 597 614 Coding CTGGGGACCACAGACAAC 0 66
18685 1 607 624 Coding TCAGCCGATCCTGGGGAC 0 67
18686 1 621 638 Coding CACCACCAGGGCTCTCAG 23 68
18687 1 626 643 Coding GGGATCACCACCAGGGCT 0 69
18688 1 657 674 Coding GAGGATGGCAAACAGGAT 0 70
18689 1 668 685 Coding ACCAGCACCAAGAGGATG 0 71
18690 1 679 696 Coding TTTTGATAAAGACCAGCA 0 72
18691 1 703 720 Coding TATTGGTTGGCTTCTTGG 0 73
18692 1 729 746 Coding GGGTTCCTGCTTGGGGTG 0 74
18693 1 750 767 Coding GTCGGGAAAATTGATCTC 0 75
18694 1 754 771 Coding GATCGTCGGGAAAATTGA 0 76
18695 1 765 782 Coding GGAGCCAGGAAGATCGTC 0 77
18696 1 766 783 Coding TGGAGCCAGGAAGATCGT 0 78
18697 1 780 797 Coding TGGAGCAGCAGTGTTGGA 0 79
18698 1 796 813 Coding GTAAAGTCTCCTGCACTG 0 80
18699 1 806 823 Coding TGGCATCCATGTAAAGTC 0 81
18700 1 810 827 Coding CGGTTGGCATCCATGTAA 0 82
18701 1 834 851 Coding CTCTTTGCCATCCTCCTG 4 83
18702 1 861 878 Coding CTGTCTCTCCTGCACTGA 0 84
18703 1 873 890 Stop GGTGCAGCCTCACTGTCT 0 85
18704 1 910 927 3′ UTR AACTGCCTGTTTGCCCAC 34 86
18705 1 954 971 3′ UTR CTTCTGCCTGCACCCCTG 0 87
18706 1 976 993 3′ UTR ACTGACTGGGCATAGCTC 0 88

Antisense oligonucleotides targeted to a CD40 nucleic acid were tested for their effects on CD40 mRNA in vitro. T24 cells at a density of 7000 cells per well in a 96-well plate were treated with 150 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and CD40 mRNA levels were measured by quantitative real-time PCR, as described herein. CD40 mRNA levels were adjusted according to GAPDH content, a housekeeping gene. Results are presented as percent inhibition of CD40, relative to untreated control cells in Table 2.

The antisense oligonucleotides were designed as 4-10-4 gapmers, where the gap segment comprises 2′-deoxynucleotides and each wing segment comprises 2′-MOE nucleotides and 5-methylcytosine substitutions. The antisense oligonucleotides comprise phosphorothioate backbones (internucleoside linkages) throughout. “5′ target site” indicates the 5′-most nucleotide which the antisense oligonucleotide is targeted to SEQ ID NO: 1 (GENBANK® Accession No X60592.1). Data are averages from three experiments. “ND” indicates a value was not determined.

TABLE 2
Inhibition of human CD40 mRNA levels by chimeric oligonucleotides having
4-10-4 MOE wings and deoxy gap
Target
SEQ Target Target SEQ
ID Start Stop Target % ID
OligoID NO Site Site Region Sequence (5′ to 3′) Inhibition NO
19211 1 18 35 5′ UTR CCAGGCGGCAGGACCACT 76 5
19212 1 20 37 5′ UTR GACCAGGCGGCAGGACCA 77 6
19213 1 26 43 5′ UTR AGGTGAGACCAGGCGGCA 81 7
19214 1 48 65 AUG CAGAGGCAGACGAACCAT 24 8
19215 1 49 66 Coding GCAGAGGCAGACGAACCA 46 9
19216 1 73 90 Coding GCAAGCAGCCCCAGAGGA 66 10
19217 1 78 95 Coding GGTCAGCAAGCAGCCCCA 75 11
19218 1 84 101 Coding GACAGCGGTCAGCAAGCA 67 12
19219 1 88 105 Coding GATGGACAGCGGTCAGCA 65 13
19220 1 92 109 Coding TCTGGATGGACAGCGGTC 79 14
19221 1 98 115 Coding GGTGGTTCTGGATGGACA 81 15
19222 1 101 118 Coding GTGGGTGGTTCTGGATGG 58 16
19223 1 104 121 Coding GCAGTGGGTGGTTCTGGA 74 17
19224 1 152 169 Coding CACAAAGAACAGCACTGA 40 18
19225 1 156 173 Coding CTGGCACAAAGAACAGCA 60 19
19226 1 162 179 Coding TCCTGGCTGGCACAAAGA 10 20
19227 1 165 182 Coding CTGTCCTGGCTGGCACAA 24 21
19228 1 176 193 Coding CTCACCAGTTTCTGTCCT 22 22
19229 1 179 196 Coding TCACTCACCAGTTTCTGT 41 23
19230 1 185 202 Coding GTGCAGTCACTCACCAGT 82 24
19231 1 190 207 Coding ACTCTGTGCAGTCACTCA 38 25
19232 1 196 213 Coding CAGTGAACTCTGTGCAGT 40 26
19233 1 205 222 Coding ATTCCGTTTCAGTGAACT 56 27
19234 1 211 228 Coding GAAGGCATTCCGTTTCAG 32 28
19235 1 222 239 Coding TTCACCGCAAGGAAGGCA 61 29
19236 1 250 267 Coding CTCTGTTCCAGGTGTCTA 62 30
19237 1 267 284 Coding CTGGTGGCAGTGTGTCTC 70 31
19238 1 286 303 Coding TGGGGTCGCAGTATTTGT 0 32
19239 1 289 306 Coding GGTTGGGGTCGCAGTATT 19 33
19240 1 292 309 Coding CTAGGTTGGGGTCGCAGT 36 34
19241 1 318 335 Coding GGTGCCCTTCTGCTGGAC 79 35
19242 1 322 339 Coding CTGAGGTGCCCTTCTGCT 70 36
19243 1 332 349 Coding GTGTCTGTTTCTGAGGTG 63 37
19244 1 334 351 Coding TGGTGTCTGTTTCTGAGG 43 38
19245 1 345 362 Coding ACAGGTGCAGATGGTGTC 73 39
19246 1 348 365 Coding TTCACAGGTGCAGATGGT 48 40
19247 1 360 377 Coding GTGCCAGCCTTCTTCACA 61 41
19248 1 364 381 Coding TACAGTGCCAGCCTTCTT 47 42
19249 1 391 408 Coding GGACACAGCTCTCACAGG 0 43
19250 1 395 412 Coding TGCAGGACACAGCTCTCA 52 44
19251 1 401 418 Coding GAGCGGTGCAGGACACAG 50 45
19252 1 416 433 Coding AAGCCGGGCGAGCATGAG 32 46
19253 1 432 449 Coding AATCTGCTTGACCCCAAA 0 47
19254 1 446 463 Coding GAAACCCCTGTAGCAATC 0 48
19255 1 452 469 Coding GTATCAGAAACCCCTGTA 36 49
19256 1 463 480 Coding GCTCGCAGATGGTATCAG 65 50
19257 1 468 485 Coding GCAGGGCTCGCAGATGGT 75 51
19258 1 471 488 Coding TGGGCAGGGCTCGCAGAT 0 52
19259 1 474 491 Coding GACTGGGCAGGGCTCGCA 82 53
19260 1 490 507 Coding CATTGGAGAAGAAGCCGA 41 54
19261 1 497 514 Coding GATGACACATTGGAGAAG 14 55
19262 1 500 517 Coding GCAGATGACACATTGGAG 78 56
19263 1 506 523 Coding TCGAAAGCAGATGACACA 59 57
19264 1 524 541 Coding GTCCAAGGGTGACATTTT 71 58
19265 1 532 549 Coding CACAGCTTGTCCAAGGGT 0 59
19266 1 539 556 Coding TTGGTCTCACAGCTTGTC 46 60
19267 1 546 563 Coding CAGGTCTTTGGTCTCACA 64 61
19268 1 558 575 Coding CTGTTGCACAACCAGGTC 82 62
19269 1 570 587 Coding GTTTGTGCCTGCCTGTTG 70 63
19270 1 575 592 Coding GTCTTGTTTGTGCCTGCC 69 64
19271 1 590 607 Coding CCACAGACAACATCAGTC 11 65
19272 1 597 614 Coding CTGGGGACCACAGACAAC 9 66
19273 1 607 624 Coding TCAGCCGATCCTGGGGAC 0 67
19274 1 621 638 Coding CACCACCAGGGCTCTCAG 23 68
19275 1 626 643 Coding GGGATCACCACCAGGGCT 58 69
19276 1 657 674 Coding GAGGATGGCAAACAGGAT 49 70
19277 1 668 685 Coding ACCAGCACCAAGAGGATG ND 71
19278 1 679 696 Coding TTTTGATAAAGACCAGCA 31 72
19279 1 703 720 Coding TATTGGTTGGCTTCTTGG 49 73
19280 1 729 746 Coding GGGTTCCTGCTTGGGGTG 14 74
19281 1 750 767 Coding GTCGGGAAAATTGATCTC 55 75
19282 1 754 771 Coding GATCGTCGGGAAAATTGA 0 76
19283 1 765 782 Coding GGAGCCAGGAAGATCGTC 69 77
19284 1 766 783 Coding TGGAGCCAGGAAGATCGT 54 78
19285 1 780 797 Coding TGGAGCAGCAGTGTTGGA 15 79
19286 1 796 813 Coding GTAAAGTCTCCTGCACTG 31 80
19287 1 806 823 Coding TGGCATCCATGTAAAGTC 65 81
19288 1 810 827 Coding CGGTTGGCATCCATGTAA 34 82
19289 1 834 851 Coding CTCTTTGCCATCCTCCTG 42 83
19290 1 861 878 Coding CTGTCTCTCCTGCACTGA 26 84
19291 1 873 890 Stop GGTGCAGCCTCACTGTCT 76 85
19292 1 910 927 3′ UTR AACTGCCTGTTTGCCCAC 63 86
19293 1 954 971 3′ UTR CTTCTGCCTGCACCCCTG 0 87
19294 1 976 993 3′ UTR ACTGACTGGGCATAGCTC 12 88

Antisense oligonucleotides targeted to a CD40 nucleic acid were tested for their effects on CD40 mRNA in vitro. T24 cells at a density of 7000 cells per well in a 96-well plate were treated with 100 nM of antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and CD40 mRNA levels were measured by quantitative real-time PCR, as described herein. CD40 mRNA levels were adjusted according to GAPDH content, a housekeeping gene. Results are presented as percent inhibition of CD40, relative to untreated control cells in Table 3.

The antisense oligonucleotides were designed as 4-10-4 gapmers, where the gap segment comprises 2′-deoxynucleotides and each wing segment comprises 2′-MOE nucleotides. The antisense oligonucleotides comprise phosphorothioate backbones (internucleoside linkages) and 5-methylcytosine substitutions throughout. “5′ target site” indicates the 5′-most nucleotide which the antisense oligonucleotide is targeted to SEQ ID NO: 1 (GENBANK Accession No. X60592.1), SEQ ID NO: 2 (GENBANK® Accession No. H50598.1), and SEQ ID NO: 3 (GENBANK® Accession No. AA203290.1).

TABLE 3
Inhibition of human CD40 mRNA levels by chimeric oligonucleotides having
4-10-4 MOE wings and deoxy gap
Target
SEQ Target Target SEQ
Oligo ID Start Stop % ID
ID NO Site Site Sequence (5′ to 3′) Inhibition NO
26162 1 66 83 GCCCCAGAGGACGCACTG 0 89
26163 1 70 87 AGCAGCCCCAGAGGACGC 98 90
26164 1 74 91 AGCAAGCAGCCCCAGAGG 47 91
26165 1 80 97 GCGGTCAGCAAGCAGCCC 54 92
26167 1 95 112 GGTTCTGGATGGACAGCG 66 93
26168 1 102 119 AGTGGGTGGTTCTGGATG 26 94
26169 1 141 158 GCACTGACTGTTTATTAG 43 95
26170 1 154 171 GGCACAAAGAACAGCACT 53 96
26171 1 164 181 TGTCCTGGCTGGCACAAA 29 97
26172 1 171 188 CAGTTTCTGTCCTGGCTG 48 98
26173 1 180 197 GTCACTCACCAGTTTCTG 47 99
26174 1 210 227 AAGGCATTCCGTTTCAGT 57 100
26175 1 224 241 CTTTCACCGCAAGGAAGG 34 101
26176 1 250 267 CTCTGTTCCAGGTGTCTA 78 30
26177 1 257 274 TGTGTCTCTCTGTTCCAG 57 102
26178 1 264 281 GTGGCAGTGTGTCTCTCT 0 103
26179 1 314 331 CCCTTCTGCTGGACCCGA 58 104
26180 1 321 338 TGAGGTGCCCTTCTGCTG 69 105
26181 1 329 346 TCTGTTTCTGAGGTGCCC 44 106
26182 1 336 353 GATGGTGTCTGTTTCTGA 12 107
26183 1 364 381 TACAGTGCCAGCCTTCTT 14 42
26184 1 445 462 AAACCCCTGTAGCAATCT 15 108
26185 1 460 477 CGCAGATGGTATCAGAAA 53 109
26186 1 469 486 GGCAGGGCTCGCAGATGG 79 110
26202 1 485 502 GAGAAGAAGCCGACTGGG 0 111
26187 1 487 504 TGGAGAAGAAGCCGACTG 23 112
26204 1 489 506 ATTGGAGAAGAAGCCGAC 0 113
26205 1 491 508 ACATTGGAGAAGAAGCCG 4 114
26206 1 493 510 ACACATTGGAGAAGAAGC 0 115
26207 1 495 512 TGACACATTGGAGAAGAA 46 116
26188 1 496 513 ATGACACATTGGAGAAGA 0 117
26208 1 497 514 GATGACACATTGGAGAAG 0 55
26189 1 503 520 AAAGCAGATGACACATTG 6 118
26209 1 524 541 GTCCAAGGGTGACATTTT 53 58
26210 1 545 562 AGGTCTTTGGTCTCACAG 81 119
26211 1 555 572 TTGCACAACCAGGTCTTT 48 120
26212 1 570 587 GTTTGTGCCTGCCTGTTG 76 63
26213 1 572 589 TTGTTTGTGCCTGCCTGT 50 121
26214 1 574 591 TCTTGTTTGTGCCTGCCT 87 122
26215 1 576 593 AGTCTTGTTTGTGCCTGC 83 123
26216 1 577 594 CAGTCTTGTTTGTGCCTG 80 124
26217 1 578 595 TCAGTCTTGTTTGTGCCT 88 125
26218 1 580 597 CATCAGTCTTGTTTGTGC 52 126
26219 1 590 607 CCACAGACAACATCAGTC 16 65
26220 1 592 609 GACCACAGACAACATCAG 11 127
26221 1 594 611 GGGACCACAGACAACATC 40 128
26222 1 622 639 TCACCACCAGGGCTCTCA 37 129
26223 1 624 641 GATCACCACCAGGGCTCT 82 130
26224 1 658 675 AGAGGATGGCAAACAGGA 33 131
26225 1 659 676 AAGAGGATGGCAAACAGG 0 132
26226 1 660 677 CAAGAGGATGGCAAACAG 0 133
26227 1 669 686 GACCAGCACCAAGAGGAT 57 134
26228 1 671 688 AAGACCAGCACCAAGAGG 35 135
26229 1 673 690 TAAAGACCAGCACCAAGA 13 136
26230 1 676 693 TGATAAAGACCAGCACCA 0 137
26231 1 678 695 TTTGATAAAGACCAGCAC 26 138
26232 2 375 392 ACTCTCTTTGCCCATCCT 0 139
26233 2 377 394 CGACTCTCTTTGCCCATC 31 140
26234 2 380 397 ATGCGACTCTCTTTGCCC 12 141
26235 2 382 399 AAATGCGACTCTCTTTGC 36 142
26236 2 385 402 CTGAAATGCGACTCTCTT 51 143
26237 2 387 404 AACTGAAATGCGACTCTC 0 144
26238 2 406 423 CTTCACTGTCTCTCCCTG 0 145
26239 2 407 424 CCTTCACTGTCTCTCCCT 56 146
26240 2 409 426 AACCTTCACTGTCTCTCC 0 147
26190 3 520 537 GATCACCACAGGCTCTCA 0 148
26191 3 565 582 TGATAAGACAGCACCAAG 9 149
26192 3 584 601 GGTAGTTCTTGCCACTTT 0 150
26193 3 593 610 GGGCCTATGGGTAGTTCT 0 151
26194 3 617 634 ATTATCTCTGGGTCTGCT 9 152
26195 3 646 663 ACTGACACATTTGAGCAG 0 153
26196 3 654 671 GACTCCCTACTGACACAT 0 154
26197 3 689 706 CAAAGAGCGGTTCTCCAC 0 155
26198 3 696 713 AATTCTCCAAAGAGCGGT 0 156
26199 3 728 745 TCTTGACATCCTTTTCAT 0 157
26200 3 736 753 CCCACCTATCTTGACATC 0 158
26201 3 791 808 AGGCCGAGAGTTCAAAAT 0 159

Antisense oligonucleotides targeted to a CD40 nucleic acid were tested for their effects on CD40 mRNA in vitro. A549 cells at a density of 5000 cells per well in a 96-well plate were treated with 120 nM of antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and CD40 mRNA levels were measured by quantitative real-time PCR, as described herein. CD40 primer probe set LTS37 was used to measure mRNA levels. CD40 mRNA levels were adjusted according to total RNA content as measured by RIBOGREEN®. Results are presented as percent inhibition of CD40, relative to untreated control cells in Table 4.

The antisense oligonucleotides were designed as 4-10-4 gapmers, 5-10-5 gapmers, or 2-15-3 gapmers, where the gap segment comprises 2′-deoxynucleotides and each wing segment comprises 2′-MOE nucleotides. The motif for each compound is indicated by the column labeled “motif.” The antisense oligonucleotides comprise phosphorothioate backbones (internucleoside linkages) and 5-methylcytosine substitutions throughout. “5′ target site” indicates the 5′-most nucleotide which the antisense oligonucleotide is targeted to SEQ ID NO: 1 (GENBANK Accession No. X60592.1) or SEQ ID NO: 4 (nucleotides 9797000 to 9813000 of GENBANK Accession No. NT_011362.9).

TABLE 4
Inhibition of human CD40 mRNA levels by chimeric oligonucleotides having
4-10-4 MOE wings and deoxy gap, 5-10-5 MOE wings and deoxy gap, and
2-15-3 MOE wings and deoxy gap
Target Target Target
Oligo SEQ ID Start Stop % SEQ ID
ID NO Motif Site Site Sequence (5′ to 3′) Inhibition NO
26163 4 4-10-4 2914 2931 AGCAGCCCCAGAGGACGC 74 90
396243 4 5-10-5 2728 2747 CCAGCAATTCACCGCGCAGG 0 160
396320 4 2-15-3 2728 2747 CCAGCAATTCACCGCGCAGG 0 160
396199 4 5-10-5 2892 2911 TGCAGAGGCAGACGAACCAT 75 161
396276 4 2-15-3 2892 2911 TGCAGAGGCAGACGAACCAT 55 161
396200 4 5-10-5 2904 2923 CAGAGGACGCACTGCAGAGG 79 162
396277 4 2-15-3 2904 2923 CAGAGGACGCACTGCAGAGG 69 162
396201 4 5-10-5 2913 2932 AAGCAGCCCCAGAGGACGCA 76 163
396278 4 2-15-3 2913 2932 AAGCAGCCCCAGAGGACGCA 78 163
396202 4 5-10-5 2924 2943 CAGCGGTCAGCAAGCAGCCC 68 164
396279 4 2-15-3 2924 2943 CAGCGGTCAGCAAGCAGCCC 88 164
396244 4 5-10-5 2928 2947 CTCACAGCGGTCAGCAAGCA 86 165
396321 4 2-15-3 2928 2947 CTCACAGCGGTCAGCAAGCA 75 165
396245 4 5-10-5 3349 3368 GCTGGCAAGGAGATGATAAC 51 166
396322 4 2-15-3 3349 3368 GCTGGCAAGGAGATGATAAC 54 166
396246 4 5-10-5 3480 3499 AGGTTGGAACACCCAAGATA 69 167
396323 4 2-15-3 3480 3499 AGGTTGGAACACCCAAGATA 78 167
396247 4 5-10-5 3649 3668 GGAGAAACCCCTGGTTTCTC 45 168
396324 4 2-15-3 3649 3668 GGAGAAACCCCTGGTTTCTC 26 168
396248 4 5-10-5 3860 3879 TCATTCCTGCCCAGGCTTCA 43 169
396325 4 2-15-3 3860 3879 TCATTCCTGCCCAGGCTTCA 39 169
396249 4 5-10-5 3950 3969 TCAGGTGAAAGTGAAAGCTG 68 170
396326 4 2-15-3 3950 3969 TCAGGTGAAAGTGAAAGCTG 69 170
396250 4 5-10-5 4490 4509 TACCATCTTCAAACACATGA 79 171
396327 4 2-15-3 4490 4509 TACCATCTTCAAACACATGA 71 171
396251 4 5-10-5 4604 4623 TTACCCAAAATGGGAAAGGA 86 172
396328 4 2-15-3 4604 4623 TTACCCAAAATGGGAAAGGA 48 172
396252 4 5-10-5 4810 4829 GAAAGAATACATGTATATGG 72 173
396329 4 2-15-3 4810 4829 GAAAGAATACATGTATATGG 10 173
396253 4 5-10-5 4944 4963 AGAGTCAGACAGCTTTAGAC 78 174
396330 4 2-15-3 4944 4963 AGAGTCAGACAGCTTTAGAC 79 174
396254 4 5-10-5 5651 5670 GTACCACCCATGCTATTAAT 79 175
396331 4 2-15-3 5651 5670 GTACCACCCATGCTATTAAT 84 175
396255 4 5-10-5 5740 5759 ACAGTGACAGAGTCCAAATG 85 176
396332 4 2-15-3 5740 5759 ACAGTGACAGAGTCCAAATG 75 176
396256 4 5-10-5 5830 5849 AATGTAAAGCTGGAAGGGTA 52 177
396333 4 2-15-3 5830 5849 AATGTAAAGCTGGAAGGGTA 37 177
396257 4 5-10-5 5964 5983 GGGCTATGTTTAGCACTTGG 79 178
396334 4 2-15-3 5964 5983 GGGCTATGTTTAGCACTTGG 73 178
396258 4 5-10-5 6078 6097 GGGCTTGATGCCTGAGTCAT 73 179
396335 4 2-15-3 6078 6097 GGGCTTGATGCCTGAGTCAT 40 179
396259 4 5-10-5 6251 6270 TGAAGTGCAAGTCAAAACAG 52 180
396336 4 2-15-3 6251 6270 TGAAGTGCAAGTCAAAACAG 44 180
396260 4 5-10-5 6332 6351 GCAATTTGAAGGGATCTTGA 68 181
396337 4 2-15-3 6332 6351 GCAATTTGAAGGGATCTTGA 42 181
396203 4 5-10-5 6374 6393 CATGCAGTGGGTGGTTCTGG 77 182
396280 4 2-15-3 6374 6393 CATGCAGTGGGTGGTTCTGG 83 182
396204 4 5-10-5 6385 6404 GTTTTTCTCTGCATGCAGTG 78 183
396281 4 2-15-3 6385 6404 GTTTTTCTCTGCATGCAGTG 70 183
396205 4 5-10-5 6424 6443 GCTGGCACAAAGAACAGCAC 61 184
396282 4 2-15-3 6424 6443 GCTGGCACAAAGAACAGCAC 65 184
396261 4 5-10-5 6709 6728 CACTAACCACACAATGATCA 85 185
396338 4 2-15-3 6709 6728 CACTAACCACACAATGATCA 62 185
396206 4 5-10-5 6787 6806 TGTGCAGTCACTCACCAGTT 83 186
396283 4 2-15-3 6787 6806 TGTGCAGTCACTCACCAGTT 72 186
396207 4 5-10-5 6838 6857 GTCTAGGAATTCGCTTTCAC 95 187
396284 4 2-15-3 6838 6857 GTCTAGGAATTCGCTTTCAC 85 187
396208 4 5-10-5 6843 6862 CAGGTGTCTAGGAATTCGCT 98 188
396285 4 2-15-3 6843 6862 CAGGTGTCTAGGAATTCGCT 90 188
396209 4 5-10-5 6883 6902 GTCGCAGTATTTGTGCTGGT 84 189
396286 4 2-15-3 6883 6902 GTCGCAGTATTTGTGCTGGT 86 189
396262 4 5-10-5 7154 7173 ACCCGAAGCCCTAGGTCTGA 92 190
396339 4 2-15-3 7154 7173 ACCCGAAGCCCTAGGTCTGA 84 190
396210 4 5-10-5 7158 7177 CTGGACCCGAAGCCCTAGGT 82 191
396287 4 2-15-3 7158 7177 CTGGACCCGAAGCCCTAGGT 90 191
396211 4 5-10-5 7163 7182 TTCTGCTGGACCCGAAGCCC 65 192
396288 4 2-15-3 7163 7182 TTCTGCTGGACCCGAAGCCC 80 192
396212 4 5-10-5 7204 7223 CTTCTTCACAGGTGCAGATG 79 193
396289 4 2-15-3 7204 7223 CTTCTTCACAGGTGCAGATG 72 193
396263 4 5-10-5 7590 7609 AGCCAGTGGCCAGGCAGGAC 70 194
396340 4 2-15-3 7590 7609 AGCCAGTGGCCAGGCAGGAC 56 194
396214 4 5-10-5 7704 7723 GAAGAAGCCGACTGGGCAGG 76 195
396291 4 2-15-3 7704 7723 GAAGAAGCCGACTGGGCAGG 80 195
396215 4 5-10-5 7709 7728 TTGGAGAAGAAGCCGACTGG 77 196
396292 4 2-15-3 7709 7728 TTGGAGAAGAAGCCGACTGG 80 196
396216 4 5-10-5 7718 7737 GATGACACATTGGAGAAGAA 76 197
396293 4 2-15-3 7718 7737 GATGACACATTGGAGAAGAA 65 197
396264 4 5-10-5 7953 7972 TGTCTATTACCTCAAAGAGA 89 198
396341 4 2-15-3 7953 7972 TGTCTATTACCTCAAAGAGA 72 198
396265 4 5-10-5 8492 8511 ACAGTGTGTTCAGAGGATTG 82 199
396342 4 2-15-3 8492 8511 ACAGTGTGTTCAGAGGATTG 67 199
396266 4 5-10-5 9755 9774 ACAATACACTTTACATGTTT 90 200
396343 4 2-15-3 9755 9774 ACAATACACTTTACATGTTT 63 200
396267 4 5-10-5 10414 10433  ATTGTGTCTTTAGAACCAGA 84 201
396344 4 2-15-3 10414 10433  ATTGTGTCTTTAGAACCAGA 59 201
396268 4 5-10-5 10528 10547  GGGCCCTAAAGGATGTAAAA 34 202
396345 4 2-15-3 10528 10547  GGGCCCTAAAGGATGTAAAA 76 202
396217 4 5-10-5 11218 11237  CAGTCTTGTTTGTGCCTGCC 70 203
396294 4 2-15-3 11218 11237  CAGTCTTGTTTGTGCCTGCC 79 203
396269 4 5-10-5 11244 11263  TGTCCAGGACTCACCACAGA 77 204
396346 4 2-15-3 11244 11263  TGTCCAGGACTCACCACAGA 83 204
396270 4 5-10-5 11801 11820  TATGGCACCTTCTTAAATAT 85 205
396347 4 2-15-3 11801 11820  TATGGCACCTTCTTAAATAT 81 205
396271 4 5-10-5 12248 12267  TGCTTTTGGTATAGAAGAGT 86 206
396348 4 2-15-3 12248 12267  TGCTTTTGGTATAGAAGAGT 76 206
396235 4 5-10-5 12526 12545 AAATGTGGCTGGCAGATGTC 79 207
396312 4 2-15-3 12526 12545 AAATGTGGCTGGCAGATGTC 82 207
396236 4 5-10-5 12572 12591 GTCAGAGCTCATCTACATCA 87 208
396313 4 2-15-3 12572 12591 GTCAGAGCTCATCTACATCA 82 208
396237 4 5-10-5 12754 12773 CTGATAAAGACCAGCACCAA 69 209
396314 4 2-15-3 12754 12773 CTGATAAAGACCAGCACCAA 70 209
396238 4 5-10-5 12762 12781 AGGACTCACTGATAAAGACC 69 210
396315 4 2-15-3 12762 12781 AGGACTCACTGATAAAGACC 43 210
396239 4 5-10-5 12982 13001 CAGACTCTGAATCAGTTTTA 78 211
396316 4 2-15-3 12982 13001 CAGACTCTGAATCAGTTTTA 70 211
396240 4 5-10-5 13021 13040 CAGTCCCCAATTCTGCTGCC 43 212
396317 4 2-15-3 13021 13040 CAGTCCCCAATTCTGCTGCC 70 212
396241 4 5-10-5 13107 13126 CCAGTGTTAGGCTCTGCCAG 76 213
396318 4 2-15-3 13107 13126 CCAGTGTTAGGCTCTGCCAG 85 213
396242 4 5-10-5 13134 13153 GAATGCCAGGAAAGGAGTGA 69 214
396319 4 2-15-3 13134 13153 GAATGCCAGGAAAGGAGTGA 84 214
396272 4 5-10-5 13171 13190 CAGCCCCAAGGCCCAAAGAT 48 215
396349 4 2-15-3 13171 13190 CAGCCCCAAGGCCCAAAGAT 57 215
396220 4 5-10-5 13491 13510 CTGCACTGGAGCAGCAGTGT 81 216
396297 4 2-15-3 13491 13510 CTGCACTGGAGCAGCAGTGT 74 216
396221 4 5-10-5 13517 13536 ACCGGTTGGCATCCATGTAA 61 217
396298 4 2-15-3 13517 13536 ACCGGTTGGCATCCATGTAA 73 217
396222 4 5-10-5 13525 13544 CCTGGGTGACCGGTTGGCAT 71 218
396299 4 2-15-3 13525 13544 CCTGGGTGACCGGTTGGCAT 82 218
396223 4 5-10-5 13802 13821 CAAGTTGGGAGACTGGATGG 65 219
396300 4 2-15-3 13802 13821 CAAGTTGGGAGACTGGATGG 79 219
396224 4 5-10-5 13810 13829 CTTTAATACAAGTTGGGAGA 68 220
396301 4 2-15-3 13810 13829 CTTTAATACAAGTTGGGAGA 64 220
396225 4 5-10-5 13877 13896 TCGGAAGGTCTGGTGGATAT 65 221
396302 4 2-15-3 13877 13896 TCGGAAGGTCTGGTGGATAT 83 221
396226 4 5-10-5 13896 13915 TGGGCACCAAACTGCTGGAT 70 222
396303 4 2-15-3 13896 13915 TGGGCACCAAACTGCTGGAT 76 222
396227 4 5-10-5 13937 13956 TATGGCTTCCTGGGCGCAGG 59 223
396304 4 2-15-3 13937 13956 TATGGCTTCCTGGGCGCAGG 74 223
396228 4 5-10-5 13961 13980 AATGCTGCAATGGGCATCTG 78 224
396305 4 2-15-3 13961 13980 AATGCTGCAATGGGCATCTG 83 224
396229 4 5-10-5 13977 13996 GTTCACTATCACAAACAATG 84 225
396306 4 2-15-3 13977 13996 GTTCACTATCACAAACAATG 67 225
396230 4 5-10-5 13997 14016 CAGTTAAGCAGCTTCCAGTT 84 226
396307 4 2-15-3 13997 14016 CAGTTAAGCAGCTTCCAGTT 85 226
396231 4 5-10-5 14028 14047 AATTTTATTTAGCCAGTCTC 80 227
396308 4 2-15-3 14028 14047 AATTTTATTTAGCCAGTCTC 79 227
396232 4 5-10-5 14046 14065 GTTGTATAAATATATTCTAA 44 228
396309 4 2-15-3 14046 14065 GTTGTATAAATATATTCTAA 25 228
396233 4 5-10-5 14065 14084 ACAGTGTTTTTGAGATTCTG 83 229
396310 4 2-15-3 14065 14084 ACAGTGTTTTTGAGATTCTG 50 229
396273 4 5-10-5 14725 14744 CTCAGGACCCAGAGTGAGGA 37 230
396350 4 2-15-3 14725 14744 CTCAGGACCCAGAGTGAGGA 50 230
396274 4 5-10-5 15073 15092 TGGGTTAAACCTCACCTCGA 59 231
396351 4 2-15-3 15073 15092 TGGGTTAAACCTCACCTCGA 56 231
396275 4 5-10-5 15350 15369 ATTAGGTCCCAAAGTTCCCC 23 232
396352 4 2-15-3 15350 15369 ATTAGGTCCCAAAGTTCCCC 48 232
396234 1 5-10-5 42 61 GGCAGACGAACCATGGCGAG 86 233
396311 1 2-15-3 42 61 GGCAGACGAACCATGGCGAG 82 233
396213 1 5-10-5 435 454 GTAGCAATCTGCTTGACCCC 82 234
396290 1 2-15-3 435 454 GTAGCAATCTGCTTGACCCC 79 234
396218 1 5-10-5 590 609 GACCACAGACAACATCAGTC 89 235
396295 1 2-15-3 590 609 GACCACAGACAACATCAGTC 85 235
396219 1 5-10-5 683 702 CCACCTTTTTGATAAAGACC 65 236
396296 1 2-15-3 683 702 CCACCTTTTTGATAAAGACC 41 236

Several antisense oligonucleotides exhibiting in vitro inhibition of CD40 (see Example 4) were tested at various doses in HuVEC cells. Cells were plated at densities of 5000 cells per well and treated with nM concentrations of antisense oligonucleotide as indicated in Table 5. After a treatment period of approximately 24 hours, RNA was isolated from the cells and CD40 mRNA levels were measured by quantitative real-time PCR, as described herein. Human CD40 primer probe set LTS37 was used to measure mRNA levels. CD40 mRNA levels were adjusted according to total RNA content as measured by RIBOGREEN®. Results are presented as percent inhibition of CD40, relative to untreated control cells. As illustrated in Table 5, CD40 mRNA levels were reduced in a dose-dependent manner.

TABLE 5
Antisense Inhibition of human CD40 in
HuVEC cells, Primer Probe Set LTS37
ISIS 0.2344 0.4688 0.9375 1.875 3.75 7.5 15.0 30.0
No nM nM nM nM nM nM nM nM
26163 17 35 38 51 62 67 82 89
396236 23 49 59 77 86 92 91 89
396266 35 45 58 74 55 72 57 56
396307 21 45 43 56 80 79 82 82
396218 34 47 52 57 78 82 86 86
396279 34 54 59 49 72 82 88 87
396287 31 48 52 50 64 77 85 86
396264 39 34 49 56 71 84 88 86

Antisense oligonucleotides exhibiting in vitro inhibition of CD40 (see Example 4) were tested at various doses in AGS cells (human adenocarcinoma cells). Antisense oligonucleotides of SEQ ID No. 90 and SEQ ID No. 208 were designed as 4-10-4 gapmers or 5-10-5 gapmers, respectively, where the gap segment comprises 2′-deoxynucleotides and each wing segment comprises 2′-MOE or 2′OMe nucleotides. The antisense oligonucleotides comprise phosphorothioate backbones (internucleoside linkages) and 5-methylcytosine substitutions throughout.

Cells were plated at densities of 5000 cells per well and treated with nM concentrations of antisense oligonucleotide as indicated in Table 6. After a treatment period of approximately 24 hours, RNA was isolated from the cells and relative CD40 mRNA expression levels were quantified by real time RT-PCR using the QuantiTect™ SYBR® Green RT-PCR kit (Qiagen). CD40 mRNA levels were adjusted according to GAPDH content, a housekeeping gene. Results are presented as percent inhibition of CD40, relative to cells treated with a scrambled control oligonucleotide ( TCCATTTATTAGTCTAGGAA (5-10-5 gapmer, where the gap segment comprises 2′-deoxynucleotides and each wing segment comprises 2′-MOE nucleotides. The oligonucleotide comprises phosphorothioate backbones (internucleoside linkages) and 5-methylcytosine substitutions throughout.

TABLE 6
Antisense Inhibition of human CD40 in AGS cells
ISIS Wing 12.5 25.0 50.0
No Motif segment nM nM nM Seq ID
 26163 4-10-4 2′MOE 80 69 90 90
396236 5-10-5 2′MOE 83 86 94 208
4-10-4 2′OMe 51 54 66 90
5-10-5 2′OMe 60 63 69 208

As illustrated in Table 6, CD40 mRNA levels were reduced in a dose-dependent manner. Antisense oligonucleotides comprising 2′MOE wing segments are more active than those with 2′OMe wing segments.

Chimeric antisense oligonucleotides having 5-10-5 MOE wings and deoxy gap and 4-10-4 MOE wings and deoxy gap may be designed to target murine CD40. These antisense oligonucleotides can be evaluated for their ability to reduce CD40 mRNA in primary mouse hepatocytes using similar methods as described in the human in vitro study.

For example, primary mouse hepatocytes may be treated with 0.2344 nM, 0.4688 nM, 0.9375 nM, 1.875 nM, 3.75 nM, 7.5 nM, 15.0 nM, and 30.0 nM of antisense oligonucleotides for a period of approximately 24 hours. RNA can be isolated from the cells and CD40 mRNA levels can be measured by quantitative real-time PCR, as described herein. Murine CD40 primer probe sets can be used to measure mRNA levels. CD40 mRNA levels can then be adjusted according to total RNA content as measured by RIBOGREEN®.

Antisense oligonucleotides showing statistically significant dose-dependent inhibition from an in vitro study can be evaluated for their ability to reduce CD40 mRNA in vivo.

Treatment

Antisense oligonucleotide can be evaluated in Balb/c mice and compared to a control group treated with saline. Oligonucleotide or saline would be administered subcutaneously at a dose of 5 mg/kg, 10 mg/kg, 25 mg/kg, or 50 mg/kg twice a week for three weeks. After the treatment period, whole liver can be collected for RNA analysis and protein analysis.

RNA Analysis

Liver RNA can be isolated for real-time PCR analysis of CD40. It is theorized that an antisense oligonucleotide showing significant dose-dependent inhibition in vitro may show significant dose-dependent inhibition in vivo.

Protein Analysis

Liver CD40 protein may be measured by Western blot.

Male 6 week old Balb/c mice were dosed subcutaneous 2× per week for 4 weeks with 25 or 50 mg/kg of antisense oligonucleotides Isis 26163 or Isis 396236. Mice were sacrificed 2 days following last administration. Body weights of the animals were monitored throughout the study. After sacrification liver, spleen and kidney weights and liver enzymes ALT and AST from mouse plasma were determined.

Compared to a saline control treatment body weights of the mice are not affected by antisense oligonucleotides Isis 26163 or Isis 396236. Liver weight and spleen weight displayed a slight increase for Isis 26163 but not for Isis 396236. LFT (liver function test) elevations were small and within the normal range of high dose mouse studies.

Antisense oligonucleotides ISIS 26163 and ISIS19216 targeted to a CD40 nucleic acid were tested for their effects on CD40 mRNA in vitro. The antisense oligonucleotides were designed as 4-10-4 gapmers, where the gap segment comprises 2′-deoxynucleotides and each wing segment comprises 2′-MOE nucleotides. The antisense oligonucleotides comprise phosphorothioate backbones (internucleoside linkages) and 5-methylcytosine substitutions throughout or in the wings, respectively.

T24 cells at a density of 7000 cells per well in a 96-well plate were treated with 100 nM or 150 nM, respectively, of antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and CD40 mRNA levels were measured by quantitative real-time PCR, as described herein. CD40 mRNA levels were adjusted according to GAPDH content, a housekeeping gene.

Results are presented in Table 7 as percent inhibition of CD40, relative to untreated control cells.

TABLE 7
Oligo ID Target site nM on T24 cells % Inhibition SEQ ID No.
26163 70-87 100 98 90
19216 73-90 150 66 10

Sequence ISIS 26163 shows a superior activity over ISIS19126, which overlaps the sequence 15 nucleobases.

Bennett, C. Frank, Freier, Susan M., Cowsert, Lex M.

Patent Priority Assignee Title
Patent Priority Assignee Title
3687808,
4469863, Nov 12 1980 FINCH, WALTER G ; FINCH, PATRICIA ANNE; MCARTY, VIDA MARILENA; MURAKOSHI, LILLIAN BONNIE; FINCH, ROBIN LEE; FINCH, RUTH MAE Nonionic nucleic acid alkyl and aryl phosphonates and processes for manufacture and use thereof
4476301, Apr 29 1982 Centre National de la Recherche Scientifique Oligonucleotides, a process for preparing the same and their application as mediators of the action of interferon
4587044, Sep 01 1983 PARAMOUNT CAPITAL, INC Linkage of proteins to nucleic acids
4605735, Feb 14 1983 Wakunaga Seiyaku Kabushiki Kaisha Oligonucleotide derivatives
4667025, Aug 09 1982 Wakunaga Seiyaku Kabushiki Kaisha Oligonucleotide derivatives
4762779, Jun 13 1985 RAYLO CHEMICALS INC Compositions and methods for functionalizing nucleic acids
4789737, Aug 09 1982 Wakunaga Seiyaku Kabushiki Kaisha Oligonucleotide derivatives and production thereof
4800159, Mar 28 1985 Roche Molecular Systems, Inc Process for amplifying, detecting, and/or cloning nucleic acid sequences
4806463, May 23 1986 MASSACHUSETTS WORCESTER, UNIVERSITY OF Inhibition of HTLV-III by exogenous oligonucleotides
4824941, Nov 09 1984 Specific antibody to the native form of 2'5'-oligonucleotides, the method of preparation and the use as reagents in immunoassays or for binding 2'5'-oligonucleotides in biological systems
4828979, Nov 08 1984 Life Technologies, Inc. Nucleotide analogs for nucleic acid labeling and detection
4835263, Jan 27 1983 Centre National de la Recherche Scientifique Novel compounds containing an oligonucleotide sequence bonded to an intercalating agent, a process for their synthesis and their use
4845205, Jan 08 1985 Institut Pasteur; Centre National de la Recherche Scientifique 2,N6 -disubstituted and 2,N6 -trisubstituted adenosine-3'-phosphoramidites
4876335, Jun 30 1986 Wakunaga Seiyaku Kabushiki Kaisha Poly-labelled oligonucleotide derivative
4904582, Jun 11 1987 SYNTHETIC GENETICS, INC , A CORP OF CA Novel amphiphilic nucleic acid conjugates
4948882, Feb 22 1983 SYNGENE, INC Single-stranded labelled oligonucleotides, reactive monomers and methods of synthesis
4958013, Jun 06 1989 Northwestern University; NORTHWESTERN UNIVERSITY, EVANSTON, IL A CORP OF IL Cholesteryl modified oligonucleotides
4981957, Jul 19 1984 Centre National de la Recherche Scientifique Oligonucleotides with modified phosphate and modified carbohydrate moieties at the respective chain termini
5013830, Sep 08 1986 AJINOMOTO CO , INC Compounds for the cleavage at a specific position of RNA, oligomers employed for the formation of said compounds, and starting materials for the synthesis of said oligomers
5023243, Oct 23 1981 Molecular Biosystems, Inc. Oligonucleotide therapeutic agent and method of making same
5034506, Mar 15 1985 ANTIVIRALS, INC Uncharged morpholino-based polymers having achiral intersubunit linkages
5075302, Mar 09 1990 Schering Corporation; SCHERING CORPORATION, A CORP OF NEW JERSEY Mercaptoacyl aminolactam endopeptidase inhibitors
5082830, Feb 26 1988 Enzo Life Sciences, Inc End labeled nucleotide probe
5109124, Jun 01 1988 Biogen, Inc Nucleic acid probe linked to a label having a terminal cysteine
5112963, Nov 12 1987 Max-Planck-Gesellschaft zur Foerderung der Wissenschaften e.V. Modified oligonucleotides
5118800, Dec 20 1983 California Institute of Technology Oligonucleotides possessing a primary amino group in the terminal nucleotide
5118802, Dec 20 1983 California Institute of Technology DNA-reporter conjugates linked via the 2' or 5'-primary amino group of the 5'-terminal nucleoside
5130302, Dec 20 1989 BORON BILOGICALS, INC , A NC CORPORATION Boronated nucleoside, nucleotide and oligonucleotide compounds, compositions and methods for using same
5134066, Aug 29 1989 Monsanto Company; MONSANTO COMPANY, A CORP OF DE Improved probes using nucleosides containing 3-dezauracil analogs
5138045, Jul 27 1990 Isis Pharmaceuticals Polyamine conjugated oligonucleotides
5149797, Feb 15 1990 WORCESTER FOUNDATION FOR BIOMEDICAL RESEARCH, INC Method of site-specific alteration of RNA and production of encoded polypeptides
5166315, Dec 20 1989 ANTIVIRALS, INC Sequence-specific binding polymers for duplex nucleic acids
5175273, Jul 01 1988 GENENTECH, INC , 460 POINT SAN BRUNO BLVD , SOUTH SAN FRANCISCO, CA 94080, A CORP OF DE Nucleic acid intercalating agents
5177196, Aug 16 1990 MicroProbe Corporation Oligo (α-arabinofuranosyl nucleotides) and α-arabinofuranosyl precursors thereof
5177198, Nov 30 1989 BORON BIOLOGICALS, INC , A NC CORPORATION OF NC Process for preparing oligoribonucleoside and oligodeoxyribonucleoside boranophosphates
5185444, Mar 15 1985 ANTIVIRALS, INC Uncharged morpolino-based polymers having phosphorous containing chiral intersubunit linkages
5188897, Oct 27 1987 Temple University of the Commonwealth System of Higher Education Encapsulated 2',5'-phosphorothioate oligoadenylates
5214134, Sep 12 1990 SANOFI S A Process of linking nucleosides with a siloxane bridge
5214136, Feb 20 1990 Isis Pharmaceuticals, Inc Anthraquinone-derivatives oligonucleotides
5216141, Jun 06 1988 Oligonucleotide analogs containing sulfur linkages
5218105, Jul 27 1990 Isis Pharmaceuticals Polyamine conjugated oligonucleotides
5220007, Feb 15 1990 WORCESTER FOUNDATION FOR BIOMEDICAL RESEARCH, INC Method of site-specific alteration of RNA and production of encoded polypeptides
5223618, Aug 13 1990 ISIS Pharmaceuticals, Inc. 4'-desmethyl nucleoside analog compounds
5235033, Mar 15 1985 ANTIVIRALS, INC Alpha-morpholino ribonucleoside derivatives and polymers thereof
5245022, Aug 03 1990 SANOFI S A Exonuclease resistant terminally substituted oligonucleotides
5254469, Sep 12 1989 CLINICAL DIAGNOSTIC SYSTEMS INC Oligonucleotide-enzyme conjugate that can be used as a probe in hybridization assays and polymerase chain reaction procedures
5256775, Jun 05 1989 Isis Pharmaceuticals, Inc Exonuclease-resistant oligonucleotides
5258506, Sep 29 1988 Chiron Diagnostics Corporation Photolabile reagents for incorporation into oligonucleotide chains
5262536, Sep 15 1988 NEN LIFE SCIENCE PRODUCTS, INC Reagents for the preparation of 5'-tagged oligonucleotides
5264423, Mar 25 1987 UNITED STATES OF AMERICA, THE, AS REPRESENTED BY THE DEPARTMENT OF HEALTH AND HUMAN SERVICES Inhibitors for replication of retroviruses and for the expression of oncogene products
5264562, Oct 24 1989 Isis Pharmaceuticals, Inc Oligonucleotide analogs with novel linkages
5264564, Oct 24 1989 Isis Pharmaceuticals, Inc Oligonucleotide analogs with novel linkages
5272250, Jul 10 1992 Boronated phosphoramidate compounds
5276019, Mar 25 1987 UNITED STATES OF AMERICA, THE, AS REPRESENTED BY THE SECRETARY OF THE DEPARTMENT OF HEALTH AND HUMAN SERVICES Inhibitors for replication of retroviruses and for the expression of oncogene products
5278302, May 26 1988 UNIVERSITY PATENTS, INC Polynucleotide phosphorodithioates
5286717, Mar 25 1987 The United States of America as represented by the Department of Health Inhibitors for replication of retroviruses and for the expression of oncogene products
5292873, Nov 29 1989 Research Foundation of State University of New York, The Nucleic acids labeled with naphthoquinone probe
5317098, Mar 17 1986 SHIZUYA, HIROAKI Non-radioisotope tagging of fragments
5319080, Oct 17 1991 Ciba-Geigy Corporation Bicyclic nucleosides, oligonucleotides, process for their preparation and intermediates
5321131, Mar 08 1990 WORCESTER FOUNDATION FOR EXPERIMENTAL BIOLOGY, THE Site-specific functionalization of oligodeoxynucleotides for non-radioactive labelling
5352775, Jan 16 1991 Zeneca Limited APC gene and nucleic acid probes derived therefrom
5359044, Dec 13 1991 Novartis AG Cyclobutyl oligonucleotide surrogates
5366878, Feb 15 1990 WORCESTER FOUNDATION FOR BIOMEDICAL RESEARCH, INC Method of site-specific alteration of RNA and production of encoded polypeptides
5367066, Oct 16 1984 Chiron Diagnostics Corporation Oligonucleotides with selectably cleavable and/or abasic sites
5371241, Jul 19 1991 GE Healthcare Bio-Sciences Corp Fluorescein labelled phosphoramidites
5378825, Jul 27 1990 ISIS Pharmaceuticals, Inc. Backbone modified oligonucleotide analogs
5386023, Jul 27 1990 Isis Pharmaceuticals Backbone modified oligonucleotide analogs and preparation thereof through reductive coupling
5391723, May 31 1989 NeoRx Corporation Oligonucleotide conjugates
5393878, Oct 17 1991 Ciba-Geigy Corporation Bicyclic nucleosides, oligonucleotides, process for their preparation and intermediates
5399676, Oct 23 1989 Isis Pharmaceuticals, Inc Oligonucleotides with inverted polarity
5403711, Nov 30 1987 University of Iowa Research Foundation Nucleic acid hybridization and amplification method for detection of specific sequences in which a complementary labeled nucleic acid probe is cleaved
5405938, Dec 20 1989 Anti-Gene Development Group Sequence-specific binding polymers for duplex nucleic acids
5405939, Oct 22 1987 Temple University of the Commonwealth System of Higher Education 2',5'-phosphorothioate oligoadenylates and their covalent conjugates with polylysine
5407794, Sep 08 1992 CYTOCOLOR INC Oxazine stained lymphocytes and method
5414077, Feb 20 1990 Isis Pharmaceuticals, Inc Non-nucleoside linkers for convenient attachment of labels to oligonucleotides using standard synthetic methods
5416203, Feb 06 1991 Northwestern University Steroid modified oligonucleotides
5432272, Oct 09 1990 Method for incorporating into a DNA or RNA oligonucleotide using nucleotides bearing heterocyclic bases
5434257, Jun 01 1992 Isis Pharmaceuticals, Inc Binding compentent oligomers containing unsaturated 3',5' and 2',5' linkages
5436327, Sep 21 1988 Oxford Gene Technology Limited Support-bound oligonucleotides
5446137, Dec 09 1993 Dade Behring Marburg GmbH Oligonucleotides containing 4'-substituted nucleotides
5451463, Aug 28 1989 Clontech Laboratories, Inc. Non-nucleoside 1,3-diol reagents for labeling synthetic oligonucleotides
5453496, May 26 1988 University Patents, Inc. Polynucleotide phosphorodithioate
5455233, Nov 30 1989 University of North Carolina; Duke University; Boron Biologicals, Inc. Oligoribonucleoside and oligodeoxyribonucleoside boranophosphates
5457187, Dec 08 1993 Board of Regents University of Nebraska Oligonucleotides containing 5-fluorouracil
5459255, Jan 11 1990 Isis Pharmaceuticals, Inc N-2 substituted purines
5463564, Sep 16 1994 3-DIMENSIONAL PHARMACEUTICALS, INC System and method of automatically generating chemical compounds with desired properties
5463567, Oct 15 1993 Caterpillar Inc Apparatus and method for providing historical data regarding machine operating parameters
5463657, Feb 15 1994 Intellectual Ventures I LLC Detection of a multi-sequence spread spectrum signal
5466677, Mar 06 1993 Ciba-Geigy Corporation Dinucleoside phosphinates and their pharmaceutical compositions
5466786, Oct 24 1989 Isis Pharmaceuticals, Inc 2'modified nucleoside and nucleotide compounds
5470967, Apr 10 1990 Bristol-Myers Squibb Pharma Company Oligonucleotide analogs with sulfamate linkages
5472672, Oct 22 1993 BOARD OF TRUSTEES OF THE LELAND STANFORD JUNIOR UNIVERSITY, THE Apparatus and method for polymer synthesis using arrays
5476925, Feb 01 1993 Northwestern University Oligodeoxyribonucleotides including 3'-aminonucleoside-phosphoramidate linkages and terminal 3'-amino groups
5484908, Nov 26 1991 Isis Pharmaceuticals, Inc Oligonucleotides containing 5-propynyl pyrimidines
5486603, Jan 08 1990 Isis Pharmaceuticals, Inc Oligonucleotide having enhanced binding affinity
5489677, Jul 27 1990 ISIS Pharmaceuticals, Inc. Oligonucleoside linkages containing adjacent oxygen and nitrogen atoms
5491133, Nov 30 1987 University of Iowa Research Foundation Methods for blocking the expression of specifically targeted genes
5502177, Sep 17 1993 Isis Pharmaceuticals, Inc Pyrimidine derivatives for labeled binding partners
5507796, Apr 28 1994 Method of suspending a pelvic organ and instrument for performing the method
5508270, Mar 06 1993 Ciba-Geigy Corporation Nucleoside phosphinate compounds and compositions
5510475,
5512439, Nov 21 1988 Life Technologies AS Oligonucleotide-linked magnetic particles and uses thereof
5512667, Aug 28 1990 DRUG ROYALTY TRUST 9 Trifunctional intermediates for preparing 3'-tailed oligonucleotides
5514785, May 11 1990 Becton, Dickinson and Company Solid supports for nucleic acid hybridization assays
5519126, Mar 25 1988 University of Virginia Alumni Patents Foundation Oligonucleotide N-alkylphosphoramidates
5519134, Jan 11 1994 Isis Pharmaceuticals, Inc Pyrrolidine-containing monomers and oligomers
5523389, Sep 29 1992 Isis Pharmaceuticals, Inc Inhibitors of human immunodeficiency virus
5525465, Oct 28 1987 Howard Florey Institute of Experimental Physiology and Medicine Oligonucleotide-polyamide conjugates and methods of production and applications of the same
5525711, May 18 1994 UNITED STATES OF AMERICA, THE, AS REPRESENTED BY THE SECRETARY OF THE DEPARTMENT OF HEALTH AND HUMAN SERVICES Pteridine nucleotide analogs as fluorescent DNA probes
5529756, Oct 22 1993 The Board of Trustees of the Leland Stanford Junior University Apparatus and method for polymer synthesis using arrays
5536821, Mar 03 1994 Worcester Foundation for Biomedical Research Aminoalkylphosphorothioamidate oligonucleotide deratives
5539082, Apr 26 1993 Peptide nucleic acids
5539083, Feb 23 1994 Isis Pharmaceuticals, Inc Peptide nucleic acid combinatorial libraries and improved methods of synthesis
5541306, Mar 03 1994 Worcester Foundation for Biomedical Research Aminoalkylphosphotriester oligonucleotide derivatives
5541307, Jul 27 1990 Isis Pharmaceuticals, Inc Backbone modified oligonucleotide analogs and solid phase synthesis thereof
5541313, Feb 22 1983 Molecular Biosystems, Inc. Single-stranded labelled oligonucleotides of preselected sequence
5543508, Dec 15 1987 Gene Shears Pty. Limited Ribozymes
5545730, Oct 16 1984 Chiron Diagnostics Corporation Multifunctional nucleic acid monomer
5550111, Jul 11 1984 Temple University-Of The Commonwealth System of Higher Education Dual action 2',5'-oligoadenylate antiviral derivatives and uses thereof
5552538, Oct 16 1984 Chiron Diagnostics Corporation Oligonucleotides with cleavable sites
5552540, Jun 24 1987 Howard Florey Institute of Experimental Physiology and Medicine Nucleoside derivatives
5554613, Jun 04 1992 AstraZeneca UK Limited Heterocyclic derivatives
5561225, Sep 19 1990 SOUTHERN RESEARCH INSTITUTE, 2000 NINTH AVENUE SOUTH, P O BOX 55305, BIRMINGHAM, AL 35255-5305 Polynucleotide analogs containing sulfonate and sulfonamide internucleoside linkages
5563036, Apr 29 1994 Amgen Inc Transcription factor-DNA binding assay
5563253, Mar 08 1990 Worcester Foundation for Experimental Biology Linear aminoalkylphosphoramidate oligonucleotide derivatives
5565350, Dec 09 1993 Thomas Jefferson University Compounds and methods for site directed mutations in eukaryotic cells
5565552, Jan 21 1992 Board of Regents, The University of Texas System Method of expanded porphyrin-oligonucleotide conjugate synthesis
5567810, Aug 03 1990 Sterling Drug, Inc. Nuclease resistant compounds
5567811, May 03 1990 Amersham International plc Phosphoramidite derivatives, their preparation and the use thereof in the incorporation of reporter groups on synthetic oligonucleotides
5571799, Aug 12 1991 Basco, Ltd. (2'-5') oligoadenylate analogues useful as inhibitors of host-v5.-graft response
5574142, Dec 15 1992 MicroProbe Corporation Peptide linkers for improved oligonucleotide delivery
5574656, Sep 16 1994 3-Dimensional Pharmaceuticals, Inc. System and method of automatically generating chemical compounds with desired properties
5576427, Mar 30 1993 Sterling Winthrop, Inc. Acyclic nucleoside analogs and oligonucleotide sequences containing them
5578717, Oct 16 1984 Chiron Diagnostics Corporation Nucleotides for introducing selectably cleavable and/or abasic sites into oligonucleotides
5578718, Jan 11 1990 Isis Pharmaceuticals; Isis Pharmaceuticals, Inc Thiol-derivatized nucleosides
5580731, Aug 25 1994 Siemens Healthcare Diagnostics Inc N-4 modified pyrimidine deoxynucleotides and oligonucleotide probes synthesized therewith
5585481, Sep 21 1987 Hologic, Inc; Biolucent, LLC; Cytyc Corporation; CYTYC SURGICAL PRODUCTS, LIMITED PARTNERSHIP; SUROS SURGICAL SYSTEMS, INC ; Third Wave Technologies, INC; Gen-Probe Incorporated Linking reagents for nucleotide probes
5587361, Oct 15 1991 Isis Pharmaceuticals, Inc Oligonucleotides having phosphorothioate linkages of high chiral purity
5587371, Jan 21 1992 Pharmacyclics, Inc.; Board of Trustees, Univ. of TX Sys. Texaphyrin-oligonucleotide conjugates
5587469, Jan 11 1990 ISIS Pharmaceuticals, Inc. Oligonucleotides containing N-2 substituted purines
5591469, Jan 27 1993 Westfalia Separator Aktiengesellschaft Process and system for regulating the fat content of milk and cream
5591584, Aug 25 1994 Siemens Healthcare Diagnostics Inc N-4 modified pyrimidine deoxynucleotides and oligonucleotide probes synthesized therewith
5591721, Oct 25 1994 Idera Pharmaceuticals, Inc Method of down-regulating gene expression
5591722, Sep 15 1989 Southern Research Institute 2'-deoxy-4'-thioribonucleosides and their antiviral activity
5594121, Nov 07 1991 Isis Pharmaceuticals, Inc Enhanced triple-helix and double-helix formation with oligomers containing modified purines
5595726, Jan 21 1992 Board of Regents, The University of Texas System Chromophore probe for detection of nucleic acid
5596086, Sep 20 1990 Isis Pharmaceuticals, Inc Modified internucleoside linkages having one nitrogen and two carbon atoms
5596091, Mar 18 1994 Regents of the University of California, The Antisense oligonucleotides comprising 5-aminoalkyl pyrimidine nucleotides
5597696, Jul 18 1994 Becton, Dickinson and Company Covalent cyanine dye oligonucleotide conjugates
5597909, Aug 25 1994 Chiron Diagnostics Corporation Polynucleotide reagents containing modified deoxyribose moieties, and associated methods of synthesis and use
5599923, Mar 06 1989 Pharmacyclics, Inc; Pharmacyclics LLC Texaphyrin metal complexes having improved functionalization
5599928, Feb 02 1994 Pharmacyclics, Inc.; Board of Regents, The University of Texas System Texaphyrin compounds having improved functionalization
5602240, Jul 27 1990 Novartis AG Backbone modified oligonucleotide analogs
5608046, Jul 27 1990 Isis Pharmaceuticals, Inc Conjugated 4'-desmethyl nucleoside analog compounds
5610289, Jul 27 1990 Isis Pharmaceuticals, Inc Backbone modified oligonucleotide analogues
5610300, Jul 01 1992 Ciba-Geigy Corporation Carbocyclic nucleosides containing bicyclic rings, oligonucleotides therefrom, process for their preparation, their use and intermediates
5612455, Jul 05 1994 Amgen Inc Nuclear factors and binding assay
5614617, Jul 01 1991 ISIS Pharmaceuticals, Inc. Nuclease resistant, pyrimidine modified oligonucleotides that detect and modulate gene expression
5618704, Jul 27 1990 ISIS Pharmacueticals, Inc. Backbone-modified oligonucleotide analogs and preparation thereof through radical coupling
5623065, Aug 13 1990 Isis Pharmaceuticals, Inc Gapped 2' modified oligonucleotides
5623070, Jul 27 1990 ISIS Pharmaceuticals, Inc. Heteroatomic oligonucleoside linkages
5625050, Mar 31 1994 Amgen Inc. Modified oligonucleotides and intermediates useful in nucleic acid therapeutics
5627053, Mar 29 1994 Ribozyme Pharmaceuticals, Inc 2'deoxy-2'-alkylnucleotide containing nucleic acid
5633360, Apr 14 1992 Isis Pharmaceuticals, Inc Oligonucleotide analogs capable of passive cell membrane permeation
5639603, Sep 16 1992 NEXUS BIOSYSTEMS, INC Synthesizing and screening molecular diversity
5639873, Feb 05 1992 Centre National de la Recherche Scientifique (CNRS) Oligothionucleotides
5641625, Apr 26 1993 NIELSEN, PETER E Cleaving double-stranded DNA with peptide nucleic acids
5646265, Jan 11 1990 ISIS Pharmceuticals, Inc. Process for the preparation of 2'-O-alkyl purine phosphoramidites
5650122, Oct 31 1986 Pasteur Sanofi Diagnostics Automated patient sample analysis instrument having tubes and reaction wells washing apparatus
5652355, Jul 23 1992 MASSACHUSETTS WORCESTER, UNIVERSITY OF Hybrid oligonucleotide phosphorothioates
5652356, Aug 17 1995 HYBRIDON, INC Inverted chimeric and hybrid oligonucleotides
5658873, Apr 10 1993 Evonik Degussa GmbH Coated sodium percarbonate particles, a process for their production and detergent, cleaning and bleaching compositions containing them
5663312, Mar 31 1993 Sanofi Oligonucleotide dimers with amide linkages replacing phosphodiester linkages
5670633, Jan 11 1990 ISIS PHARMACEUTICALS INC Sugar modified oligonucleotides that detect and modulate gene expression
5677437, Jul 27 1990 ISIS Pharmaceuticals, Inc. Heteroatomic oligonucleoside linkages
5677439, Aug 03 1990 Sanofi Oligonucleotide analogues containing phosphate diester linkage substitutes, compositions thereof, and precursor dinucleotide analogues
5681941, Jan 11 1990 Isis Pharmaceuticals, Inc Substituted purines and oligonucleotide cross-linking
5684711, Sep 16 1994 3-Dimensional Pharmaceuticals, Inc. System, method, and computer program for at least partially automatically generating chemical compounds having desired properties
5688941, Jul 27 1990 ISIS Pharmaceuticals, Inc. Methods of making conjugated 4' desmethyl nucleoside analog compounds
5693463, Jun 27 1991 GENELABS TECHNOLOGIES, INC Method of ordering sequence binding preferences of a DNA-binding molecule
5696248, Jun 15 1994 Hoechst Aktiengesellschaft 3'-modified oligonucleotide derivatives
5697248, Jul 25 1991 MEASURMENT SPECIALTIES, INC Liquid level sensor
5700637, May 03 1988 Oxford Gene Technology Limited Apparatus and method for analyzing polynucleotide sequences and method of generating oligonucleotide arrays
5700920, Jul 01 1992 Novartis Corporation Carbocyclic nucleosides containing bicyclic rings, oligonucleotides therefrom, process for their preparation, their use and intermediates
5700922, Dec 24 1991 ISIS PHARMACEUTICALS INC PNA-DNA-PNA chimeric macromolecules
5708158, Jul 05 1994 Amgen Inc Nuclear factors and binding assays
5714331, May 24 1991 EXXON CHEMICAL PATENT INC Peptide nucleic acids having enhanced binding affinity, sequence specificity and solubility
5716780, Dec 23 1992 Genelabs Technologies, Inc. Method of constructing sequence-specific DNA-binding molecules
5719262, Nov 22 1993 Peptide nucleic acids having amino acid side chains
5720923, Jul 28 1993 Applied Biosystems, LLC Nucleic acid amplification reaction apparatus
5766855, May 24 1991 Peptide nucleic acids having enhanced binding affinity and sequence specificity
5773571, Apr 26 1993 Peptide nucleic acids
5783431, Apr 24 1996 Merck Sharp & Dohme Corp Methods for generating and screening novel metabolic pathways
5786461, May 24 1991 Peptide nucleic acids having amino acid side chains
5789573, Aug 14 1990 Isis Pharmaceuticals, Inc Antisense inhibition of ICAM-1, E-selectin, and CMV IE1/IE2
5801154, Apr 16 1996 Isis Pharmaceuticals, Inc Antisense oligonucleotide modulation of multidrug resistance-associated protein
5824485, Apr 25 1995 CUBIST PHARMACEUTICALS, INC Methods for generating and screening novel metabolic pathways
5831014, Feb 23 1994 ISIS Pharmaceuticals, Inc. PNA combinatorial libraries and improved methods of synthesis
5859221, Jan 11 1990 Isis Pharmaceuticals, Inc 2'-modified oligonucleotides
5864010, Feb 23 1994 ISIS Pharmaceuticals, Inc. Peptide nucleic acid combinatorial libraries
5877021, Jan 12 1996 RIBOZYME PHARMACEUTICALS INC B7-1 targeted ribozymes
5901069, Sep 16 1994 3-Dimensional Pharmaceuticals, Inc. System, method, and computer program product for at least partially automatically generating chemical compounds with desired properties from a list of potential chemical compounds to synthesize
5955589, Jun 06 1995 Isis Pharmaceuticals, Inc Gapped 2' modified oligonucleotides
5969116, May 12 1993 Novartis Corporation Nucleosides and oligonucleotides having 2'-ether groups
5986053, Apr 26 1993 NIELSEN, PETER E Peptide nucleic acids complexes of two peptide nucleic acid strands and one nucleic acid strand
6016348, Nov 27 1996 Thomson Consumer Electronics, Inc. Decoding system and data format for processing and storing encrypted broadcast, cable or satellite video data
6025339, Jun 07 1995 East Carolina University Composition, kit and method for treatment of disorders associated with bronchoconstriction and lung inflammation
6143881, Jul 23 1992 WORCESTER FOUNDATION FOR BIOMEDICAL RESEARCH, INC Hybrid oligonucleotide phosphorothioates
6194150, Jan 12 1996 Ribozyme Pharmaceuticals, Inc. Nucleic acid based inhibition of CD40
6197584, May 01 1998 Ionis Pharmaceuticals, Inc Antisense modulation of CD40 expression
6201103, May 24 1991 Peter E., Nielsen Peptide nucleic acid incorporating a chiral backbone
6204326, Feb 23 1994 ISIS PHARMACEUTICALS INC PNA combinatorial libraries and improved methods of synthesis
6210892, Oct 07 1998 Ionis Pharmaceuticals, Inc Alteration of cellular behavior by antisense modulation of mRNA processing
6228982, Apr 26 1993 NIELSEN, PETER E Double-stranded peptide nucleic acids
6295514, Nov 04 1996 3-DIMENSIONAL PHARMACEUTICALS, INC Method, system, and computer program product for representing similarity/dissimilarity between chemical compounds
6346614, Jul 23 1992 Hybridon, Inc. Hybrid oligonucleotide phosphorothioates
6350853, Apr 26 1993 Peter E., Nielsen Conjugated peptide nucleic acids having enhanced cellular uptake
6395474, May 24 1991 Peptide nucleic acids
6399754, Dec 24 1991 ISIS Pharmaceuticals, Inc. Sugar modified oligonucleotides
6414112, May 24 1991 Peptide nucleic acids having 2,6-diaminopurine nucleobases
6421612, Nov 04 1996 3-DIMENSIONAL PHARMACEUTICALS, INC System, method and computer program product for identifying chemical compounds having desired properties
6434490, Sep 16 1994 3-Dimensional Pharmaceuticals, Inc. Method of generating chemical compounds having desired properties
6441130, May 24 1991 ISIS Pharmaceuticals, Inc.; PepSeptive Biosystems, Inc. Linked peptide nucleic acids
6451968, May 24 1991 PerSeptive Biosystems, Inc Peptide nucleic acids
6453246, Nov 04 1996 3-DIMENSIONAL PHARMACEUTICALS, INC System, method, and computer program product for representing proximity data in a multi-dimensional space
6506784, Jul 01 1999 3-Dimensional Pharmaceuticals, Inc.; Heska Corporation Use of 1,3-substituted pyrazol-5-yl sulfonates as pesticides
6518266, Jul 22 1999 3-DIMENSIONAL PHARMACEUTICALS, INC 1- Aryl-3-thioalkyl pyrazoles, the synthesis thereof and the use thereof as insecticides
6571227, Nov 04 1996 3-DIMENSIONAL PHARMACEUTICALS, INC Method, system and computer program product for non-linear mapping of multi-dimensional data
6582908, Dec 06 1990 Affymetrix, Inc Oligonucleotides
6593292, Aug 24 1999 KAI PHARMACEUTICALS, INC Compositions and methods for enhancing drug delivery across and into epithelial tissues
6617162, Dec 18 2001 Ionis Pharmaceuticals, Inc Antisense modulation of estrogen receptor alpha expression
20010053519,
20020049173,
20030228597,
20040186071,
20050202531,
20050272080,
20060063730,
EP514927,
EP650493,
WO127261,
WO220547,
WO222635,
WO3022222,
WO3030826,
WO3052072,
WO3070768,
WO8607363,
WO8910977,
WO9220702,
WO9304204,
WO9402498,
WO9402499,
WO9405333,
WO9417093,
WO9528640,
WO9611205,
WO9639415,
WO9722256,
WO9803533,
WO9837242,
WO9953101,
WO9957320,
WO9960010,
/
Executed onAssignorAssigneeConveyanceFrameReelDoc
Dec 21 2016IONIS PHARMACEUTICALS, INC.(assignment on the face of the patent)
Date Maintenance Fee Events
Jan 24 2019BIG: Entity status set to Undiscounted (note the period is included in the code).
Jun 08 2022M1552: Payment of Maintenance Fee, 8th Year, Large Entity.


Date Maintenance Schedule
Mar 26 20224 years fee payment window open
Sep 26 20226 months grace period start (w surcharge)
Mar 26 2023patent expiry (for year 4)
Mar 26 20252 years to revive unintentionally abandoned end. (for year 4)
Mar 26 20268 years fee payment window open
Sep 26 20266 months grace period start (w surcharge)
Mar 26 2027patent expiry (for year 8)
Mar 26 20292 years to revive unintentionally abandoned end. (for year 8)
Mar 26 203012 years fee payment window open
Sep 26 20306 months grace period start (w surcharge)
Mar 26 2031patent expiry (for year 12)
Mar 26 20332 years to revive unintentionally abandoned end. (for year 12)