The present invention relates to the production and use of covalently closed circular (ccc) recombinant plasmids, and more particularly to vector modifications that improve expression of said DNA molecules in the target organism.
|
0. 8. A method for heat inducible production of a rep protein dependent plasmid vector, comprising:
a. obtaining bacterial cells transformed with the rep protein dependent plasmid vector, the bacterial cells comprising a PL promoter and a rep protein, wherein the rep protein dependent plasmid vector comprises a replication origin, wherein the PL promoter controls the expression of the rep protein, wherein the PL promoter comprises the nucleic acid sequence of SEQ ID NO:10, and wherein the PL promoter comprises an ol1 mutation within the nucleic acid sequence of SEQ ID NO: 10, wherein the ol1 mutation comprises either a single base substitution or a single base deletion that decreases or prevents repressor biding to ol1;
b. incubating said bacterial cells at 25-32° C. to maintain the rep protein dependent plasmid vector at a basal copy number; and
c. incubating said bacterial cells at 37-42° C. to increase copy number of said rep protein dependent plasmid vector.
1. A method for heat inducible production of a rep protein dependent replication origin plasmid vector, comprising:
a. cloning the plasmid replication regulating rep protein into an expression vector to create a PL-rep protein expression cassette in which said rep protein is expressed under the control of the PL promoter and said PL promoter further comprises an ol1 mutation in which repressor binding to ol1 is decreased or lost by mutation in ol1, said ol1 mutation comprising either a single base substitution or a single base deletion within the PL promoter (−35 to −10) SEQ ID NO:10;
b. integrating said PL-rep protein expression cassette into a host strain genome to create a PL-rep protein host strain in which expression from the said PL-rep protein expression cassette is repressed by a temperature sensitive lambda repressor expressed from the host strain genome;
c. transforming said PL-rep protein host strain with said rep protein dependent replication origin plasmid vector;
d. isolating the resultant transformed bacterial cells;
e. propagating said transformed bacterial cells at 25-32° C. to maintain the said rep protein dependent plasmid vector at a basal copy number; and
f. inducing said transformed bacterial cells at 37-42° C. to increase copy number of said rep protein dependent plasmid vector.
2. The method of
3. The method of
4. The method of
5. The method of
6. The method of
7. The method of
0. 9. The method of claim 8, wherein said ol1 mutation within the nucleic acid sequence of SEQ ID NO:10 is selected from the group consisting of SEQ ID NO: 11 and SEQ ID NO: 12.
0. 10. The method of claim 8, wherein the replication origin is selected from the group consisting of a R6K replication origin, ColE2-P9 replication origin and ColE2 related replication origin.
0. 11. The method of claim 8, wherein the replication origin is a R6K replication origin, and wherein said rep protein comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 13 and SEQ ID NO: 14.
0. 12. The method of claim 8, wherein the replication origin is a ColE2-P9 replication origin, and wherein the rep protein comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 15 and SEQ ID NO: 16.
0. 13. The method of claim 8, wherein said bacteria cells further comprises a genomically expressed RNA-IN regulated selection marker.
0. 14. The method of claim 8, wherein said rep protein dependent plasmid vector has a vector backbone with at least 95% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 39, SEQ ID NO: 40, and SEQ ID NO: 41.
|
|||||||||||||||||||||||||||||||||||||||||||||||
This application is a division of U.S. application Ser. No. 14/422,865, filed Feb. 20, 2015, which is a 371 U.S. National Phase application of PCT/US2013/000068, filed Mar. 14, 2013 which claim the benefit of U.S. Provisional Application Ser. No. 61/743,219, filed Aug. 29, 2012 entitled “DNA Plasmids With Improved Expression”. The entire disclosures of each of the above-identified applications are incorporated herein by reference.
This invention was supported in part with government support under Grant No. R44GM080768, awarded by the National Institutes of Health. The government has certain rights in this invention.
Applicants submit herewith a computer readable form (CRF) of the Sequence Listing for entry into this application. The content of the Sequence Listing information recorded in computer readable form includes no new matter beyond the scope of the published International Application.
The present invention relates to a family of eukaryotic expression plasmids useful for gene therapy, obtaining improved genetic immunization, natural interferon production, and more particularly, for improving the expression of plasmid encoded antigens, therapeutic proteins and RNAs.
The present invention also relates to the production of covalently closed circular (ccc) recombinant DNA molecules such as plasmids, cosmids, bacterial artificial chromosomes (BACs), bacteriophages, viral vectors and hybrids thereof, and more particularly to strain modifications that improve production yield of said DNA molecules in fermentation culture.
Such recombinant DNA molecules are useful in biotechnology, transgenic organisms, gene therapy, therapeutic vaccination, agriculture and DNA vaccines.
E. coli plasmids have long been an important source of recombinant DNA molecules used by researchers and by industry. Today, plasmid DNA is becoming increasingly important as the next generation of biotechnology products (e.g., gene medicines and DNA vaccines) make their way into clinical trials, and eventually into the pharmaceutical marketplace. Plasmid DNA vaccines may find application as preventive vaccines for viral, bacterial, or parasitic diseases; immunizing agents for the preparation of hyper immune globulin products; therapeutic vaccines for infectious diseases; or as cancer vaccines. Plasmids are also utilized in gene therapy or gene replacement applications, wherein the desired gene product is expressed from the plasmid after administration to the patient.
Therapeutic plasmids often contain a pMB1, ColE1 or pBR322 derived replication origin. Common high copy number derivatives have mutations affecting copy number regulation, such as ROP (Repressor of primer gene) deletion, with a second site mutation that increases copy number (e.g. pMB1 pUC G to A point mutation, or ColE1 pMM1). Higher temperature (42° C.) can be employed to induce selective plasmid amplification with pUC and pMM1 replication origins.
U.S. Pat. No. 7,943,377 (Carnes, A E and Williams, J A, 2011) disclose methods for fed-batch fermentation, in which plasmid-containing E. coli cells were grown at a reduced temperature during part of the fed-batch phase, during which growth rate was restricted, followed by a temperature upshift and continued growth at elevated temperature in order to accumulate plasmid; the temperature shift at restricted growth rate improved yield and purity of plasmid. Other fermentation processes for plasmid production are described in Carnes A. E. 2005 BioProcess Intl; 3:36-44, which is incorporated herein by reference in its entirety.
The art teaches that one of the limitations of application of plasmid therapies and plasmid vaccines is regulatory agency (e.g. Food and Drug Administration, EMEC) safety concerns regarding 1) plasmid transfer and replication in endogenous bacterial flora, or 2) plasmid encoded selection marker expression in human cells, or endogenous bacterial flora. Additionally, regulatory agency guidances recommend removal of all non essential sequences in a vector. Plasmids containing a pMB1, ColE1 or pBR322 derived replication origin can replicate promiscuously in E. coli hosts. This presents a safety concern that a plasmid therapeutic gene or antigen will be transferred and replicated to a patient's endogenous flora. Ideally, a therapeutic or vaccine plasmid would be replication incompetent in endogenous E. coli strains. This requires replacement of the pMB1, ColE1 or pBR322 derived replication origin with a conditional replication origin that requires a specialized cell line for propagation. As well, regulatory agencies such as the EMEA and FDA are concerned with utilization of antibiotic resistance or alternative protein markers in gene therapy and gene vaccine vectors, due to concerns that the gene (antibiotic resistance marker or protein marker) may be expressed in a patients cells. Ideally, plasmid therapies and plasmid vaccines would be 1) replication incompetent in endogenous E. coli strains, 2) would not encode a protein based selection marker and 3) be minimalized to eliminate all non essential sequences.
The art further teaches that one of the limitations of application of plasmid therapies and vaccines is that antigen expression is generally very low. Vector modifications that improve antigen expression (e.g. codon optimization of the gene, inclusion of an intron, use of the strong constitutive CMV or CAGG promoters versus weaker or cell line specific promoter) are highly correlative with improved in vivo expression and, where applicable, immune responses (reviewed in Manoj S, Babiuk L A, van Drunen Little-van den Hurk S. 2004 Crit Rev Clin Lab Sci 41: 1-39). A hybrid CMV promoter (CMV/R), which increased antigen expression, also improved cellular immune responses to HIV DNA vaccines in mice and nonhuman primates (Barouch D H, Yang Z Y, Kong W P, Korioth-Schmitz B, Sumida S M, Truitt D M, Kishko M G, Arthur J C, Miura A, Mascola J R, Letvin N L, Nabel G J. 2005 J Virol. 79: 8828-8834). A plasmid containing the woodchuck hepatitis virus posttranscriptional regulatory element (a 600 bp element that increases stability and extranuclear transport of RNA resulting in enhanced levels of mRNA for translation) enhanced antigen expression and protective immunity to influenza hemagglutinin (HA) in mice (Garg S, Oran A E, Hon H, Jacob J. 2004 J Immunol. 173: 550-558). These studies teach that improvement in expression beyond that of current CMV based vectors may generally improve immunogenicity and, in the case of gene therapeutics, efficacy.
The present invention relates to a family of minimalized eukaryotic expression plasmids that are replication incompetent in endogenous flora and have dramatically improved in vivo expression. These vectors are useful for gene therapy, genetic immunization and or interferon therapy.
The present invention also relates generally to methods of increasing production yield of covalently closed supercoiled plasmid DNA.
Improved vectors that utilize novel replication origins that unexpectedly improve antigen expression are disclosed.
One object of the invention is to provide improved expression plasmid vectors. Yet another object of the invention is to provide methods for improving plasmid copy number.
According to one object of the invention, a method of increasing expression from an expression plasmid vector comprises modifying the plasmid DNA to replace the pMB1, ColE1 or pBR322 derived replication origin and selectable marker with an alternative replication origin selected from the group consisting of an minimal pUC origin, a R6K gamma replication origin, a ColE2-P9 replication origin, and a ColE2-P9 related replication origin and an RNA selectable marker; transforming the modified plasmid DNA into a bacterial cell line rendered competent for transformation; and isolating the resultant transformed bacterial cells. The resultant plasmid surprisingly has higher in vivo expression levels than the parent pMB1, ColE1 or pBR322 derived replication origin expression plasmid vector.
According to one object of the invention, a composition for construction of a eukaryotic expression vector comprises an R6K origin with at least 90% sequence identity to the sequence set forth as SEQ ID NO: 1, and a RNA selectable marker, wherein said R6K origin is operably linked to said RNA selectable marker and a eukaryotic region. According to another object of the invention, said R6K origin-RNA selectable marker improves said vector expression in vivo compared to a corresponding vector containing a pMB1, ColE1 or pBR322 derived replication origin. According to still another object of the invention, said vector has at least 95% sequence identity to a sequence selected from the group consisting of: SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO:41.
According to one object of the invention, a composition for construction of a eukaryotic expression vector comprises a ColE2-P9 origin with at least 90% sequence identity to the sequence set forth as SEQ ID NO: 4, 5, 6, or 7, and a a RNA selectable marker, wherein said ColE2-P9 origin—a RNA selectable marker is operably linked to a eukaryotic region. According to another object of the invention, said ColE2-P9 origin-RNA selectable marker improves said vector expression in vivo compared to a corresponding vector containing a pMB1, ColE1 or pBR322 derived replication origin. According to still another object of the invention, said vector has at least 95% sequence identity to a sequence selected from the group consisting of: SEQ ID NO: 8, SEQ ID NO: 9. According to still another object of the invention, a primosomal assembly site (ssiA) is optionally incorporated into the vector adjacent to the ColE2-P9 origin.
According to another object of the invention, production cell lines are disclosed that improve plasmid yield in shake flask and or fermentation culture with said R6K gamma replication origin, ColE2-P9 replication origin, or ColE2-P9 related replication origin plasmid vectors of the current invention.
According to another object of the invention, production cell lines providing heat inducible induction of R6K gamma replication origin, ColE2-P9 replication origin, or ColE2-P9 related replication origin plasmid vectors for DNA production are disclosed. These cell lines contain one or more copies of the corresponding R6K gamma replication origin, ColE2-P9 replication origin, or ColE2-P9 related replication protein integrated into the genome and expressed from the group consisting of: the heat inducible PL promoter (SEQ ID NO: 10), the heat inducible PL promoter incorporating the OL1-G deletion (SEQ ID NO: 11), the heat inducible PL promoter incorporating the OL1-G to T substitution (SEQ ID NO: 12).
According to another object of the invention, mutant R6K replication proteins that improve heat inducible induction of R6K gamma replication origin vectors are disclosed. These cell lines contain one or more copies of the mutant R6K gamma replication origin replication protein integrated into the genome and expressed from the group consisting of: the heat inducible PL promoter (SEQ ID NO: 10), the heat inducible PL promoter incorporating the OL1-G deletion (SEQ ID NO: 11), the heat inducible PL promoter incorporating the OL1-G to T substitution (SEQ ID NO: 12). The mutant R6K gamma replication origin replication protein are selected from the group consisting of: P42L-P113S (SEQ ID NO: 13), P42L-P106L-F107S (SEQ ID NO: 14).
According to another object of the invention, a mutant ColE2-P9 replication protein that improve heat inducible induction of ColE2-P9 replication origin vectors is disclosed. These cell lines contain one or more copies of the mutant ColE2-P9 replication origin replication protein integrated into the genome and expressed from the group consisting of: the heat inducible PL promoter (SEQ ID NO: 10), the heat inducible PL promoter incorporating the OL1-G deletion (SEQ ID NO: 11), the heat inducible PL promoter incorporating the OL1-G to T substitution (SEQ ID NO: 12). The mutant ColE2-P9 replication origin replication protein is ColE2-P9 Rep mut G194D (SEQ ID NO: 16).
Further objects and advantages of the invention will become apparent from a consideration of the drawings and ensuing description.
Table 1: PL promoter with OL1 mutations OL1-G and OL1-G to T improve plasmid yields in HyperGRO fermentation
Table 2: NTC9385R-EGFP LB media shake flask production yields in R6K production strains
Table 3: NTC9385C-Luc plasmid performance in different processes and production cell lines
Table 4: ColE2 Origin EGFP vector production in NTC701131 ColE2 production cell line
Table 5: NTC9382C, NTC9385C, NTC9382R, NTC9385R, NTC9682C, NTC9685C, NTC9682R, and NTC9685R vectors
Table 6: gWIZ and NTC9385C Nanoplasmid expression compared to NTC8685
Table 7: SR vector expression in vitro and in vivo
Table 8: RNA Pol III Nanoplasmid vector expression
Table 9: High level expression is obtained with pMB1 RNAI or RNA-OUT antisense RNA vectors
SEQ ID NO:1: R6K gamma Origin
SEQ ID NO:2: NTC9385R vector backbone
SEQ ID NO:3: NTC9685R vector backbone
SEQ ID NO:4: ColE2 Origin (+7)
SEQ ID NO:5: ColE2 Origin (+7, CpG free)
SEQ ID NO:6: ColE2 Origin (Min)
SEQ ID NO:7: ColE2 Origin (+16)
SEQ ID NO:8: NTC9385C vector backbone
SEQ ID NO:9: NTC9685C vector backbone
SEQ ID NO:10: PL Promoter (−35 to −10)
SEQ ID NO:11: PL Promoter OL1-G (−35 to −10)
SEQ ID NO:12: PL Promoter OL1-G to T(−35 to −10)
SEQ ID NO:13: R6K Rep protein P42L-P113S
SEQ ID NO:14: R6K Rep protein P42L-P106L-F107S
SEQ ID NO:15: ColE2 Rep protein (wild type)
SEQ ID NO:16: ColE2 Rep protein mut (G194D)
SEQ ID NO:17: pINT pR pL R6K Rep piP42L-P106L-F107S (P3−)
SEQ ID NO:18: pINT pR pL ColE2 Rep protein mut (G194D)
SEQ ID NO:19: NTC9385R and NTC9685R Bacterial region. [NheI site-trpA terminator-R6K Origin-RNA-OUT-KpnI site]
SEQ ID NO:20: NTC9385C and NTC9685C Bacterial region. [NheI site-ssiA-ColE2 Origin (+7)-RNA-OUT-KpnI site]
SEQ ID NO:21: NTC9385C and NTC9685C CpG free ssiA [from plasmid R6K]
SEQ ID NO:22: CpG free R6K origin
SEQ ID NO:23: RNA-OUT selectable marker from NTC9385C, NTC9685C, NTC9385R, and NTC9685R
SEQ ID NO:24: RNA-OUT Sense strand RNA from NTC9385C, NTC9685C, NTC9385R, NTC9685R, and NTC9385Ra
SEQ ID NO:25: TPA secretion sequence
SEQ ID NO:26: PCR primer 15061101
SEQ ID NO:27: PCR primer 15061102
SEQ ID NO:28: ColE2 core replication origin
SEQ ID NO:29: +7(CpG free)-ssiA ColE2 origin
SEQ ID NO:30: HTLV-IR-Rabbit β globin hybrid intron
SEQ ID NO:31: pMB1 RNAI antisense repressor RNA (origin antisense partner of RNAII)
SEQ ID NO:32: pMB1 RNAI selectable Marker, RNAI RNA (Sense strand)
SEQ ID NO:33: IncB RNAI antisense repressor RNA (IncB plasmid origin RNAII antisense partner)
SEQ ID NO:34: IncB RNAI selectable Marker. DraIII-KpnI restriction fragment
SEQ ID NO:35: IncB RNAII-SacB. PstI-MamI restriction fragment
SEQ ID NO:36: CpG free RNA-OUT selection marker—flanked by KpnI and BglII-EcoRI sites
SEQ ID NO:37: CpG free R6K gamma—RNA-OUT bacterial region (CpG free R6K origin-CpG free RNA-OUT selection marker)—flanked by EcoRI-SphI and BglII-EcoRI sites
SEQ ID NO:38: CpG free ColE2 bacterial region (CpG free ssiA-CpG free ColE2 origin-CpG free RNA-OUT selection marker)-flanked by EcoRI-SphI and BglII-EcoRI sites
SEQ ID NO:39: NTC9385Ra-O2 vector backbone
SEQ ID NO:40: NTC9385Ra-O1 vector backbone
SEQ ID NO:41: NTC9385R-BE vector backbone
SEQ ID NO:42: Pmin minimal pUC replication origin
SEQ ID NO:43: pUC (0.85) Bacterial region [NheI site—trpA terminator-Pmin pUC replication origin (minimal)-RNA-OUT-KpnI site]
SEQ ID NO:44: artificial sequence including a PL promoter
A405: Absorbance at 405 nanometers
AF: Antibiotic-free
APC: Antigen Processing Cell, for example, langerhans cells, plasmacytoid or conventional dendritic cells
Approximately: As used herein, the term “approximately” or “about,” as applied to one or more values of interest, refers to a value that is the same or similar to a stated reference value
BAC: Bacterial artificial chromosome
Bacterial region: Region of a plasmid vector required for propagation and selection in the bacterial host
BE: Boundary element: Eukaryotic sequence that that blocks the interaction between enhancers and promoters. Also referred to as insulator element. An example is the AT-rich unique region upstream of the CMV enhancer SpeI site that can function as an insulator/boundary element (Angulo A, Kerry D, Huang H, Borst E M, Razinsky A, Wu J et al. 2000 J Virol 74: 2826-2839)
bp: basepairs
ccc: Covalently Closed Circular
cI: Lambda repressor
cITs857: Lambda repressor further incorporating a C to T (Ala to Thr) mutation that confers temperature sensitivity. cITs857 is a functional repressor at 28-30° C., but is mostly inactive at 37-42° C. Also called cI857
CmR: Chloramphenicol resistance
cmv: Cytomegalovirus
CMV promoter boundary element: AT-rich region of the human cytomegalovirus (CMV) genome between the UL127 open reading frame and the major immediate-early (MIE) enhancer. Also referred to as unique region (Angulo et al. Supra, 2000)
ColE2-P9 replication origin: a region which is specifically recognized by the plasmid-specified Rep protein to initiate DNA replication. Includes but not limited to ColE2-P9 replication origin sequences disclosed in SEQ ID NO:4: ColE2 Origin (+7), SEQ ID NO:5: ColE2 Origin (+7, CpG free), SEQ ID NO:6: ColE2 Origin (Min) and SEQ ID NO:7: ColE2 Origin (+16) and replication functional mutations as disclosed in Yagura et al 2006, J Bacteriol 188:999-1010 included herein by reference
ColE2 related replication origin: The ColE2-P9 origin is highly conserved across the ColE2-related plasmid family. Fifteen ColE2 related plasmid members including ColE3 are compared in Hiraga et al 1994, J Bacteria 176:7233 and 53 ColE2 related plasmid members including ColE3 are compared in Yagura et al Supra, 2006. These sequences are included herein by reference
ColE2-P9 plasmid: a circular duplex DNA molecule of about 7 kb that is maintained at about 10 to 15 copies per host chromosome. The plasmid encodes an initiator protein (Rep protein), which is the only plasmid-specified transacting factor essential for ColE2-P9 plasmid replication
ColE2-P9 replication origin RNA-OUT bacterial region: Contains a ColE2-P9 replication origin for propagation and the RNA-OUT selection marker. Optionally includes a PAS, for example, the R6K plasmid CpG free ssiA primosomal assembly site (SEQ ID NO:21) or alternative ∅X174 type or ABC type primosomal assembly sites, such as those disclosed in Nomura et al 1991 Gene 108:15
ColE2 plasmid: NTC9385C and NTC9685C vectors disclosed herein, as well as modifications and alternative vectors containing a ColE2-P9 replication origin
delivery methods: Methods to deliver gene vectors [e.g. poly(lactide-co-glycolide) (PLGA), ISCOMs, liposomes, niosomes, virosomes, chitosan, and other biodegradable polymers, electroporation, piezoelectric permeabilization, sonoporation, ultrasound, corona plasma, plasma facilitated delivery, tissue tolerable plasma, laser microporation, shock wave energy, magnetic fields, contactless magneto-permeabilization, gene gun, microneedles, naked DNA injection, hydrodynamic delivery, high pressure tail vein injection, needle free biojector, liposomes, microparticles, microspheres, nanoparticles, virosomes, bacterial ghosts, bacteria, attenuated bacteria, etc] as known in the art and included herein by reference
DNA replicon: A genetic element that can replicate under its own control; examples include plasmids, cosmids, bacterial artificial chromosomes (BACs), bacteriophages, viral vectors and hybrids thereof
E. coli: Escherichia coli, a gram negative bacteria
EGFP: Enhanced green fluorescent protein
EP: Electroporation
Eukaryotic expression vector: A vector for expression of mRNA, protein antigens, protein therapeutics, shRNA, RNA or microRNA genes in a target organism
Eukaryotic region: The region of a plasmid that encodes eukaryotic sequences and/or sequences required for plasmid function in the target organism. This includes the region of a plasmid vector required for expression of one or more transgenes in the target organism including RNA Pol II enhancers, promoters, transgenes and polyA sequences. A eukaryotic region may express protein or RNA genes using one or more RNA Pol II promoters, or express RNA genes using one or more RNA Pol III promoters or encode both RNA Pol II and RNA Pol III expressed genes. Additional functional eukaryotic region sequences include RNA Pol I or RNA Pol III promoters, RNA Pol I or RNA Pol III expressed transgenes or RNAs, transcriptional terminators, S/MARs, boundary elements, etc
FU: Fluorescence units
g: Gram, kg for kilogram
Hr(s): Hour(s)
HTLV-I R: HTLV-I R 5′ untranslated region (UTR). Sequences and compositions were disclosed in Williams, J A 2008 World Patent Application WO2008153733 and included herein by reference
IM: Intramuscular
immune response: Antigen reactive cellular (e.g. antigen reactive T cells) or antibody (e.g. antigen reactive IgG) responses
IncB RNAI: plasmid pMU720 origin encoded RNAI (SEQ ID NO: 33) that represses RNA II regulated targets (Wilson I W, Siemering K R, Praszkier J, Pittard A J. 1997. J Bacteriol 179:742)
kan: Kanamycin
kanR: Kanamycin Resistance gene
Kd: Kilodalton
kozak sequence: Optimized sequence of consensus DNA sequence gccRccATG (R=G or A) immediately upstream of an ATG start codon that ensures efficient tranlation initiation. A SalI site (GTCGAC) immediately upstream of the ATG start codon (GTCGACATG) is an effective Kozak sequence
Minicircle: Covalently closed circular plasmid derivatives in which the bacterial region has been removed from the parent plasmid by in vivo or in vitro intramolecular (cis-) site specific recombination or in vitro restriction digestion/ligation
mSEAP: Murine secreted alkaline phosphatase
Nanoplasmid vector: Vector combining an RNA selection marker with a R6K or ColE2 related replication origin. For example, NTC9385C, NTC9685C, NTC9385R, NTC9685R, NTC9385R-BE, NTC9385Ra-O1 and NTC9385Ra-O2 vectors described herein and modifications thereof
NTC7382 promoter: A chimeric promoter comprising the CMV enhancer-CMV promoter-HTLV R-synthetic rabbit β globin 3′ intron acceptor-exon 2-SRF protein binding site-kozak sequence, with or without an upstream SV40 enhancer. The creation and application of this chimeric promoter is disclosed in Williams J A Supra, 2008 and included herein by reference
NTC8385: NTC8385 and NTC8685 plasmids are antibiotic-free vectors that contain a short RNA (RNA-OUT) selection marker in place of the antibiotic resistance marker (kanR) The creation and application of these RNA-OUT based antibiotic-free vectors are disclosed in Williams, J A Supra, 2008 and included herein by reference
NTC8685: NTC8685 (
OL1: Lambda repressor binding site in the PL promoter (
OD600: optical density at 600 nm
PAS: Primosomal assembly site. Priming of DNA synthesis on a single stranded DNA ssi site. ∅X174 type PAS: DNA hairpin sequence that binds priA, which, in turn, recruits the remaining proteins to form the preprimosome [priB, dnaT, recruits dnaB (delivered by dnaC)], which then also recruits primase (dnaG), which then, finally, makes a short RNA substrate for DNA polymerase I. ABC type PAS: DNA hairpin binds dnaA, recruits dnaB (delivered by dnaC) which then also recruits primase (dnaG), which then, finally, makes a short RNA substrate for DNA polymerase I. See Masai et al, 1990 J Biol Chem 265:15134. For example, the R6K plasmid CpG free ssiA primosomal assembly site (SEQ ID NO:21) or alternative ∅X174 type or ABC type primosomal assembly sites, such as those disclosed in Nomura et al Supra, 1991
PAS-BH: Primosomal assembly site on the heavy (leading) strand
PAS-BH region: pBR322 origin region between ROP and PAS-BL (approximately pBR322 2067-2351)
PAS-BL: Primosomal assembly site on the light (lagging) strand
PBS: Phosphate buffered Saline
PCR: Polymerase Chain Reaction
pDNA: Plasmid DNA
pINT pR pL vector: The pINT pR pL integration expression vector is disclosed in Luke et al 2011 Mol Biotechnol 47:43 and included herein by reference. The target gene to be expressed is cloned downstream of the pL1 promoter (
PL promoter: Lambda promoter left (
Plasmid: An extra chromosomal DNA molecule separate from the chromosomal DNA which is capable of replicating independently from the chromosomal DNA
pMB1 RNAI: pMB1 plasmid origin encoded RNAI that represses RNAII regulated targets (SEQ ID NO: 31; SEQ ID NO:32) that represses RNAII regulated targets such as those described in Grabherr R, Pfaffenzeller I. 2006 US patent application US20060063232 and Cranenburgh R M. 2009; U.S. Pat. No. 7,611,883
Pmin: Minimal 678 bp pUC replication origin SEQ ID NO:42 and functional variants with base substitutions and/or base deletions. Vectors described herein incorporating Pmin include NTC8385-Min and NTC8885MP-U6
Pol: Polymerase
polyA: Polyadenylation signal or site. Polyadenylation is the addition of a poly(A) tail to an RNA molecule. The polyadenylation signal is the sequence motif recognized by the RNA cleavage complex. Most human polyadenylation sites contain an AAUAAA motif and conserved sequences 5′ and 3′ to it. Commonly utilized polyA sites are derived from the rabbit β globin (NTC8685;
pUC plasmid: Plasmid containing the pUC origin
R6K plasmid: NTC9385R, NTC9685R, NTC9385Ra-O1 and RNA9385Ra-O2 vectors disclosed herein, as well as modifications, and alternative R6K vectors known in the art including but not limited to pCOR vectors (Gencell), pCpG-free vectors (Invivogen), and CpG free University of Oxford vectors including pGM169
R6K replication origin: a region which is specifically recognized by the plasmid-specified Rep protein to initiate DNA replication. Includes but not limited to R6K replication origin sequence disclosed as SEQ ID NO:1: R6K Origin, and CpG free versions (SEQ ID NO:22) as disclosed in Drocourt et al U.S. Pat. No. 7,244,609 and incorporated herein by reference
R6K replication origin-RNA-OUT bacterial region: Contains a R6K replication origin for propagation and the RNA-OUT selection marker
Rep: Replication
Rep protein dependent plasmid: A plasmid in which replication is dependent on a replication (Rep) protein provided in Trans. For example, R6K replication origin, ColE2-P9 replication origin and ColE2 related replication origin plasmids in which the Rep protein is expressed from the host strain genome. Numerous additional Rep protein dependent plasmids are known in the art, many of which are summarized in del Solar et al 1998 Microbiol. Mol. Biol. Rev 62:434-464 which is included herein by reference
RNA-IN: Insertion sequence 10 (IS10) encoded RNA-IN, an RNA complementary and antisense to RNA-OUT. When RNA-IN is cloned in the untranslated leader of a mRNA, annealing of RNA-IN to RNA-OUT reduces translation of the gene encoded downstream of RNA-IN
RNA-IN regulated selection marker: A genomically expressed RNA-IN regulated selectable marker. In the presence of plasmid borne RNA-OUT, expression of a protein encoded downstream of RNA-IN is repressed. An RNA-IN regulated selection marker is configured such that RNA-IN regulates either 1) a protein that is lethal or toxic to said cell per se or by generating a toxic substance (e.g. SacB), or 2) a repressor protein that is lethal or toxic to said bacterial cell by repressing the transcription of a gene that is essential for growth of said cell (e.g. murA essential gene regulated by RNA-IN tetR repressor gene). For example, genomically expressed RNA-IN-SacB cell lines for RNA-OUT plasmid propagation are disclosed in Williams, J A Supra, 2008 (SEQ ID NO:23) and included herein by reference. Alternative selection markers described in the art may be substituted for SacB
RNA-OUT: Insertion sequence 10 (IS10) encoded RNA-OUT (SEQ ID NO:24), an antisense RNA that hybridizes to, and reduces translation of, the transposon gene expressed downstream of RNA-IN. The sequence of the core RNA-OUT sequence (SEQ ID NO:24) and complementary RNA-IN SacB genomically expressed RNA-IN-SacB cell lines can be modified to incorporate alternative functional RNA-IN/RNA-OUT binding pairs such as those disclosed in Mutalik et al. 2012 Nat Chem Biol 8:447, including, but not limited to, the RNA-OUT A08/RNA-IN S49 pair, the RNA45 OUT A08/RNA-IN S08 pair, and CpG free modifications of RNA-OUT A08 that modify the CG in the RNA-OUT 5′ TT CGCT sequence to a non-CpG sequence
RNA-OUT Selectable marker: An RNA-OUT selectable marker DNA fragment including E. coli transcription promoter and terminator sequences flanking an RNA-OUT RNA. An RNA-OUT selectable marker, utilizing the RNA-OUT promoter and terminator sequences, that is flanked by DraIII and KpnI restriction enzyme sites, and designer genomically expressed RNA-IN-SacB cell lines for RNA-OUT plasmid propagation, are disclosed in Williams, J A Supra, 2008 (SEQ ID NO:23) and included herein by reference. The RNA-OUT promoter and terminator sequences flanking the RNA-OUT RNA may be replaced with heterologous promoter and terminator sequences. For example, the RNA-OUT promoter may be substituted with a CpG free promoter known in the art, for example the I-EC2K promoter or the P5/6 5/6 or P5/6 6/6 promoters disclosed in Williams, J A Supra, 2008 and included herein by reference
RNA selectable marker: also RNA selection marker. An RNA selectable marker is a plasmid borne expressed non translated RNA that regulates a chromosomally expressed target gene to afford selection. This may be a plasmid borne nonsense suppressing tRNA that regulates a nonsense suppressible selectable chromosomal target as described by Crouzet J and Soubrier F 2005 U.S. Pat. No. 6,977,174 included herein by reference. This may also be a plasmid borne antisense repressor RNA, a non limiting list included herein by reference includes RNA-OUT that represses RNA-IN regulated targets, pMB1 plasmid origin encoded RNAI that represses RNAII regulated targets (SEQ ID NO: 31; SEQ ID NO:32; Grabherr and, Pfaffenzeller Supra, 2006; Cranenburgh R M. Supra, 2009), IncB plasmid pMU720 origin encoded RNAI that represses RNA II regulated targets (SEQ ID NO: 33; SEQ ID NO:34; Wilson et al Supra, 1997), ParB locus Sok of plasmid R1 that represses Hok regulated targets, Flm locus FlmB of F plasmid that represses flmA regulated targets (Morsey M A, 1999 U.S. Pat. No. 5,922,583). An RNA selectable marker may be another natural antisense repressor RNAs known in the art such as those described in Wagner E G H, Altuvia S, Romby P. 2002. Adv Genet 46:361 and Franch T, and Gerdes K. 2000. Current Opin Microbiol 3:159. An RNA selectable marker may also be an engineered repressor RNAs such as synthetic small RNAs expressed SgrS, MicC or MicF scaffolds as described in Na D, Yoo S M, Chung H, Park H, Park J H, Lee S Y. 2013. Nat Biotechnol 31:170
ROP: Repressor of primer
sacB: Structural gene encoding Bacillus subtilis levansucrase. Expression of sacB in gram negative bacteria is toxic in the presence of sucrose
SEAP: Secreted alkaline phosphatase
shRNA: Short hairpin RNA
SR: Spacer region. As used herein, spacer region is the region linking the 5′ and 3′ ends of the eukaryotic region sequences. The eukaryotic region 5′ and 3′ ends are typically separated by the replication origin and selection marker. In simple single RNA Pol II transcription vectors this will be between the RNA Pol II promoter region (5′ to a promoter, enhancer, boundary element, S/MAR) and the RNA Pol II polyA region (3′ to a polyA sequence, eukaryotic transcriptional terminator sequence, boundary element, S/MAR). For example, in NTC9385R (
ssi: Single stranded initiation sequences
SV40 enhancer: Region containing the 72 bp and optionally the 21 bp repeats
target antigen: Immunogenic protein or peptide epitope, or combination of proteins and epitopes, against which an immune response can be mounted. Target antigens may by derived from a pathogen for infectious disease applications, or derived from a host organism for applications such as cancer, allergy, or autoimmune diseases. Target antigens are well defined in the art. Some examples are disclosed in Williams, Supra, 2008 and are included herein by reference
TE buffer: A solution containing approximately 10 mM Tris pH 8 and 1 mM EDTA
Transcription terminator: Bacterial: A DNA sequence that marks the end of a gene or operon for transcription. This may be an intrinsic transcription terminator or a Rho-dependent transcriptional terminator. For an intrinsic terminator, such as the trpA terminator, a hairpin structure forms within the transcript that disrupts the mRNA-DNA-RNA polymerase ternary complex. Alternatively, Rho-dependent transcriptional terminators require Rho factor, an RNA helicase protein complex, to disrupt the nascent mRNA-DNA-RNA polymerase ternary complex. Eukaryotic: PolyA sites are not ‘terminators’, instead internal cleavage at PolyA sites leaves an uncapped 5′ end on the 3′UTR RNA for nuclease digestion. Nuclease catches up to RNA Pol II and causes termination. Termination can be promoted within a short region of the poly A site by introduction of RNA Pol II pause sites (eukaryotic transcription terminator). Pausing of RNA Pol II allows the nuclease introduced into the 3′ UTR mRNA after PolyA cleavage to catch up to RNA Pol II at the pause site. A nonlimiting list of eukaryotic transcription terminators know in the art include the C2×4terminator (Ashfield R, Patel A J, Bossone S A, Brown H, Campbell R D, Marcu K B, Proudfoot N J. 1994. EMBO J 13:5656) and the gastrin terminator (Sato K, Ito R, Baek K H, Agarwal K, 1986. Mol. Cell. Biol. 6:1032). Terminator element may stabilize mRNA by enhancing proper 3′-end processing of mRNA (Kim D, Kim J D, Baek K, Yoon Y, Yoon J. 2003. Biotechnol Prog 19:1620)
Transgene: Target antigen or protein or RNA gene that is cloned into a vector
ts: Temperature sensitive
μg: microgram
μl: microliter
UTR: Untranslated region of a mRNA (5′ or 3′ to the coding region)
VARNA: Adenoviral virus associated RNA, including VAR-NAI (VAI or VA1) and or VARNAII (VAII or VA2) from any Adenovirus serotype, for example, serotype 2, serotype 5 or hybrids thereof
VARNAI: Adenoviral virus associated RNAI, also referred to as VAI, or VA1, from any Adenovirus serotype, for example, serotype 2, serotype 5 or hybrids thereof
Vector: A gene delivery vehicle, including viral (e.g. alphavirus, poxvirus, lentivirus, retrovirus, adenovirus, adenovirus related virus, etc) and nonviral (e.g. plasmid, midge, transcriptionally active PCR fragment, minicircles, bacteriophage, etc) vectors. These are well known in the art and are included herein by reference
Vector backbone: Eukaryotic region and bacterial region of a vector, without the transgene or target antigen coding region
The invention relates generally to plasmid DNA compositions and methods to improve plasmid expression and plasmid production. The invention can be practiced to improve expression of vectors such as eukaryotic expression plasmids useful for gene therapy, genetic immunization and or interferon therapy. The invention can be practiced to improve the copy number of vectors such as eukaryotic expression plasmids useful for gene therapy, genetic immunization and or interferon therapy. It is to be understood that all references cited herein are incorporated by reference in their entirety.
According to one preferred embodiment, the present invention provides for method of increasing in vivo expression of transgene from covalently closed super-coiled plasmid DNA, which comprises modifying the plasmid DNA to replace the pMB1, ColE1 or pBR322 derived replication origin and selectable marker with a replication origin selected from the group consisting of an Pmin minimal pUC replication origin, ColE2-P9 replication origin, ColE2 related replication origin, and R6K replication origin and a RNA selectable marker; transforming the modified plasmid DNA into a Rep protein producing bacterial cell line rendered competent for transformation; and isolating the resultant transformed bacterial cells. The modified plasmid produced from these cells has increased transgene expression in the target organism.
In one preferred embodiment, the spacer region encoded pMB1, ColE1 or pBR322 derived replication origin is replaced with a CpG free ColE2 origin. In another preferred embodiment, a primosome assembly site is incorporated into a ColE2 plasmid DNA backbone to improve plasmid copy number. In yet another preferred embodiment, the pMB1, ColE1 or pBR322 derived replication origin is replaced with a CpG free R6K origin.
The methods of plasmid modification of the present invention have been surprisingly found to improve plasmid expression in the target organism. Increased expression vectors may find application to improve the magnitude of DNA vaccination mediated antigen reactive B or T cell responses for preventative or therapeutic vaccination, increase RNA and or protein transgene levels to improve gene replacement therapy or gene knockdown therapy, increase plasmid based expression levels of DNA vector expressed therapeutic antibodies that neutralize infectious diseases such as influenza, HIV, malaria, hepatitis C virus, tuberculosis, etc.
Plasmid encoded transgene expression in the target organism is preferably increased by employing specific constructs or compositions incorporated in a vector. According to one preferred embodiment, the present invention provides a composition for construction of a vector, comprising a ColE2 origin with at least 90% sequence identity to the sequences set forth as SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, and a RNA selectable marker and a eukaryotic region, wherein the ColE2 origin is operably linked to the RNA selectable marker and eukaryotic region. It has been surprisingly found that this ColE2 origin-RNA selectable marker improves plasmid encoded transgene expression in the target organism. According to another preferred embodiment, the resultant vector of the invention has at least 95% sequence identity to a sequence selected from the group consisting of: SEQ ID NO: 8, SEQ ID NO: 9.
According to another preferred embodiment, the present invention provides a composition for construction of a vector, comprising an R6K origin with at least 90% sequence identity to the sequences set forth as SEQ ID NO: 1, SEQ ID NO: 22, and a RNA selectable marker and a eukaryotic region, wherein the R6K origin is operably linked to the RNA selectable marker and eukaryotic region. It has been surprisingly found that this R6K origin-RNA selectable marker improves plasmid encoded transgene expression in the target organism. According to another preferred embodiment, the resultant vector of the invention has at least 95% sequence identity to a sequence selected from the group consisting of: SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41.
As used herein, the term “sequence identity” refers to the degree of identity between any given query sequence, e.g., SEQ ID NO: 2, and a subject sequence. A subject sequence may, for example, have at least 90 percent, at least 95 percent, or at least 99 percent sequence identity to a given query sequence. To determine percent sequence identity, a query sequence (e.g., a nucleic acid sequence) is aligned to one or more subject sequences using any suitable sequence alignment program that is well known in the art, for instance, the computer program ClustalW (version 1.83, default parameters), which allows alignments of nucleic acid sequences to be carried out across their entire length (global alignment). Chema et al., 2003 Nucleic Acids Res., 31:3497-500. In a preferred method, the sequence alignment program (e.g., ClustalW) calculates the best match between a query and one or more subject sequences, and aligns them so that identities, similarities, and differences can be determined Gaps of one or more nucleotides can be inserted into a query sequence, a subject sequence, or both, to maximize sequence alignments. For fast pair-wise alignments of nucleic acid sequences, suitable default parameters can be selected that are appropriate for the particular alignment program. The output is a sequence alignment that reflects the relationship between sequences. To further determine percent identity of a subject nucleic acid sequence to a query sequence, the sequences are aligned using the alignment program, the number of identical matches in the alignment is divided by the length of the query sequence, and the result is multiplied by 100. It is noted that the percent identity value can be rounded to the nearest tenth. For example, 78.11, 78.12, 78.13, and 78.14 are rounded down to 78.1, while 78.15, 78.16, 78.17, 78.18, and 78.19 are rounded up to 78.2.
According to another preferred embodiment, the present invention provides methods and compositions for production of a Rep protein dependent plasmid vector. Production cell lines providing improved heat inducible PL promoter expression of a Rep protein integrated into the genome and expressed from the heat inducible PL promoter incorporating the OL1-G deletion (SEQ ID NO: 11), or the heat inducible PL promoter incorporating the OL1-G to T substitution (SEQ ID NO: 12). It has been surprisingly found that these promoter modifications improves Rep protein dependent plasmid vector copy number in shake flask and fermentation cultures.
Turning now to the drawings,
The invention also relates to compositions and methods for producing high expression level plasmids. The present invention provides sequences that, when introduced into a vector backbone, increase plasmid expression.
The surprising observation that a ColE2 replication origin-RNA selection marker or R6K replication origin-RNA selection marker can be utilized as a plasmid expression enhancer is disclosed.
As described herein, plasmid expression is increased by replacement of the pMB1, ColE1 or pBR322 derived origin-selection marker bacterial region with an R6K origin-RNA selection marker in the plasmid backbone. In yet another preferred embodiment, the R6K origin is CpG free. In yet another preferred embodiment, the R6K origin is included with an RNA-OUT selection marker. In yet another preferred embodiment, the R6K origin is included with an pMB1 RNAI selection marker. In yet another preferred embodiment, the R6K origin is included with an IncB RNAI selection marker.
In yet another preferred embodiment, plasmid expression is increased by replacement of the pMB1, ColE1 or pBR322 derived origin-selection marker bacterial region with a ColE2 origin-RNA selection marker in the plasmid backbone. In yet another preferred embodiment, the ColE2 origin is CpG free. In yet another preferred embodiment, the ColE2 origin is included with an RNA-OUT selection marker. In yet another preferred embodiment, the ColE2 origin is included with an pMB1 RNAI selection marker. In yet another preferred embodiment, the ColE2 origin is included with an IncB RNAI selection marker. In yet another preferred embodiment, the ColE2 origin is included with a primosome assembly site.
In yet another preferred embodiment, plasmid expression is increased by replacement of the pMB1, ColE1 or pBR322 derived origin-selection marker with a Pmin minimal pUC, ColE2 or a R6K origin in the plasmid backbone spacer region and an RNA selection marker in an intron. In yet another preferred embodiment, the R6K or ColE2 origin is CpG free. In yet another preferred embodiment, the RNA selection marker is the RNA-OUT selection marker. In yet another preferred embodiment, the RNA selection marker is the pMB1 RNAI selection marker. In yet another preferred embodiment, the RNA selection marker is the IncB RNAI selection marker.
The methods of the invention are further illustrated by the following examples. These are provided by way of illustration and are not intended in any way to limit the scope of the invention.
Fermentation:
Fermentations were performed using proprietary fed-batch media (NTC3019, HyperGRO media) in New Brunswick BioFlo 110 bioreactors as described (Carnes and Williams, Supra, 2011). The seed cultures were started from glycerol stocks or colonies and streaked onto LB medium agar plates containing 6% sucrose. The plates were grown at 30-32° C.; cells were resuspended in media, and used to provide approximately 0.1% inoculums for the fermentations that contained 0.5% sucrose to select for RNA-OUT plasmids.
Antibiotic-free RNA-OUT plasmid fermentations were performed in E. coli strain XL1Blue [recAl endAl gyrA96 thi-1 hsdR17 supE44 relAl lac [F′ proAB lacIqZΔM15 Tn10 (Tetr)] (Stratagene, La Jolla, Calif.)] or GT115 [F—mcrA Δ(mrr-hsdRMS-mcrBC) φ801 acZΔM15 ΔlacX74 recAl rspL (StrA) endAl Δdcm uidA(ΔMluI)::pir-116 ΔsbcC-sbcD (Invivogen, San Diego)] strains containing chromosomally integrated pCAH63-CAT RNA-IN-SacB (P5/6 6/6) at the phage lambda integration site as disclosed in Williams, J A Supra, 2008. SacB (Bacillus subtilis levansucrase) is a counterselectable marker which is lethal to E. coli cells in the presence of sucrose. Translation of SacB from the RNA-IN-SacB transcript is inhibited by plasmid encoded RNA-OUT. This facilitates plasmid selection in the presence of sucrose, by inhibition of SacB mediated lethality.
Analytical Methods:
Culture samples were taken at key points and at regular intervals during all fermentations. Samples were analyzed immediately for biomass (OD600) and for plasmid yield. Plasmid yield was determined by quantification of plasmid obtained from Qiagen Spin Miniprep Kit preparations as described (Carnes and Williams, Supra, 2011). Briefly, cells were alkaline lysed, clarified, plasmid was column purified, and eluted prior to quantification. Agarose gel electrophoresis analysis (AGE) was performed on 0.8-1% Tris/acetate/EDTA (TAE) gels as described in Carnes and Williams J A, Supra, 2011.
R6K Background:
The R6K gamma plasmid replication origin requires a single plasmid replication protein π that binds as a monomer to multiple repeated ‘iteron’ sites (seven core repeats containing TGAGNG consensus) and as a dimer to repressive sites [TGAGNG (dimer repress) as well as to iterons with reduced affinity]. Various host factors are used including IHF, DnaA, and primosomal assembly proteins DnaB, DnaC, DnaG (Abhyankar et al 2003 J Biol Chem 278: 45476-45484). The R6K core origin contains binding sites for DnaA and IHF that affect plasmid replication (π, IHF and DnaA interact to initiate replication).
Different versions of the R6K gamma replication origin have been utilized in various eukaryotic expression vectors, for example pCOR vectors (Soubrier et al 1999, Gene Therapy 6:1482) and a CpG free version in pCpGfree vectors (Invivogen, San Diego Calif.), and pGM169 (University of Oxford). Incorporation of the R6K replication origin does not improve expression levels compared to an optimized pUC origin vector (Soubrier et al Supra, 1999). However, use of a conditional replication origin such as R6K gamma that requires a specialized cell line for propagation adds a safety margin since the vector will not replicate if transferred to a patients endogenous flora.
A highly minimalized R6K gamma derived replication origin that contains core sequences required for replication (including the DnaA box and stb 1-3 sites; Wu et al, 1995. J Bacteriol. 177: 6338-6345), but with the upstream π dimer repressor binding sites and downstream π promoter deleted (by removing one copy of the iterons, as with pCpG; see map below) was designed (SEQ ID NO:1) and NTC9685R and NTC9385R expression vectors incorporating it constructed (see Example 3).
Typical R6K production strains incorporate the π protein derivative PIR116 that contains a P106L substitution that increases copy number (by reducing π dimerization; π monomers activate while π dimers repress). Fermentation results with pCOR (Soubrier et al., Supra, 1999) and pCpG plasmids (Hebel H L, Cai Y, Davies L A, Hyde S C, Pringle I A, Gill D R. 2008. Mol Ther 16: S110) were low, around 100 mg/L in PIR116 cell lines.
As expected, fermentation yields of the R6K expression vector NTC9685R-EGFP in R6K plasmid production cell line NTC641642 (GT115-SacB; GT115 modified for RNA-OUT AF vector selection by insertion of pCAH63-CAT RNA-IN-SacB (P5/6 6/6) into the genome. The GT115 genome encoded endogenous π gene P3 promoter constitutively expresses R6K replication protein π containing the pir-116 mutation; Metcalf et al, 1994; Gene 138; 1-7) were low (Table 1). Mutagenesis of the pir-116 replication protein and selection for increased copy number has been used to make new production strains. For example, the TEX2pir42 strain contains a combination of P106L and P42L. The P42L mutation interferes with DNA looping replication repression. The TEX2pir42 cell line improved copy number and fermentation yields with pCOR plasmids with reported yields of 205 mg/L (Soubrier F. 2004. World Patent Application WO2004033664). Methods to improve R6K origin yields are needed.
Other combinations of π copy number mutants have been shown to improve copy number. This includes ‘P42L and P113S’ and ‘P42L, P106L and F107S’ (Abhyankar et al 2004. J Biol Chem 279:6711-6719).
Two cell lines using the endogenous π gene P3 promoter to express π mutants ‘P42L and P113S’ (SEQ ID NO:13) (NTC640722 cell line) and ‘P42L, P106L and F107S’ (SEQ ID NO:14) were constructed and tested for copy number improvement with NTC9685R-EGFP. Two additional cell lines using the PL promoter in addition to the endogenous π gene P3 promoter to express π mutants ‘P42L and P113S’ (NTC641981 cell line) and ‘P42L, P106L and F107S’ (NTC641053 cell line) were made and tested for copy number improvement with NTC9685R-EGFP. R6K production cell lines were made in XL1-Blue SacB (XL1-Blue attλ:P5/6 6/6-RNAIN-SacB, CmR).
These cell lines were constructed as follows. The R6K replication proteins π were cloned into the pINT pR pL integration vectors as described in Luke et al Supra, 2011 and included herein by reference. Constructed R6K Rep protein vectors were integrated into the genome at the HK022 phage attachment site as described in Luke et al, Supra, 2011. Briefly the pINT pINT pR pL R6K Rep vectors were amplified by PCR to delete the R6K replication origin, ligated to form a circle, and integrated into the HK022 attachment site using the pAH69 helper plasmid as described.
The results (Table 1) demonstrated that constitutive expression of ‘P42L and P113S’ or ‘P42L, P106L and F107S’ resulted in much higher levels of NTC9685R-EGFP than the NTC641642 encoded P106L Rep protein. However, constitutive expression from P3 resulted in low overall biomass and plasmid multimerization with P42L, P106L and F107S (RF306, RF314), due to high plasmid levels and resultant metabolic burden during the growth phase.
TABLE 1
2.6 kb NTC9685R-EGFP R6K Nanoplasmid fermentation yields in R6K rep cell lines
Growth
Induced
Final
phase
Growth
phase
Induced
plasmid
Ferm
temp
spec
temp
spec
Final
yield
Plasmid
#
Cell line
Rep Gene
Promoter
(C.)
yielda
(C.)
yielda
OD600
(mg/L)
multimerization
RF310
NTC641642
P106L
Const P3
37
1.1
NA, 37
1.2
43
53
RF323
NTC641642
P106L
Const P3
37
ND
NA, 37
0.9
54
49
Monomer
RF305
NTC640722
P42L-P113S
Const P3
30
3.4
37
3.6
96
345
Monomer
RF321
NTC641981
P42L-P113S
pR PL & P3
32
4.4-5.0
42
2.8
93
259
Monomerb
RF306
NTC641053
P42L-P106L-
pR PL & P3
30
3.1
37
6.6
86
567
Multimer
F107S
RF314
NTC641053
P42L-P106L-
pR PL & P3
32
2.6-4.7
42
7.1
79
558
Multimer
F107S
RF351
NTC661135
P42L-P106L-
pR PL only
32
0.4
42
1.45
88
128
Monomer
F107S
RF326
NTC661135-
P42L-P106L-
pR PL OL1
32
0.64
42
6.7
81
545
Monomer
MUT
F107S
G
RF358
NTC711055
P42L-P106L-
pR PL OL1
32
1
42
5.9
118
690
Monomer
F107S
G
RF359
NTC711231
P42L-P106L-
pR PL OL1
30
1.8
42
8.5
82
695
Monomer
F107S
G to T
NTC640721 = NTC5402-P42L-P106L-F107S
NTC640722 = NTC5402-P42L-P113S
NTC641053 = NTC5402-pR pL P42L-P106L-F107S
NTC641642 = GT115-SacB (relA+) pir116 = P106L
NTC641981 = NTC5402-pR pL P42L-P113S
NTC661135 = NTC54208-pR pL P42L-P106L-F107S (P3-)
NTC661135-MUT = NTG54208-pR pL (OL1-G) P42L-P106L-F107S (P3-)
NTC661134 = NTC5402-pR pL P42L-P113S (P3-)
NTC711055 = NTC54208-pR pL (OL1-G) P42L-P106L-F107S (P3-)
NTC711231 = NTC54208-pR pL (OL1-G to T) P42L-P106L-F107S (P3-)
ND = Not determined
NA = Not applicable
aSpecific Yield = mg plasmid/L/OD600
bSome dimer present
NTC5402 = XL1Blue, SacB
NTC54208 = XL1Blue, SacB, dcm-
Heat inducible versions were then made by deletion of the P3 promoter to determine if PL promoter mediated replication protein induction in a temperature shift improved R6K plasmid production yields and quality by reduction of plasmid copy number and metabolic burden during the reduced temperature growth phase. A strain encoding a deletion of the P3 promoter expressing P42L, P106L and F107S (NTC661135, incorporating a single copy of the pINT pR pL R6K Rep pi P42L-P106L-F107S (P3−) integration vector;
However, excellent results were obtained after fermentation with a second NTC661135 cell line (RF326) in which plasmid copy number was increased 10 fold by temperature shifting, resulting in excellent final plasmid yields of 545 mg/L. PCR amplification and sequencing of the P42L, P106L and F107S expression cassette from the RF326 cell line (NTC661135-MUT) and the RF351 cell line (NTC661135) demonstrated that NTC661135-MUT contained a mutation in the OL1 lambda repressor binding site in the PL promoter (
This mutation was introduced into the pINT pR pL R6K Rep pi P42L-P106L-F107S (P3−) integration vector by PCR mutagenesis and a sequence verified clone incorporating the OL1-G mutation integrated into the genome (NTC711055) as described above. Fermentation evaluation of this cell line with the NTC9685R-EGFP plasmid (Table 1; RF358) demonstrated similar dramatic 6 fold heat inducible plasmid copy number induction, resulting in excellent final plasmid yields of 690 mg/L.
Repressor binding to OL1 is altered by mutations in OL1, such as OL1-G (
The OL1-G to T (V2) mutation was introduced into the pINT pR pL R6K Rep pi P42L-P106L-F107S (P3−) integration vector by PCR mutagenesis and a sequence verified clone incorporating the OL1-G mutation integrated into the genome as described above to create NTC711231. Fermentation evaluation of this cell line with the NTC9685R-EGFP plasmid (Table 1; RF359) demonstrated, similar to OL1G, a dramatic 5 fold heat inducible plasmid copy number induction, resulting in excellent final plasmid yields of 695 mg/L.
Cell lines incorporating the pINT pR pL R6K Rep pi P42L-P106L-F107S (P3−) integration vector containing either the wildtype PL promoter (NTC661135, SEQ ID NO:10), the OL1-G mutation (NTC711055, SEQ ID NO:11) or the OL1-G to T mutation (NTC711231, SEQ ID NO:12) were transformed with the NTC9385R-EGFP plasmid and yields in shake flask determined (Table 2). The results demonstrated the OL1-G and OL1-G to T mutations dramatically improve temperature inducible R6K plasmid yields in shake flask culture. Improved yield with two different R6K plasmids (NTC9385R, Table 2; NTC9685R, Table 1) in either LB shake flask media or HyperGRO fermentation media demonstrates improved temperature inducible R6K plasmid is generic, and is not plasmid or growth media specific. Thus the invention can be utilized with a plurality of R6K origin vectors, in various plasmid growth media described in the art and various temperature induction profiles.
Likewise the pINT pR pL R6K Rep plasmids can be integrated into alternative E. coli strains to create production hosts. Any strain that is acceptable for plasmid production, such as JM108, BL21, DH5, DH1, DH5α, GT115, GT116, DH10B, EC100, can be converted to a high yield temperature inducible R6K plasmid production host by integration of a pINT pR pL R6K Rep plasmid into the genome. The pR pL R6K Rep expression cassette may alternatively be removed from the pINT vector backbone and directly integrated into the chromosome, for example, using Red Gam recombination cloning (for example, using the methods described in Datsenko and Wanner 2000 Proc Natl Acad Sci USA 97:6640-6645). The pR pL R6K Rep expression cassette may alternatively be transferred to a different vector backbone, such as integration vectors that target different phage attachment sites, for example, those described by Haldimann and Wanner 2001, J Bacteriol 183:6384-6393.
TABLE 2
NTC9385R-EGFP LB media shake flask production
yields in R6K production strains
30° C.
32° C.
37° C.
Rep Gene
Spec
Spec
Spec
Cell Line
Rep Gene
Promoter
yielda
yielda
yielda
NTC661135
P42L-P106L-
PR PL
1.2
2.1
0.6
F107S
NTC711055
P42L-P106L-
PR PL
0.5
1.3
9.1
F107S
(OL1-G)
NTC711231
P42L-P106L-
PR PL
1.3
7.0
9.3
F107S
(OL1-G
to T)
aSpecific yield = mg plasmid/L/OD600
These results are surprising since the art teaches that PL promoter mutations in the OL1 binding site such as V2 (OL1-G to T) are constitutively active due to an inability of the lambda repressor to stop expression from the PL promoter (Bailone and Galibert, Supra, 1980). While not limiting the application of the invention, it is possible that the lambda repressor is able to repress the PL promoter through binding to the OL2 and OL3 sites (
The application of two independent OL1 mutations (OL1-G and OL1-G to T) to create cell lines for high yield R6K plasmid production demonstrates the general utility of PL promoters incorporating OL1 mutations to improve heat inducible chromosomal expression of a target protein. Any OL1 mutation is contemplated for use in the current invention. New OL1 mutations can be defined by standard methods known in the art, for example error prone mutagenesis of the OL1 region, with subsequent selection of beneficial OL1 mutations by screening for heat inducible target protein production. The target protein can be a Rep protein as described herein, or a fluorescent marker, or any target protein or RNA. Thus application of PL promoters incorporating OL1 mutations is contemplated generally as a platform for improved heat inducible chromosomal expression of any recombinant protein or RNA. This can be applied to improve heat inducible chromosomal expression of any recombinant protein or RNA using either shake flask (Table 2) or fermentation (Table 1) culture.
These cell lines may also be used to produce alternative R6K plasmids, such as CpGfree vectors, pCOR vectors, pGM169, etc. PL promoter vectors with the OL1 mutations may be used to improve expression of alternative target proteins or mRNAs from the genome.
These cell lines may also be used to produce alternative Rep protein dependent plasmids, such as ColE2-P9 replication origin plasmids (Examples 2 and 3), ColE2 related replication origin plasmids, etc. Numerous additional Rep protein dependent plasmids known in the art may also be produced using the cell lines of the invention. Many Rep protein dependent plasmids are described in del Solar et al Supra, 1998 which is included herein by reference.
Heat inducible target protein production may be further improved, by further mutating OL1-G and OL1-G to T or an alternative OL1 mutation to incorporate a mutation in the PL-10 GATACT sequence to make it more closely match the consensus TATAAT (−35 is already consensus TTGACA (
Alternative temperature sensitive (ts) lambda repressors (cI) may be substituted for the cITs857 mutation utilized in the pINT vectors. Multiple alternative ts lambda repressors have been defined (for example, see Lieb M. 1979 J Virol 32:162 incorporated herein by reference) or new ts lambda repressors may be isolated by screening for temperature sensitive cI function.
Alternative integration methods rather than the described pINT pR pL integration vectors may be utilized such as integration of the pR pL expression cassette into the genome at defined sites using Red Gam recombination cloning (for example, using the methods described in Datsenko and Wanner Supra, 2000).
Similar to plasmid R6K, the ColE2 replication origin is separate from the replication protein, so the ColE2 replication origin theoretically may be utilized to construct Rep protein dependent plasmids. Here application of the ColE2 replication origin, using ColE2-P9 as an example, to produce ColE2 Rep protein dependent plasmids is demonstrated (Example 3).
ColE2 Background:
The ColE2 replication origin (for example, ColE2-P9) is highly conserved across the ColE2-related plasmid family (15 members are compared in Hiraga et al Supra, 1994, and 53 ColE2 related plasmid members including ColE3 are compared in Yagura et al Supra, 2006, both references are included herein by reference). Plasmids containing this origin are normally 10 copies/cell (low copy #). For application in gene therapy or DNA vaccination vectors, the copy number of ColE2 replication origin vectors needs to be improved dramatically.
Expression of the ColE2-P9 replication (Rep) protein is regulated by antisense RNA (RNAI). Copy number mutations have been identified that interfere with this regulation and raise the copy number to 40/cell (Takechi et al 1994 Mol Gen Genet 244:49-56).
pINT pR pL ColE2 Rep Protein Cell Line NTC641711:
The ColE2 Rep protein (SEQ ID NO:15) was expressed using the heat inducible pINT pR pL vector as described in Example 1. The ColE2 RNAI region was removed and replaced with an optimal kozak-ATG region. This modification deletes the RNAI −10 promoter box. The Rep internal RNAI −35 box (Yasueda et al 1994 Mol Gen Genet 244: 41-48) was mutagenized (from (opposite strand) TTGAAG to CTGAAG) to lower the consensus. A high copy mutation in the Rep coding region (C139T; Nagase et al 2008 Plasmid 59:36-44) was also incorporated.
These changes do not alter the Rep protein amino acid sequence (SEQ ID NO:15).
The ColE2 Rep gene was PCR amplified from CGSC Strain #8203 with following primers
15061101:
(SEQ ID NO: 26)
ggaacgggatccagaaggagatatacatatgagtgccgtacttcagcgct
tcaggga
15061102:
(SEQ ID NO: 27)
ggaacggaattcttatcattttgcgagatctggatcacat
The 920 bp PCR product was digested with BamHI/EcoRI and cloned into BamHI/EcoRI digested pINT pR pL BamHI/EcoRI (3766, polylinker). Recombinant clones were selected by restriction digestion and sequence verified. The map of the resultant pINT pR pL CoE2 Rep integration vector is shown in
A kanR ColE2-P9 replication origin fluorescent reporter plasmid (pDNAVACCUltra5-C2-P5/6,4/6-T7RBS EGFP) was constructed to select for copy number improving mutations. The 1067 bp pUC replication origin was removed from the kanR pDNAVACCUltra5-P5/6,4/6-T7RBS EGFP vector (the pDNAVACCUltra5-EGFP vector disclosed in Williams J A, 2006 World patent application WO06078979, modified to express the EGFP reporter in E. coli utilizing the weak constitutive P5/6,4/6 promoter disclosed in Lissemore J L, Jankowski J T, Thomas C B, Mascotti D P, deHaseth P L. 2000. Biotechniques 28: 82-89 and included herein by reference) by NheI-DraIII digestion, and replaced with a 132 bp ColE2-P9 replication origin (+7-ssiA; see below). Recombinant clones were recovered in cell line NTC641711 and the ColE2 origin confirmed by restriction digestion and sequence verification. This demonstrates that the ColE2-P9 Rep protein cell line NTC641711 can be used to select and propagate ColE2 replication origin containing plasmids.
ColE2 Rep Protein Mutagenesis, Selection of Copy Number Increasing Mutants
Background:
The ColE2 Rep protein binds as a monomer to the ColE2 replication origin. However, Rep protein exists mostly as a dimer in solution; Rep dimerization will limit the amount of active monomeric Rep which is hypothesized will maintain ColE2 plasmid at a low copy number (Han M, Aoki K, Yagura M, Itoh T. 2007. Biochem Biophys Res Commun 353:306). Copy number autoregulation by Rep protein dimerization is a common copy number control mechanism. Significantly, R6K Rep protein mutations such as P106L (PIR116) utilized in Example 1 that interfere with dimer formation dramatically increase copy number (Abhyankar et al Supra, 2004). It was hypothesized that ColE2 plasmid copy number can also be increased with a dimerization deficient Rep mutation.
Mutagenesis:
ColE2 Rep protein functional domains have been mapped and a region responsible for dimerization defined (
Two colonies were isolated from 30,000 screened cells with significantly higher colony fluorescence. Both cell lines were verified to have improved pDNAVACCUltra5-C2-P5/6,4/6-T7RBS EGFP plasmid copy number in liquid culture demonstrating increased fluorescence corresponds to increased copy number.
The lambda repressor-PL-ColE2 Rep regions from genomic DNA from these two cell lines were amplified by PCR and sequenced to determine the basis for improvement. One colony had a mutation in the lambda repressor which presumably reduces the activity of the repressor leading to Rep protein overexpression. This demonstrates that alternations to the vector backbone that increase PL promoter activity improve ColE2 plasmid copy number. Thus ColE2 copy number, like R6K plasmids, will be improved by making a cell line with the ColE2 Rep protein (or Rep protein copy number improving mutations) expressed from pINT pR pL vectors incorporating the lambda repressor binding site OL1 mutations (OL1-G and OL1-G to T) identified in Example 1.
The second colony had a mutation in the Rep protein (G194D; SEQ ID NO:16). This mutation was introduced back into the pINT pR pL ColE2 Rep vector to create the pINT pR pL ColE2 Rep protein mutant (G194D) (SEQ ID NO:18). The integration plasmid was integrated into NTC54208 (XL1Blue-sacB [dcm-]) to create cell line NTC701131 as described in Example 1. ColE2 plasmid production yields were improved in the ColE2 Rep protein mutant cell line NTC701131, compared to the parental ColE2 Rep protein cell line NTC641711 in both shake flask and fermentation culture (Table 3). This demonstrates that the ColE2 Rep protein, like the R6K Rep protein, can be mutagenized to create copy number improving variants.
Combining the ColE2 Rep protein G194D mutant with pINT pR pL vector incorporating the lambda repressor binding site OL1 OL1-G to T mutation identified in Example 1 further increased copy number (cell line NTC710351=NTC54208-pR pL (OL1-G to T) ColE2 rep G194D) and fermentation production yields (Example 3).
TABLE 3
NTC9385C-Luc plasmid performance in different processes and production cell linesa
ColE2
Plasmid
LB shake flask (37 C.)
Plasmid + Shake flask (37 C.) c
HyperGRO fermentation
production
Spec
Spec
Spec
cell line
OD600
mg/L
yield b
OD600
mg/L
yield b
OD600
mg/L
yield b
NTC641711
3.4
1.4
0.4
13.0
12.3
0.93
148
61
0.4
NTC701131
3.4
3.1
0.9
16.6
17.9
1.1
113
110
1.0
Rep mutant
140
142
1.0
aAll plasmid preparations at harvest were high quality monomer.
b Specific yield = mg plasmid/L/OD600
c Plasmid + media from Thomson Instruments Company
Additional rounds of mutagenesis of the wild type Rep protein, or mutagenesis of mutant Rep protein such as G194D may be performed to further improve copy number. The entire Rep protein or subfragments can be mutagenized (e.g. BamH1-EcoRI fragment for entire Rep protein;
ColE2 Origin Vectors:
The following vectors containing the minimal ColE2-P9 origin (Yagura and Itoh 2006 Biochem Biophys Res Commun 345:872-877) and various origin region modifications were constructed.
+7-ssiA:
This combines the ColE2 origin (+7) (SEQ ID NO:4) with ssiA from plasmid R6K (SEQ ID NO:21). Thus ssiA vectors contain, in addition to the ColE2-P9 origin, a downstream primosome assembly site. Like most plasmid origins, the ColE2 origin contains a primosomal assembly site about 100 bp downstream of the origin (Nomura et al Supra, 1991). This site primes lagging strand DNA replication (Masai et al 1990 J Biol Chem 265:15124-15133) which may improve plasmid copy number or plasmid quality. The ColE2 PAS (ssiA) is similar to PAS-BH (ColE1 ssiA=PAS-BL Marians et al 1982 J Biol Chem 257:5656-5662) and both sites (and PAS-BH) are CpG rich ∅X174 type PAS. A CpG free PAS (ssiA from R6K; Nomura et al Supra, 1991; SEQ ID NO:21) that acts as a dnaA, dnaB dnaC (ABC) primosome on a dnaA box hairpin sequence (Masai et al 1990 J Biol Chem 265:15134-15144) was selected for inclusion in the +7-ssiA vectors. Alternative ABC or ∅X174 type PAS sequences are functionally equivalent to ssiA from R6K, and may be substituted for ssiA in these ColE2 replication origin vectors.
+7-ssiA vectors were constructed by replacing the pUC origin NheI-DraIII region (
+7 (No ssiA):
This deletes the ssiA sequence from +7-ssiA while retaining the ColE2 origin (+7) (SEQ ID NO:4). The ssiA sequence was removed by NheI-MfeI digestion, the sites blunted with Klenow and the vector religated to delete the 64 bp ssiA region. Plasmids were transformed into ColE2 plasmid production host NTC641711. The correct ColE2 vector was identified by restriction digestion and sequence verified.
+7 CpG-ssiA:
This combines the ColE2 replication origin (+7 CpG) (SEQ ID NO:5) with ssiA from plasmid R6K (SEQ ID NO:21). The single CpG in the ColE2 replication origin (Table 4) was removed from the vector by site directed mutagenesis. Plasmids were transformed into ColE2 plasmid production host NTC641711. The correct ColE2 vector was identified by restriction digestion and sequence verified.
+16-ssiA:
This combines the ColE2 replication origin (+16) (SEQ ID NO:7) with ssiA from plasmid R6K (SEQ ID NO:21). A 16 bp region of homology downstream of the ColE2-P9 replication origin is conserved with the ColE3 replication origin. This 16 bp region was added to the vector by site directed mutagenesis. Plasmids were transformed into ColE2 plasmid production host NTC641711. The correct ColE2 vector was identified by restriction digestion and sequence verified.
Min-ssiA:
This combines the ColE2 Min replication origin (SEQ ID NO:6) with ssiA from plasmid R6K (SEQ ID NO:21). This is the minimal 32 bp ColE2 sequence sufficient for replication defined by Yasueda et al 1989 Mol Gen Genet 215:209) (SEQ ID NO:28), extended by an additional 6 bp (Table 4). This vector was created by site directed mutagenesis of the +7-ssiA clone. Plasmids were transformed into ColE2 plasmid production host NTC641711. The correct ColE2 vector was identified by restriction digestion and sequence verified.
The series of plasmids were transformed into ColE2 plasmid production host NTC701131 (Rep mutant). The resultant cell lines were then used determine plasmid copy number and quality (Table 4). Two different backbones were evaluated with the +7-ssiA and +16-ssiA ColE2 replication origins to determine the effect of plasmid sequence alterations.
The results demonstrate that the four replication origin variants containing the ssiA sequence [+7-ssiA; +16-ssiA; +7 (CpG free) ssiA; Min-ssiA] are functional in NTC701131, replicating to a similar copy number (0.73-1×). All plasmids were high quality monomer. This demonstrates that any of these minimal ColE2 origin variants can function as a plasmid replication origin to produce high quality plasmid.
Yagura et al Supra, 2006 have demonstrated that the Min ColE2 Replication origin (SEQ ID NO:28, which is reverse complement of residues 7-38, in
A surprising observation that is contrary to the teachings of Yagura et al Supra, 2006 is that the +7(CpG free)-ssiA ColE2 origin is fully functional. This origin contains a change of a G to C in residue 36 (
The ssiA sequence was not necessary for plasmid replication, although removal of ssiA in +7 (no ssiA) reduced copy number to 55% of +7 (ssiA). Thus inclusion of a primosomal assembly site is beneficial to ColE2 plasmid copy number.
TABLE 4
ColE2 Origin EGFP vector production in
NTC701131 ColE2 production cell lineb
Specific
Cell
Yield
Relative
line
(mg/L/
copy
Originc
ID#
OD600
mg/L
OD600)
numbera
+7-ssiA
071-
13.5
20.7
2.3
1x
(NTC9385C)
020-
11.4
20.4
1.8
2D
12.5
27.2
2.2
(2.1 avg)
+16-ssiA
071-
19.6
23.5
1.2
0.70x
029-
16.5
20.9
1.3
1A
13.1
24.8
1.9
(1.5 avg)
+7(CpG
071-
10.5
25.1
2.4
0.83x
free)-
020-
8.4
11.6
1.4
ssiA
3D
10.1
14.1
1.4
(1.7 avg)
Min-ssiA
071-
11.3
13.7
1.2
0.73x
020-
15.9
37.2
2.3
4D
13.3
14.8
1.1
(1.5 avg)
+7
071-
12.8
17.2
1.3
0.55x
(no ssiA)
020-
13.5
16.4
1.2
5D
13.5
14.5
1.1
(1.2 avg)
+7-ssiA
071-
14.7
22.3
1.5
0.70x
(NTC9685C)
020-
13.2
21.3
1.6
6D
11.7
14.9
1.3
(1.5 avg)
+16-ssiA
071-
13.5
26.9
1.9
0.76x
(VA1-SV40)
020-
11.9
17.7
1.5
7D
13.2
18.8
1.4
(1.6 avg)
aAverage specific yield/+7-ssiA average specific yield (specific yield = mg plasmid/L/OD600)
bPlasmid + media, 37 °C. throughout growth conditions. All plasmid preparations at harvest were high quality monomer
cNTC ColE2 origin sequences
+7: caaaagggcgctgttatctgataaggcttatctggtctcattttg (SEQ ID NO: 4) Min bold underlined
+7 (CpG free): caaaagggGgctgttatctgataaggcttatctggtctcattttg (SEQ ID NO: 5)(C to G change in bold underlined core to eliminate CpG is uppercase double underlined)
Min: The 32 bp minimal origin defined by Yasueda et al Supra, 1989 (SEQ ID NO: 28) is Bold underlined): ggcgctgttatctgataaggcttatctggtctcatttt (SEQ ID NO: 6)
+16: CTGCTCAAAAAGACGCcaaaagggcgctgttatctgataaggcttatctggtctcattttg (SEQ ID NO: 7) Min bold underlined, additional 16 bp in +16 is uppercase
A series of AF eukaryotic expression vectors incorporating these novel ColE2-P9 derived vector origins were made. To replace the pUC origin, the +7 (ssiA) ColE2 origin from Example 2 was selected as well as the R6K origin (SEQ ID NO:1) from Example 1. The features of these vectors (NTC9382C, NTC9385C, NTC9382R, NTC9385R, NTC9682C, NTC9685C, NTC9682R, and NTC9685R) are summarized in Table 5.
NTC9682C, NTC9685C (
NTC9382C, NTC9385C (
NTC9682C, NTC9682R, NTC9382C, and NTC9382R all express the secreted transgene product as TPA fusion proteins while NTC9685C, NTC9685R, NTC9385C, and NTC9385R all express the native transgene product from a vector encoded ATG start codon.
The remainder of the vector sequences is identical between the different vectors, with the exception that the two R vectors NTC9682R and NTC9382R (
An R6K gamma origin vector was constructed by swapping in the R6K gamma origin (SEQ ID NO:1) in a NotI-DraIII R6K origin synthetic gene for the corresponding NotI-DraIII pUC origin region in NTC8685. The NTC9682R, NTC9685R NTC9382R, NTC9385R vectors were made by standard restriction digestion mediated fragment swaps. The ColE2 origin vectors were constructed in a similar fashion, by swapping in the +7 ssiA ColE2 origin in a NheI-DraIII synthetic gene for the corresponding NheI-DraIII pUC origin region. The NTC9682C, NTC9685C, NTC9382C, NTC9385C vectors were made by standard restriction digestion mediated fragment swaps. The 466 bp Bacterial region [NheI site-trpA terminator-R6K Origin-RNA-OUT-KpnI site] for NTC9385R and NTC9685R is shown in SEQ ID NO:19. The 281 bp Bacterial region [NheI site-ssiA-ColE2 Origin (+7)-RNA-OUT-KpnI site] for NTC9385C and NTC9685C is shown in SEQ ID NO:20.
High fermentation yields in HyperGRO media are obtained with these vectors. For example 695 mg/mL with NTC9685R-EGFP in R6K production cell line NTC711231 (Table 1) and 672 mg/L with NTC9385C-EGFP in ColE2 production cell line NTC710351.
These are just a few possible nonlimiting vector configurations. Many alternative vector configurations incorporating the novel R6K or ColE2 origin vector modifications may also be made, including but not limited to vectors with alternative selection markers, alternative promoters, alternative terminators, and different orientations of the various vector-encoded elements or alternative R6K or ColE2 origins as described in Examples 1 and 2.
TABLE 5
NTC9382C, NTC9385C, NTC9382R, NTC9385R, NTC9682C,
NTC9685C, NTC9682R, and NTC9685R vectors
VA RNAI
SV40
Transgene
Vector
Origin
present
enhancer
targeting
NTC9382C
ColE2-P9
No
No
Secretion (TPA)
NTC9382R
R6K
No
No
Secretion (TPA)
NTC9682C
ColE2-P9
Yes
Yes
Secretion (TPA)
NTC9682R
R6K
Yes
Yes
Secretion (TPA)
NTC9385C
ColE2-P9
No
No
Native
(SEQ ID NO: 8)
NTC9385R
R6K
No
No
Native
(SEQ ID NO: 2)
NTC9685C
ColE2-P9
Yes
Yes
Native
(SEQ ID NO: 9)
NTC9685R
R6K
Yes
Yes
Native
(SEQ ID NO: 3)
An example strategy for cloning into these vectors is outlined below.
GTCGACATG--------Gene of interest----Stop codon
SalI
------AGATCT
BglII
For the NTC9385C, NTC9685C, NTC9385R, and NTC9685R vectors, the ATG start codon (double underlined) is immediately preceded by a unique SalI site. The SalI site is an effective Kozak sequence for translational initiation. In NTC9382C, NTC9682C, NTC9382R, and NTC9682R, the SalI site is downstream in frame with the optimized TPA secretion sequence (SEQ ID NO:25). The TPA ATG start codon is double underlined and the SalI site single underlined. SEQ ID NO:25: TPA secretion sequence atggatgcaatgaagagagggctctgctgtgtgctgctgctgtgtggagcagtctt cgtttcgcccagcggtaccggatccgtcgac
For precise cloning, genes are copied by PCR amplification from clones, cDNA, or genomic DNA using primers with SalI (5′ end) and BglII (3′ end) sites. Alternatively, genes are synthesized chemically to be compatible with the unique SalI/BglII cloning sites in these vectors.
For NTC9385C, NTC9685C, NTC9385R, and NTC9685R, the start codon ATG may immediately follow the SalI site (GTCGACATG) since the SalI site is a high function Kozak sequence. For all vectors one or two stop codons (preferably TAA or TGA) may be included after the open reading frame, prior to the BglII site. A PCR product or synthetic gene designed for NTC9385C, NTC9685C, NTC9385R, and NTC9685R is compatible with, and can also be cloned into, the NTC9382C, NTC9682C, NTC9382R, and NTC9682R vectors.
EGFP and muSEAP transgene versions NTC9385C, NTC9685C, NTC9385R, and NTC9685R were constructed by standard restriction fragment swaps. The muSEAP gene is secreted using its endogenous secretion signal, while EGFP is cell associated. Expression levels in vitro were determined using EGFP, while expression levels in vivo were determined using muSEAP. Expression levels were compared to the NTC8685 parent vector, the gWIZ vector, and a minicircle comparator.
Adherent HEK293 (human embryonic kidney), A549 (human lung carcinoma), cell lines were obtained from the American Type Culture Collection (Manassas, Va., USA). Cell lines were propagated in Dulbecco's modified Eagle's medium/F12 containing 10% fetal bovine serum and split (0.25% trypsin-EDTA) using Invitrogen (Carlsbad, Calif., USA) reagents and conventional methodologies. For transfections, cells were plated on 24-well tissue culture dishes. plasmids were transfected into cell lines using Lipofectamine 2000 following the manufacturer's instructions (Invitrogen).
Total cellular lysates for EGFP determination were prepared by resuspending cells in cell lysis buffer (BD Biosciences Pharmingen, San Diego, Calif., USA), lysing cells by incubating for 30 min at 37° C., followed by a freeze-thaw cycle at −80° C. Lysed cells were clarified by centrifugation and the supernatants assayed for EGFP by FLX800 microplate fluorescence reader (Bio-Tek, Winooski, Vt., USA). The results are summarized in
Groups of five mice were injected with plasmid DNA in an IACUC-approved study. Five micrograms of muSEAP plasmid in 25 or 50 μL of phosphate-buffered saline (PBS) was injected intramuscularly (IM) into a tibialis cranialis muscles of female BALB/c mice or ND4 Swiss Webster mice (6 to 8 weeks old) followed by Ichor TriGrid electroporation. SEAP levels in serum were determined using the Phospha-light SEAP Reporter Gene Assay System from Applied Biosystems (Foster City, Calif.) according to the manufacturer's instructions. The results are summarized in
The NTC9385C, NTC9685C, NTC9385R, and NTC9685R vectors had similar expression to the parent NTC8685 vector in vitro, and higher expression than the gWIZ comparator (
TABLE 6
gWIZ and NTC9385C Nanoplasmid expression compared to NTC8685
% NTC8685
% NTC8685
% NTC8685
% NTC8685
% NTC8685
expression
expression
expression
expression
expression
T = 7 days
T = 7 days
T = 28 days
T = 28 days
Plasmid
in vitro a
BALB/c b
ND4 b
BALB/c b
ND4 b
gWIZ
58
59
57
21
57
NTC8385
NA
NA
101
NA
101
NTC9385C
92
377
349
150
233
Minicircle c
NA
89
NA
40
NA
a 100 ng/well EGFP transgene vectors transfected with lipofectamine into HEK293 cells
b murine SEAP (muSEAP) transgene vectors in 8-10 week old BALB/c or ND4 Swiss Webster female mice, 5 μg dose with EP intramuscular into one anterior tibialis muscle followed by Ichor TriGrid electroporation. 25 μL dose for ND4 mice, 50 μL dose for BALB/c.
c Minicircle equivalent to NTC9385C or NTC9385R, with NheI-KpnI region containing the replication origin and RNA-OUT selection marker (bacterial region) removed from NTC8385-muSEAP by SpeI/NheI digestion, gel purification of the eukaryotic region, in vitro ligation and supercoiling with DNA gyrase. The SpeI site is the same site used to truncate the CMV promoter to make NTC8685 and the NTC9385C-muSEAP vector so the minicircle eukaryotic region is the same as NTC9385C-muSEAP, the difference being the C2 and RNA-OUT region including the KpnI site is deleted in the minicircle.
NA = Not assayed
This improved in vivo expression was not specific to the CMV promoter. Versions of NTC8685-muSEAP and NTC9385C-muSEAP were constructed in which the murine creatine kinase (MCK) promoter (3 copies of the MCK Enhancer upstream of the MCK promoter and 50 bp of the MCK exon 1 leader sequence; Wang B, Li J, Fu F H, Chen C, Zhu X, Zhou L, Jiang X, Xiao X. 2008. Gene Ther 15:1489) was substituted for the CMV promoter. The swaps replaced the entire CMV enhancer CMV promoter-exon 1 leader (NTC8685: from a XbaI site immediately after the SV40 enhancer to a SacII site in the CMV derived exon 1 leader sequence
While the basis for expression improvement is unknown, it is not simply due to the size difference between the parent pUC origin vectors and the modified R6K origin-RNA selection marker or ColE2 origin-RNA selection marker vectors of the invention, since expression was not improved with a minicircle comparator vector that contains no bacterial region (Table 6). This demonstrates improved in vivo expression with the R6K origin-RNA selection marker or ColE2 origin-RNA selection marker vectors is not the result of simple elimination of a threshold amount of bacterial region sequences.
Reduction of the vector spacer region size as described herein by replacement of the spacer region replication origin and selection marker with the R6K, ColE2 origin-RNA selection marker vectors of the invention will also increase the duration of in vivo expression since expression duration is improved with plasmid vectors in which the bacterial region is removed (minicircle) or replaced with a spacer region of up to at least 500 bp (Lu J, Zhang F, Xu S, Fire A Z, Kay M A. 2012. Mol Ther 20:2111-9). Thus the replicative minicircle vectors of the invention also have additional utility for applications requiring extended duration expression, such as: liver gene therapy using hydrodynamic delivery with transgenes such as α−1 antitrypsin (AAT) for AAT deficiency, Coagulation Factor VIII for Hemophilia A Therapy or Coagulation Factor IX for Hemophilia B Therapy etc: lung gene therapy with transgenes such as Cystic fibrosis transmembrane conductance regulator (CFTR) for cystic fibrosis etc; muscle gene therapy with transgenes such as the GNE gene for Hereditary inclusion body myopathies (HIBM), or dystrophin or dystrophin minigenes for duchenne muscular dystrophy (DMD).
NTC8685 (SR=1465 bp) has much lower expression than NTC9385R (SR=466 bp) and NTC9385C (SR=281 bp). A minimal pUC origin vector was constructed with an 866 bp spacer region (NTC8385-Min; contains Pmin minimal pUC origin-RNA-OUT). These vectors were tested for expression in vitro (lipofectamine 2000 delivery) and in vivo after intradermal electroporation delivery. As with Intramuscular injection (Example 3), the results (Table 7) demonstrated ColE2 and R6K origin vector dramatically improved in vivo expression after intradermal delivery compared to NTC8685. For example the NTC9385C vector was unexpectedly improved 2.7 to 3.1× compared to NTC8685 while the NTC9385R vector was unexpectedly improved 5.3 to 6.3× that of NTC8685 (Table 7). The 866 bp minimal pUC origin vector also improved expression to 1.4-1.9× that of NTC8685. This demonstrates improved in vivo expression with the NTC9385C and NTC9385R vectors is not limited to muscle tissue, and is observed also after intradermal delivery. Inclusion of the C2×4 eukaryotic transcription terminator in the NTC9385C vector further improved in vivo expression to 2.9 to 4.1× compared to NTC8685. This demonstrates improved in vivo expression with Nanoplasmid vectors may be obtained with alternative/additional sequences flanking the bacterial region.
A NTC9385R derivative was made in which the RNA-OUT antibiotic free marker was transferred to the intron (NTC9385Ra-O2 SEQ ID NO:39; RNA-OUT SEQ ID NO:23) inserted into the unique HpaI site in the intron (SEQ ID NO: 30). This vector encodes the R6K replication origin in the spacer region (SR=306 bp). To determine splicing accuracy NTC9385Ra-O2-EGFP was transfected into the A549 cell line and cytoplasmic RNA isolated. The RNA was reverse transcribed using an EGFP specific primer, and PCR amplified using Exon 1 and Exon 2 specific primers. The resultant PCR product (a single band) was determined by sequencing to be the correct spliced exon1-exon2 fragment. This demonstrated that intronic RNA-OUT is accurately removed by splicing and does not interfere with splicing accuracy. NTC9385Ra-O2-EGFP also demonstrated improved in vivo expression compared to NTC8685 (Table 7: 1.6-3.5×). This demonstrates that Nanoplasmid vectors with improved expression of the current invention may encode the RNA selection marker in the intron rather than the spacer region.
The improved expression level after intradermal delivery demonstrates the application of Nanoplasmid vectors of the invention for cutaneous gene therapy applications, for example, for wound healing, burns, diabetic foot ulcer, or critical limb ischemia therapies using growth factors such as hypoxia inducible factor, hypoxia inducible factor 1α, keratinocyte growth factor, vascular endothelial growth factor (VEGF), fibroblast growth factor-1 (FGF-1, or acidic FGF), FGF-2 (also known as basic FGF), FGF-4, placental growth factor (P1GF), angiotensin-1 (Ang-1), hepatic growth factor (HGF), Developmentally Regulated Endothelial Locus (Del-1), stromal cell derived factor-1 (SDF-1), etc.
TABLE 7
SR vector expression in vitro and in vivo
ID + EP c
ID + EP c
ID + EP c
muSEAP
SR
A549
HEK-293
(pg/mL)
(pg/mL)
(pg/mL)
Vector b
SR a
(bp)
Intron a
(A405) d
(A405) d
T = 4
T = 7
T = 14
NTC8685
T-
1465
HR- β
0.240 ± 0.029
3.002 ± 0.188
1.9 ± 1.2
6.7 ± 4.1
5.0 ± 3.9
VA1-
(1.0x)
(1.0x)
(1.0x)
(1.0x)
(1.0x)
BH-
P-
AF→
NTC8385-
T-Pmin-
866
HR- β
0.495 ± 0.027
2.713 ± 0.177
3.7 ± 2.7
12.4 ± 8.1
7.1 ± 5.2
Mine
AF→
(2.1x)
(0.9x)
(1.9 x)
(1.9 x)
(1.4 x)
NTC9385R
T ←R-
466
HR- β
0.604 ± 0.04
3.036 ± 0.169
12.0 ± 7.4
35.5 ± 31.1
29.9± 23.4
(SEQ ID
AF→
(2.5x)
(1.0x)
(6.3 x)
(5.3 x)
(6.0 x)
NO: 2)
NTC9385C
←C -
281
HR- β
0.267 ± 0.053
2.720 ± 0.228
5.8 ± 3.0
20.8 ± 9.6
13.5 ± 9.8
(SEQ ID
AF→
(1.1x)
(0.9x)
(3.1 x)
(3.1 x)
(2.7x)
NO: 8)
NTC9385C
←C -
281
HR- β
0.214 ± 0.017
2.472 ± 0.197
5.6 ± 2.3
27.7 ± 20.3
16.0 ± 14.3
C2x4
AF→
(0.89x)
(0.82x)
(2.9 x)
(4.1 x)
(3.2x)
NTC9385R
T ←R
306
HR-
0.524 ± 0.071
3.065 ± 0.220
3.6 ± 2.8
23.4 ± 16.5
7.8 ± 8.0
a-O2 (SEQ
←AF- β
(2.2x)
(1.0x)
(1.9 x)
(3.5 x)
(1.6 x)
ID NO: 39)
a Prokaryotic terminator = T; HTLV-IR = HR; B globin 3′ acceptor site = β; RNA-OUT = AF; pUC origin = P; minimal pUC origin = Pmin; R6Kγ origin = R; ColE2-P9 origin = C; C2x4 eukaryotic transcription terminator = C2x4
b All plasmids produced in XL1Blue dcm- host strains. P vectors were produced in dcm- XL1Blue NTC54208; R vectors were produced in dcm- R6K rep cell line NTC711231 (OL1 G to T); C vectors were produced in dcm- ColE2 rep cell line NTC710351 (OL1 G to T).
c Dose = 50 μg in 50 μl saline injected intradermal (ID) with EP on day 0. 6 mice/group. Mean ± SD pg/mL muSEAP reported for day 4, 7 and 14. ( ) Mean muSEAP standardized to NTC8685
d muSEAP plasmid DNA transfected with Lipofectamine 2000. Mean ± SD A405 reported 48 hrs post transfection. ( ) Mean A405 standardized to NTC8685
ePmin minimal pUC origin (SEQ ID NO: 42) and RNA-OUT (bacterial region = SEQ ID NO: 43)
An example Nanoplasmid vector for RNA Pol III directed expression of RNA is shown in
RNA Pol III Nanoplasmid vectors were made by standard restriction digestion mediated fragment swaps to combine either U6 or HI RNA Pol III promoter-target RNA-TTTTTT terminator (Eukaryotic region) with either the 466 bp Bacterial region [NheI site-trpA terminator-R6K Origin-RNA-OUT-KpnI site; SEQ ID NO:19] for NTC9385R-U6 and NTC9385RE-U6 vectors (Table 8) or the 281 bp Bacterial region [NheI site-ssiA-ColE2 Origin (+7)-RNA-OUT-KpnI site; SEQ ID NO:20] for NTC9385C-U6 and NTC9385CE-U6 vectors (Table 8). Versions were modified to express from the U6 promoter eRNA18, a single stranded RNA the expression of which can be quantified by Reverse transcriptase dependent RT-PCR. Vector performance (U6 promoter mediated eRNA18 RNA expression) was determined in total RNA extracted from HEK293 at either 25 or 48 hrs after lipofectamine 2000 mediated transfection as described (Luke J, Simon G G, Soderholm J, Errett J S, August J T, Gale M Jr, Hodgson C P, Williams J A. 2011. J Virol. 85:1370). These results (Table 9) demonstrate Nanoplasmid RNA Pol III vectors direct dramatically improved RNA expression relative to a plasmid RNA Pol III vector (NTC7485-U6-eRNA18) comparator.
Random 22 bp shRNA (KP2F11) versions of NTC9385CE-U6 (903 bp NTC9385CE-U6-KP2F11 shRNA propagated in ColE2 rep cell line NTC710351) and NTC9385R-U6 (855 bp NTC9385R-U6-KP2F11 shRNA propagated in R6K rep cell line NTC711231) were fermented in HyperGRO media as described in Example 1 except fermentation and cultures for inoculations were grown at 37° C. throughout. Final yields were 149 mg/L (NTC9385CE-U6-KP2F11) and 216 mg/L (NTC9385R-U6-KP2F11 shRNA). This demonstrates that Nanoplasmid vectors for RNA Pol III expression (and RNA Pol II; Example 3) have superior manufacturing simplicity and yield compared to shRNA expressing minicircle vectors (Zhao et al 2011. Gene Ther 18:220-224). For example, optimal manufacture of minicircle vectors yields only 5 mg of minicircle per liter culture (Kay M A, He C Y, Chen Z Y 2010. Nat Biotechnol 28:1287-1289).
TABLE 8
RNA Pol III Nanoplasmid vector expression
Transfection 1: RNA
Transfection 2: RNA
isolated 48 hr post
isolated 25 hr post
transfection
transfection
HEK pg
HEK pg
RNA/
RNA/
Pol II
Size
100 ng
HEK
100 ng
HEK
Vector
Enhancer
(bp)
mRNAa
Stdb
mRNAa
Stdb
NTC9385R-EGFP
None
NA
0.0 ± 0.0
0%
(negative control)
NTC8885MP-U6-
SV40
1578c
62.2 ± 5.9
69%
eRNA18
(1.3x)
NTC9385RE-U6-
SV40
1178
119.1 ± 13.9
98%
eRNA18
(2.5x)
NTC9385R-U6-
None
945d
123.7 ± 8.0
82%
eRNA18
(2.6x)
NTC9385CE-U6-
SV40
993
119.0 ± 13.9
83%
eRNA18
(2.5x)
NTC9385C-U6-
None
760e
131.1 ± 10.5
70%
57.3 ± 2.6
127%
eRNA18
(2.7x)
(5.0x)
NTC7485-U6-
SV40
2978
48.0 ± 1.3
100%
11.5 ± 1.5
100%
eRNA18
(1x control)
(100%
(1x)
(control)
control)
apg eRNA18 target/100 ng total RNA isolated post-transfection.
bStandardized mU6 expression compared to NTC7485-U6 shRNA eRNA18 vector (C) = test vector average pg RNA/C vector average pg RNA × test vector size (bp)/2978 × 100%
cPmin minimal pUC origin (SEQ ID NO: 42) and RNA-OUT (bacterial region = SEQ ID NO: 43) with SV40 enhancer. HI promoter version (with shRNA and no SV40) is 1035 bp
dR6K origin and RNA-OUT (bacterial region = SEQ ID NO: 19). H1 promoter version (with shRNA) is 635 bp
eC2 origin and RNA-OUT (bacterial region = SEQ ID NO: 20). H1 promoter version (with shRNA) is 442 bp (FIG. 11)
Expression of Nanoplasmid vectors encoding RNA-OUT in the intron (both orientations of RNA-OUT SEQ ID NO:23 inserted into the unique HpaI site in the intron SEQ ID NO:30; NTC9385Ra-O1 dual and NTC9385Ra-O2 dual) demonstrated robust expression with RNA-OUT in either orientation in the intron (Table 9). Consistent with this, similarly high levels of expression are obtained with NTC9385Ra-O1 (SEQ ID NO:40) and NTC9385Ra-O2 (SEQ ID NO:39) which have opposite orientations of intronic RNA-OUT marker and the R6K origin in the spacer region. Nanoplasmid variants with the pMB1 antisense RNA RNAI (SEQ ID NO:31) with promoter and terminator region (RNAI selectable marker: SEQ ID NO:32 flanked by DraIII-KpnI restriction sites for cloning as described previously for RNA-OUT) substituted for RNA-OUT were constructed and tested for expression to determine if alternative selection markers may be utilized in place of RNA-OUT. The results (Table 9) demonstrate alternative RNA selection markers may be substituted for RNA-OUT. Substitution of RNAI for RNA-OUT in the vector backbone (NTC9385Ra-RNAI-O1) or in the intron in either orientation (NTC9385R-RNAI-O1 and NTC9385R-RNAI-O2) did not reduce expression relative to the corresponding RNA-OUT construct. To determine splicing accuracy, NTC9385R-RNAI-O1-EGFP and NTC9385R-RNAI-O2-EGFP were transfected into the A549 cell line and cytoplasmic RNA isolated from transfected HEK293 and A549 cells using the protein and RNA isolation system (PARIS kit, Ambion, Austin Tex.) and quantified by A260. Samples were DNase treated (DNA-free DNase; Ambion, Austin Tex.) prior to reverse transcription using the Agpath-ID One step RT-PCR kit (Ambion, Austin Tex.) with a EGFP transgene specific complementary strand primer. Intron splicing was determined by PCR amplification of the reverse transcribed cytoplasmic RNA with the exon 1 and exon 2 specific primers. The resultant PCR product (a single band in each case) was determined by sequencing to be the correct spliced exon1-exon2 fragment. This demonstrated that, like intronic RNA-OUT, intronic RNAI in either orientation is accurately removed by splicing and does not interfere with splicing accuracy. This demonstrates that alternative RNA based selection markers could be substituted for RNA-OUT in the spacer region or the intron and that pMB1 RNAI is a preferred RNA based selection marker.
The RNAI transcription unit (SEQ ID NO: 32) may be substituted for the RNA-OUT selection marker (SEQ ID NO: 23) in any of the constructs described in Examples 1-6. Alternatively, the 108 bp RNAI antisense repressor RNA (SEQ ID NO: 31) may be substituted for the 70 bp RNA-OUT antisense repressor RNA (SEQ ID NO: 24) retaining the flanking RNA-OUT transcription control sequences in any of the constructs described in Examples 1-6. RNAI regulated vectors may be grown in RNAII-SacB regulated cell lines further expressing, as required, R6K, ColE2-P9, or ColE2 related rep protein. RNAII-SacB regulated cell lines may be made replacing the RNA-IN sequence in pCAH63-CAT RNA-IN-SacB (P5/6 6/6) with a RNAII target sequence as described in Williams, J A Supra, 2008 included herein by reference. Alternatively, RNAI regulated vectors may be grown in any of the RNAII regulated chromosomal selection marker cell lines disclosed in Grabherr and, Pfaffenzeller Supra, 2006; Cranenburgh Supra, 2009. These cell lines would be modified for expression, as required, of R6K, ColE2-P9, or ColE2 related rep protein.
Another preferred RNA based selection marker, IncB plasmid RNAI (SEQ ID NO:33; SEQ ID NO:34), is shown in
TABLE 9
High level expression is obtained with pMB1
RNAI or RNA-OUT antisense RNA vectors
A549 FU b
HEK293 FU b
SR
(T = 48 hr
(T = 48 hr
Vector (EGFP)
Spacer region a
(bp)
Intron a
mean + SD)
mean + SD)
NTC8685
T-VA1-BH-P-
1465
HR- β c
8546 ± 1163
62068 ± 1760
AF-SV40
(1.0x)
(1.0x)
NTC8385
T-Pmin-AF-BE
866
HR- β c
9364 ± 966
31482 ± 1822
(0.85 kb) d
(1.10x)
(0.51x)
NTC9385C
←C -AF→
281
HR- β c
8860 ± 382
33356 ± 1489
(SEQ ID NO: 8)
(1.04x)
(0.54x)
NTC9385R
←R -AF→
466
HR- β c
16237 ± 2520
55919 ± 6371
(SEQ ID NO: 2)
(1.90x)
(0.90x)
NTC9385Ra-
←R
306
HR-←AF- β
14510 ± 835
49526 ± 2179
O2 (SEQ ID
(1.70x)
(0.80x)
NO: 39)
NTC9385Ra-
←R -AF→
466
HR-AF→- β
13929 ± 1291
56552 ± 2714
O1 dual
(1.63x)
(0.91x)
NTC9385Ra-
←R -AF→
466
HR-←AF- β
12543 ± 245
54379 ± 1244
O2 dual
(1.47x)
(0.89x)
NTC9385Ra-
←R -RNAI→
488
HR-AF→- β
15773 ± 238
55468 ± 6619
RNAI-O1
(1.85x)
(0.89x)
NTC9385R-
←R -AF→
466
HR-← RNAI - β
14296 ± 287
60630 ± 2176
RNAI-O1
(1.67x)
(0.98x)
NTC9385R-
←R -AF→
466
HR- RNAI →- β
12271 ± 466
60691 ± 6482
RNAI-O2
(1.44x)
(0.98x)
a trpA term = T; HTLV-IR = HR; B globin 3′ acceptor site = β; RNA-OUT sucrose selection marker = AF; pUC origin RNAI antisense RNA = RNAI; pUC origin = P; R6K origin = R; ColE2 origin = C; BH = PAS-BH UP = upstream pUC plasmid derived DNA.
b EGFP plasmid DNA transfected with Lipofectamine 2000. Fluorescence units (FU) reported. Mean FU standardized to NTC8685
c HR β intron is 225 bp
d Pmin minimal pUC origin (SEQ ID NO: 42) and RNA-OUT (bacterial region = SEQ ID NO: 43)
Thus, the reader will see that the improved expression vectors of the invention provide for a rational approach to improve plasmid expression.
While the above description contains many examples, these should not be construed as limitations on the scope of the invention, but rather should be viewed as an exemplification of preferred embodiments thereof. Many other variations are possible. For example, the RNA-OUT selectable marker may be substituted with an alternative RNA-OUT sequence variant that functionally binds RNA-IN to repress expression, for example, a CpG free RNA-OUT (SEQ ID NO:36). A CpG free R6K-RNA-OUT bacterial region (SEQ ID NO:37) or CpG free ColE2-RNA-OUT bacterial region (SEQ ID NO: 38) may be utilized. Likewise, the RNA-OUT promoter and/or terminator could be substituted with an alternative promoter and/or terminator. Likewise, the ColE2-P9 or R6K replication origin may be substituted with a ColE2 related replication origin, and propagated in a strain expressing the ColE2 related replication origin replication protein. Likewise, the ColE2-P9 or R6K origin may be substituted with an origin from one of the numerous additional Rep protein dependent plasmids that are know in the art, for example the Rep protein dependent plasmids described in del Solar et al Supra, 1998 which is included herein by reference. Likewise, the vectors may encode a diversity of transgenes different from the examples provided herein, for example, antigen genes for a variety of pathogens, or therapeutic genes such as hypoxia inducible factor, keratinocyte growth factor, factor IX, factor VIII, etc, or RNA genes such as microRNAs or shRNA. Likewise, the eukaryotic region may express RNA from a RNA Pol III promoter as described herein. The orientation of the various vector-encoded elements may be changed relative to each other. The vectors may optionally contain additional functionalities, such as nuclear localizing sequences, and/or immunostimulatory RNA elements as disclosed in Williams, Supra, 2008. The vectors may include a boundary element between the bacterial region and the eukaryotic region, for example, the CMV promoter boundary element upstream of the CMV enhancer (or heterologous promoter enhancer) may be included in the vector design (e.g. NTC9385R-BE; SEQ ID NO: 41). The vectors may include a eukaryotic transcriptional terminator between the bacterial region and the eukaryotic region, for example, the 4×C2 terminator or the gastrin terminator. Likewise, the vectors may utilize a diversity of RNA Pol II promoters different from the CMV promoter examples provided herein, for example, constitutive promoters such as the elongation factor 1 (EF1) promoter, the chicken β-actin promoter, the β-actin promoter from other species, the elongation factor-1α (EF1α) promoter, the phosphoglycerokinase (PGK) promoter, the Rous sarcoma virus (RSV) promoter, the human serum albumin (SA) promoter, the α-1 antitrypsin (AAT) promoter, the thyroxine binding globulin (TBG) promoter, the cytochrome P450 2E1 (CYP2E1) promoter, etc. The vectors may also utilize combination promoters such as the chicken β-actin/CMV enhancer (CAG) promoter, the human or murine CMV-derived enhancer elements combined with the elongation factor 1α (EF1α) promoters, CpG free versions of the human or murine CMV-derived enhancer elements combined with the elongation factor 1α (EF1α) promoters, the albumin promoter combined with an α-fetoprotein MERII enhancer, etc, or the diversity of tissue specific or inducible promoters know in the art such as the muscle specific promoters muscle creatine kinase (MCK), and C5-12 described herein or the liver-specific promoter apolipoprotein A-I (ApoAI).
Accordingly, the scope of the invention should be determined not by the embodiments illustrated, but by the appended claims.
| Patent | Priority | Assignee | Title |
| Patent | Priority | Assignee | Title |
| 5922583, | Nov 30 1995 | NOVARTIS ANIMAL HEALTH CANADA, INC ; Novartis AG | Methods for production of recombinant plasmids |
| 6977174, | Sep 15 1995 | Centelion | Circular DNA molecule with conditional origin of replication, method for preparing the same and use thereof in gene therapy |
| 7244609, | Mar 09 2001 | Cayla | Synthetic genes and bacterial plasmids devoid of CpG |
| 7279313, | Sep 15 1995 | Centelion | Circular DNA molecule having a conditional origin of replication, process for their preparation and their use in gene therapy |
| 7611883, | Nov 20 2003 | BOEHRINGER INGELHEIM RCV GMBH & CO KG | Plasmid maintenance |
| 7807444, | Sep 15 1995 | Centelion | Circular DNA molecule having a conditional origin of replication, process for their preparation and their use in gene therapy |
| 7943377, | Aug 19 2004 | ALDEVRON, L L C | Process for plasmid DNA fermentation |
| 20030161844, | |||
| 20060063232, | |||
| 20070015282, | |||
| 20070141708, | |||
| 20090075357, | |||
| 20090252713, | |||
| 20100184158, | |||
| 20100303859, | |||
| GB2214508, | |||
| WO2004033664, | |||
| WO2006029449, | |||
| WO2008153733, | |||
| WO2009025690, |
| Executed on | Assignor | Assignee | Conveyance | Frame | Reel | Doc |
| Feb 04 2015 | WILLIAMS, JAMES A | Nature Technology Corporation | ASSIGNMENT OF ASSIGNORS INTEREST SEE DOCUMENT FOR DETAILS | 054965 | /0522 | |
| Dec 04 2020 | Nature Technology Corporation | (assignment on the face of the patent) | / | |||
| Dec 16 2022 | Nature Technology Corporation | ALDEVRON, L L C | MERGER SEE DOCUMENT FOR DETAILS | 062770 | /0971 |
| Date | Maintenance Fee Events |
| Dec 04 2020 | BIG: Entity status set to Undiscounted (note the period is included in the code). |
| Date | Maintenance Schedule |
| Feb 21 2026 | 4 years fee payment window open |
| Aug 21 2026 | 6 months grace period start (w surcharge) |
| Feb 21 2027 | patent expiry (for year 4) |
| Feb 21 2029 | 2 years to revive unintentionally abandoned end. (for year 4) |
| Feb 21 2030 | 8 years fee payment window open |
| Aug 21 2030 | 6 months grace period start (w surcharge) |
| Feb 21 2031 | patent expiry (for year 8) |
| Feb 21 2033 | 2 years to revive unintentionally abandoned end. (for year 8) |
| Feb 21 2034 | 12 years fee payment window open |
| Aug 21 2034 | 6 months grace period start (w surcharge) |
| Feb 21 2035 | patent expiry (for year 12) |
| Feb 21 2037 | 2 years to revive unintentionally abandoned end. (for year 12) |