A human gene has been discovered which is genetically altered in human tumor cells. The genetic alteration is gene amplification and leads to a corresponding increase in gene products. Detecting that the gene, designated hMDM2, has become amplified or detecting increased expression of gene products is diagnostic of tumorigenesis. human mdm2 protein binds to human p53 and appears to allow the cell to escape from p53-regulated growth.
|
2. A composition comprising human mdm2 protein and a buffer, said protein consisting of the sequence of SEQ ID NO:2.
5. An isolated human mdm2 protein consisting of the sequence of SEQ ID NO:2, wherein said protein is produced in a non-human cell.
7. An isolated human mdm2 protein consisting of the sequence of SEQ ID NO:2, wherein said protein is made in an in vitro transcription and translation system.
1. A composition comprising human mdm2 protein and a buffer, said protein consisting of the sequence of SEQ ID NO:2, wherein said protein is produced in a non-human cell.
3. A composition comprising human mdm2 protein and a buffer, said protein consisting of the sequence of SEQ ID NO:2, wherein said protein is made in an in vitro transcription and translation system.
4. The composition of
8. The human mdm2 protein of
|
|||||||||||||||||||||||||||||||||||||
This application is a division of application Ser. No. 07/903,103, filed Jun. 23, 1992, which issued as U.S. Pat. No. 5,411,860 on May 2, 1995, which is a continuation-in-part of application Ser. No. 07/867,840 filed Apr. 7, 1992 (now abandoned).
The invention relates to the area of cancer diagnostics and therapeutics. More particularly, the invention relates to the detection of a gene which is amplified in certain human tumors.
According to the Knudson model for tumorigenesis (Cancer Research, 1985, vol. 45, p. 1482), there are tumor suppressor genes in all normal cells which, when they become non-functional due to mutation, cause neoplastic development. Evidence for this model has been found in cases of retinoblastoma and colorectal tumors. The implicated suppressor genes in these tumors, RB and p53 respectively, were found to be deleted or altered in many of the tumors studied.
The p53 gene product, therefore, appears to be a member of a group of proteins which regulate normal cellular proliferation and suppression of cellular transformation. Mutations in the p53 gene have been linked to tumorigenesis, suggesting that alterations in p53 protein function are involved in cellular transformation. The inactivation of the p53 gene has been implicated in the genesis or progression of a wide variety of carcinomas (Nigro et al., 1989, Nature 342:705-708), including human colorectal carcinoma (Baker et al., 1989, Science 244:217-221), human lung cancer (Takahashi et al., 1989, Science 246:491-494; Iggo et al., 1990, Lancet 335:675-679), chronic myelogenous leukemia (Kelman et al, 1989, Proc. Natl. Acad. Sci. USA 86:6783-6787) and osteogenic sarcomas (Masuda et al., 1987, Proc. Natl. Acad. Sci. USA 84:7716-7719).
While there exists an enormous body of evidence linking p53 gene mutations to human tumorigenesis (Hollstein et al., 1991, Science 253:49-53) little is known about cellular regulators and mediators of p53 function.
Hinds et al. (Cell Growth & Differentiation, 1990, 1:571-580), found that p53 cDNA clones, containing a point mutation at amino acid residue 143, 175, 273 or 281, cooperated with the activated ras oncogene to transform primary rat embryo fibroblasts in culture. These mutant p53 genes are representative of the majority of mutations found in human cancer. Hollstein et al., 1991, Science 253:49-53. The transformed fibroblasts were found to produce elevated levels of human p53 protein having extended half-lives (1.5 to 7 hours) as compared to the normal (wild-type) p53 protein (20 to 30 minutes).
Mutant p53 proteins with mutations at residue 143 or 175 form an oligomeric protein complex with the cellular heat shock protein hsc70. While residue 273 or 281 mutants do not detectably bind hsc70, and are poorer at producing transformed foci than the 175 mutant, complex formation between mutant p53 and hsc70 is not required for p53-mediated transformation. Complex formation does, however, appear to facilitate this function. All cell lines transformed with the mutant p53 genes are tumorigenic in athymic (nude) mice. In contrast, the wild-type human p53 gene does not possess transforming activity in cooperation with ras. Tuck and Crawford, 1989, Oncogene Res. 4:81-96.
Hinds et al. supra also expressed human p53 protein in transformed rat cells. When the expressed human p53 was immunoprecipitated with two p53 specific antibodies directed against distinct epitopes of p53, an unidentified Mr 90,000 protein was coimmunoprecipitated. This suggested that the rat Mr 90,000 protein is in a complex with the human p53 protein in the transformed rat cell line.
As mentioned above, levels of p53 protein are often higher in transformed cells than normal cells. This is due to mutations which increase its metabolic stability (Oven et al., 1981, Mol. Cell. Biol. 1:101-110; Reich et al., (1983), Mol. Cell. Biol. 3:2143-2150). The stabilization of p53 has been associated with complex formation between p53 and viral or cellular proteins. (Linzer and Levine, 1979, Cell 17:43-52; Crawford et al., 1981, Proc. Natl. Acad. Sci. USA 78:41-45; Dippold et al., 1981, Proc. Natl. Acad. Sci. USA 78:1695-1699; Lane and Crawford, 1979, Nature (Lond.) 278:261-263; Hinds et al., 1987, Mol. Cell. Biol. 7:2863-2869; Finlay et al., 1988, Mol. Cell. Biol. 8:531-539; Sarnow et al., 1982, Cell. 28:387-394; Gronostajski et al., 1984, Mol. Cell. Biol. 4:442-448; Pinhasi-Kimhi et al., 1986, Nature (Lond.) 320: 182-185; Ruscetti and Scolnick, 1983, J. Virol. 46: 1022-1026; Pinhasi and Oren, 1984, Mol. Cell. Biol. 4:2180-2186; and Sturzbecher et al., 1987, Oncogene 1:201-211.) For example, p53 protein has been observed to form oligomeric protein complexes with the SV40 large T antigen, the adenovirus type 5 E1B-Mr 55,000 protein, and the human papilloma virus type 16 or 18 E6 product. Linzer and Levine, 1979, Cell 17:43-52; Lane and Crawford, 1979, Nature, 278:261-263; Samow et al., 1982, Cell 28:387-394; Werness et al., 1990, Science, 248:76-79. Similarly, complexes have been observed of p105RB (the product of the retinoblastoma susceptibility gene) with T antigen (DeCaprio et al., 1988, Cell 54:275-283), the adenovirus EIA protein (Whyte et al., 1988, Nature 334:124-129) and the E7 protein of human papilloma virus 16 or 18 (Munger et al., 1989, EMBO J. 8:4099-4105). It has been suggested that interactions between these viral proteins and p105RB inactivate a growth-suppressive function of p105RB, mimicking deletions and mutations commonly found in the RB gene in tumor cells. In a similar fashion, oligomeric protein complex formation between these viral proteins and p53 may eliminate or alter the function of p53. Finlay et at., 1989, Cell 57: 1083-1093.
Fakharzadeh et at. (EMBO J. 1991, 10:1565-1569) analyzed amplified DNA sequences present in a tumorigenic mouse cell line (i.e., 3T3DM, a spontaneously transformed derivative of mouse Balb/c cells). Studies were conducted to determine whether any of the amplified genes induced tumorigenicity following introduction of the amplified genes into a nontransformed recipient cell (e.g., mouse NIH3T3 or Rat2 cells). The resulting cell lines were tested for tumorigenicity in nude mice. A gene, designated MDM2, which is amplified more than 50-fold in 3T3DM cells, induced tumorigenicity when overexpressed in NIH3T3 and Rat 2 cells. From the nucleotide and predicted amino acid sequence of mouse MDM2 (mMDM2), Fakharzadeh speculated that this gene encodes a potential DNA binding protein that functions in the modulation of expression of other genes and, when present in excess, interferes with normal constraints on cell growth.
It is an object of the invention to provide a method for diagnosing a neoplastic tissue, such as sarcoma, in a human.
It is another object of the invention to provide a cDNA molecule encoding the sequence of human MDM2.
Yet another object of the invention is to provide a preparation of human MDM2 protein which is substantially free of other human cellular proteins.
Still another object of the invention is to provide DNA probes capable of hybridizing with human MDM2 genes or mRNA molecules.
Another object of the invention is to provide antibodies immunoreactive with human MDM2 protein.
Still another object of the invention is to provide kits for detecting amplification or elevated expression of human MDM2.
Yet another object of the invention is to provide methods for identifying compounds which interfere with the binding of human MDM2 to human p53.
A further object of the invention is to provide a method of treating a neoplastic human cell.
It has now been discovered that hMDM2, a heretofore unknown human gene, plays a role in human cancer. The hMDM2 gene has been cloned and the recombinant derived hMDM2 protein shown to bind to human p53 in vitro. hMDM2 has been found to be amplified in some neoplastic cells and the expression of hMDM2-encoded products has been found to be correspondingly elevated in tumors with amplification of this gene. The elevated levels of MDM2 appear to sequester p53 and allow the cell to escape from p53-regulated growth.
FIG. 1A-C shows the cDNA sequence of human MDM2. In this figure, human and mouse nucleotide (SEQ ID NOS: 1 and 3, respectively) and amino acid sequences (SEQ ID NOS: 2 and 4, respectively) are compared, the mouse sequence being shown only where it differs from the corresponding human sequence.
FIG. 2 shows that hMDM2 binds to p53.
FIG. 3 illustrates the amplification of the hMDM2 gene in sarcomas.
FIG. 4A-C illustrates hMDM2 expression.
It is a discovery of the present invention that a gene exists which is amplified in some human tumors. The amplification of this gene, designated MDM2, is diagnostic of neoplasia or the potential therefor. Detecting the elevated expression of human MDM2-encoded products is also diagnostic of neoplasia or the potential for neoplastic transformation. Over a third of the sarcomas surveyed, including the most common bone and soft tissue forms, were found to have amplified hMDM2 sequences. Expression of hMDM2 was found to be correspondingly elevated in tumors with the gene amplification.
Other genetic alterations leading to elevated hMDM2 expression may be involved in tumorigenesis also, such as mutations in regulatory regions of the gene. Elevated expression of hMDM2 may also be involved in tumors other than sarcomas including but not limited to those in which p53 inactivation has been implicated. These include colorectal carcinoma, lung cancer and chronic myelogenous leukemia.
According to one embodiment of the invention, a method of diagnosing a neoplastic tissue in a human is provided. Tissue or body fluid is isolated from a human, and the copy number of human MDM2 genes is determined. Alternatively, expression levels of human MDM2 gene products can be determined. These include protein and mRNA.
Body fluids which may be tested include urine, serum, blood, feces, saliva, and the like. Tissues suspected of being neoplastic are desirably separated from normal appearing tissue for analysis. This can be done by paraffin or cryostat sectioning or flow cytometry, as is known in the art. Failure to separate neoplastic from non-neoplastic cells can confound the analysis. Adjacent non-neoplastic tissue or any normal tissue can be used to determine a base-line level of expression or copy number, against which the amount of hMDM2 gene or gene products can be compared.
The human MDM2 gene is considered to be amplified if the cell contains more than the normal copy number (2) of this gene per genome. The various techniques for detecting gene amplification are well known in the art. Gene amplification can be determined, for example, by Southern blot analysis, as described in Example 4, wherein cellular DNA from a human tissue is digested, separated, and transferred to a filter where it is hybridized with a probe containing complementary nucleic acids. Alternatively, quantitative polymerase chain reaction (PCR) employing primers can be used to determine gene amplification. Appropriate primers will bind to sequences that bracket human MDM2 coding sequences. Other techniques for determining gene copy number as are known in the art can be used without limitation.
The gene product which is measured may be either mRNA or protein. The term elevated expression means an increase in mRNA production or protein production over that which is normally produced by non-cancerous cells. Although amplification has been observed in human sarcomas, other genetic alterations leading to elevated expression of MDM2 may be present in these or other tumors. Other tumors include those of lung, breast, brain, colorectal, bladder, prostate, liver, skin, and stomach. These, too, are contemplated by the present invention. Non-cancerous cells for use in determining base-line expression levels can be obtained from cells surrounding a tumor, from other humans or from human cell lines. Any increase can have diagnostic value, but generally the mRNA or protein expression will be elevated at least about 3-fold, 5-fold, and in some cases up to about 100-fold over that found in non-cancerous cells. The particular technique employed for detecting mRNA or protein is not critical to the practice of the invention. Increased production of mRNA or protein may be detected, for example, using the techniques of Northern blot analysis or Western blot analysis, respectively, as described in Example 4 or other known techniques such as ELISA, immunoprecipitation, RIA and the like. These techniques are also well known to the skilled artisan.
According to another embodiment of the invention, nucleic acid probes or primers for the determining of human MDM2 gene amplification or elevated expression of mRNA are provided. The probe may comprise ribo- or deoxyfibonucleic acids and may contain the entire human MDM2 coding sequence, a sequence complementary thereto, or fragments thereof. A probe may contain, for example, nucleotides 1-949, or 1-2372 as shown in FIG. 1 (SEQ ID NOS:1). Generally, probes or primers will contain at least about 14 contiguous nucleotides of the human sequence but may desirably contain about 40, 50 or 100 nucleotides. Probes are typically labelled with a fluorescent tag, a radioisotope, or the like to render them easily detectable. Preferably the probes will hybridize under stringent hybridization conditions. Under such conditions they will not hybridize to mouse MDM2. The probes of the invention are complementary to the human MDM2 gene. This means that they share 100% identity with the human sequence.
hMDM2 protein can be produced, according to the invention, substantially free of other human proteins. Provided with the DNA sequence (SEQ ID NO: 1), those of skill in the art can express the cDNA in a non-human cell. Lysates of such cells provide proteins substantially free of other human proteins. The lysates can be further purified, for example, by immunoprecipitation, coprecipitation with p53, or by affinity chromatography.
The antibodies of the invention are specifically reactive with hMDM2 protein. Preferably, they do not cross-react with MDM2 from other species. They can be polyclonal or monoclonal, and can be raised against native hMDM2 or a hMDM2 fusion protein or synthetic peptide. The antibodies are specifically immunoreactive with hMDM2 epitopes which are not present on other human proteins. Some antibodies are reactive with epitopes unique to human MDM2 and not present on the mouse homolog. The antibodies are useful in conventional analyses, such as Western blot analysis, ELISA and other immunological assays for the detection of proteins. Techniques for raising and purifying polyclonal antibodies are well known in the art, as are techniques for preparing monoclonal antibodies. Antibody binding can be determined by methods known in the art, such as use of an enzyme-labelled secondary antibody, staphylococcal protein A, and the like.
According to another embodiment of the invention, interference with the expression of MDM2 provides a therapeutic modality. The method can be applied in vivo, in vitro, or ex vivo. For example, expression may be down-regulated by administering triple-strand forming or antisense oligonucleotides which bind to the hMDM2 gene or mRNA, respectively, and prevent transcription or translation. The oligonucleotides may interact with unprocessed pre-mRNA or processed mRNA. Small molecules and peptides which specifically inhibit MDM2 expression can also be used. Similarly, such molecules which inhibit the binding of MDM2 to p53 would be therapeutic by alleviating the sequestration of p53.
Such inhibitory molecules can be identified by screening for interference of the hMDM2/p53 interaction where one of the binding partners is bound to a solid support and the other partner is labeled. Antibodies specific for epitopes on hMDM2 or p53 which are involved in the binding interaction will interfere with such binding. Solid supports which may be used include any polymers which are known to bind proteins. The support may be in the form of a filter, column packing matrix, beads, and the like. Labeling of proteins can be accomplished according to any technique known in the art. Radiolabels, enzymatic labels, and fluorescent labels can be used advantageously. Alternatively, both hMDM2 and p53 may be in solution and bound molecules separated from unbound subsequently. Any separation technique known in the art may be employed, including immunoprecipitation or immunoaffinity separation with an antibody specific for the unlabeled binding partner.
A cDNA molecule containing the coding sequence of hMDM2 can be used to produce probes and primers. In addition, it can be expressed in cultured cells, such as E. coli, to yield preparations of hMDM2 protein substantially free of other human proteins. The proteins produced can be purified, for example, with immunoaffinity techniques using the antibodies described above.
Kits are provided which contain the necessary reagents for determining gene copy number, such as probes or primers specific for the hMDM2 gene, as well as written instructions. The instructions can provide calibration curves to compare with the determined values. Kits are also provided to determine elevated expression of mRNA (i.e., containing probes) or hMDM2 protein (i.e., containing antibodies). Instructions will allow the tester to determine whether the expression levels are elevated. Reaction vessels and auxiliary reagents such as chromogens, buffers, enzymes, etc. may also be included in the kits.
The human MDM2 gene has now been identified and cloned. Recombinant derived hMDM2 has been shown to bind to human p53. Moreover, it has been found that hMDM2 is amplified in some sarcomas. The amplification leads to a corresponding increase in MDM2 gene products. Such amplification is associated with the process of tumorigenesis. This discovery allows specific assays to be performed to assess the neoplastic or potential neoplastic status of a particular tissue.
The following examples are provided to exemplify various aspects of the invention and are not intended to limit the scope of the invention.
To obtain human cDNA clones, a cDNA library was screened with a murine MDM2 (mMDM2) cDNA probe. A cDNA library was prepared by using polyadenylated RNA isolated from the human colonic carcinoma cell line CaCo-2 as a template for the production of random hexamer primed double stranded cDNA. Gubler and Hoffmann, 1983, Gene 25:263-268. The cDNA was ligated to adaptors and then to the lambda YES phage vector, packaged, and plated as described by Elledge et al. (Proc. Natl. Acad. Sci. USA, 1991, 88:1731-1735). The library was screened initially with a 32 P-labelled (Feinberg and Vogelstein, 1983, Anal. Biochem. 132:6-13) mMDM2 cDNA probe (nucleotides 259 to 1508 (SEQ ID NO: 3) (Fakharzadeh et al., 1991, EMBO J. 10:1565-1569)) and then rescreened with an hMDM2 cDNA clone containing nucleotides 40 to 702 (SEQ ID NO: 1).
Twelve clones were obtained, and one of the clones was used to obtain thirteen additional clones by re-screening the same library. In total, twenty-five clones were obtained, partially or totally sequenced, and mapped. Sequence analysis of the twenty-five clones revealed several cDNA forms indicative of alternative splicing. The sequence shown in FIG. 1 (SEQ ID NO: 1) is representative of the most abundant class and was assembled from three clones: c14-2 (nucleotides 1-949), c89 (nucleotides 467-1737), and c33 (nucleotides 390-2372). The 3' end of the untranslated region has not yet been cloned in mouse or human. The 5' end is likely to be at or near nucleotide 1. There was an open reading frame extending from the 5' end of the human cDNA sequence to nucleotide 1784. Although the signal for translation initiation could not be unambiguously defined, the ATG at nucleotide 312 was considered the most likely position for several reasons. First, the sequence similarity between hMDM2 and mMDM 2 fell off dramatically upstream of nucleotide 312. This lack of conservation in an otherwise highly conserved protein suggested that the sequences upstream of the divergence may not code for protein. Second, an anchored polymerase chain reaction (PCR) approach was employed in an effort to acquire additional upstream cDNA sequence. Ochman et al., 1985, In: PCR Technology: Principles and Applications for DNA Amplification (Erlich, ed.) pp. 105-111 (Stockton, N.Y.). The 5' ends of the PCR derived clones were very similar (within 3 bp) to the 5' ends of clones obtained from the cDNA library, suggesting that the 5' end of the hMDM2 sequence shown in FIG. 1 (SEQ ID NO: 1) may represent the 5' end of the transcript. Third, in vitro translation of the sequence shown in FIG. 1, beginning with the methionine encoded by the nucleotide 312 ATG, generated a protein similar in size to that observed in human cells.
In FIG. 1, hMDM2 and mMDM2 nucleotide (SEQ ID NOS: 1 and 3 respectively) and amino acid (SEQ ID NOS: 2 and 4, respectively) sequences are compared. The mouse sequence is only shown where it differs from the corresponding human sequence. Asterisks mark the 5' and 3' boundaries of the previously published mMDM2 cDNA. Fakharzadeh et al., 1991, EMBO J. 10:1565-1569. Dashes indicate insertions. The mouse and human amino acid sequences are compared from the putative translation start site at nucleotide 3 12 through the conserved stop codon at nucleotide 1784.
Comparison of the human and mouse MDM2 coding regions revealed significant conservation at the nucleotide (80.3%) and amino acid (80.4%) levels. Although hMDM2 and mMDM2 bore little similarity to other genes recorded in current databases, the two proteins shared several motifs. These included a basic nuclear localization signal (Tanaka, 1990, FEBS Letters 271:41-46) at codons 181 to 185, several casein kinase II serine phosphorylation sites (Pinna, 1990, Biochem. et. Biophys. Acta. 1054:267-284) at codons 166 to 169, 192 to 195, 269 to 272, and 290 to 293, an acidic activation domain (Ptashne, 1988, Nature 355:683-689) at codons 223 to 274, and two metal binding sites (Harrison, 1991, Nature 353:715) at codons 305 to 322 and 461 to 478, neither of which is highly related to known DNA binding domains. The protein kinase A domain noted in mMDM2 (Fakharzadeh et al., 1991, EMBO J. 10:1565-1569) was not conserved in hMDM2.
To determine whether the hMDM2 protein could bind to human p53 protein in vitro, an hMDM2 expression vector was constructed from the cDNA clones. The hMDM2 expression vector was constructed in pBluescript SK+(Stratagene) from overlapping cDNA clones. The construct contained the sequence shown in FIG. 1 (SEQ ID NO: 1) from nucleotide 312 to 2176. A 42 bp black beetle virus ribosome entry sequence (Dasmahapatra et at., 1987, Nucleic Acid Research 15:3933) was placed immediately upstream of this hMDM2 sequence in order to obtain a high level of expression. This construct, as well as p53 (El-Deriy et al., 1992, Nature Genetics, in press) and MCC (Kinzler et al., 1991, Science 251:1366-1370)constructs in pBluescript SK+, were transcribed with T7 RNA polymerase and translated in a rabbit reticulocyte lysate (Promega) according to the manufacturer's instructions.
Although the predicted size of the protein generated from the construct was only 55.2 kd (extending from the methionine at nucleotide 312 to nucleotide 1784 (SEQ ID NO:1)), in vitro translated protein migrated at approximately 95 kilodaltons.
Ten μl of lysate containing the three proteins (hMDM2, p53 and MCC), alone or mixed in pairs, were incubated at 37°C for 15 minutes. One microgram (10 μl) of p53 Ab 1 (monoclonal antibody specific for the C-terminus of p53) or Ab2 (monoclonal antibody specific for the N-terminus of p53) (Oncogene Science), or 5 μl of rabbit serum containing MDM2 Ab (polyclonal rabbit anti-hMDM2 antibodies) or preimmune rabbit serum (obtained from the rabbit which produced the hMDM2 Ab), were added as indicated. The polyclonal rabbit antibodies were raised against an E. coli-produced hMDM2-glutathione S-transferase fusion protein containing nucleotides 390 to 816 of the hMDM2 cDNA. Ninety μl of RIPA buffer (10 mM tris [pH 7.5], 1% sodium deoxycholate, 1% NP40, 150 mM NaCl, 0.1% SDS), SNNTE buffer (Levin and George, 1992, submitted for publication), or Binding Buffer (El-Deriy et al., 1992, Nature Genetics, in press) were then added and the mixtures allowed to incubate at 4°C for 2 hours.
Two milligrams of protein A sepharose were added to each tube, and the tubes were rotated end-over-end at 4°C for 1 hour. After pelleting and washing, the immunoprecipitates were subjected to SDS-polyacrylamide gel electrophoresis and the dried gels autoradiographed for 10 to 60 minutes in the presence of Enhance (New England Nuclear).
FIG. 2 shows the co-precipitation of hMDM2 and p53. The three buffers produced similar results, although the co-precipitation was less efficient in SNNTE buffer containing 0.5M NaCl (FIG. 2, lanes 5 and 8) than in Binding Buffer containing 0.1M NaCl (FIG. 2 lanes 6 and 9).
In vitro translated hMDM2, p53 and MCC proteins were mixed as indicated above and incubated with p53 Abl, p53 Ab2, hMDM2 Ab, or preimmune serum. Lanes 1, 4, 7, 10 and 14 contain aliquots of the protein mixtures used for immunoprecipitation. The bands running slightly faster than p53 are polypeptides produced from internal translation initiation sites.
The hMDM2 protein was not immunoprecipitated with monoclonal antibodies to either the C-terminal or N-terminal regions of p53 (FIG. 2, lanes 2 and 3). However, when in vitro translated human p53 was mixed with the hMDM2 translation product, the anti-p53 antibodies precipitated hMDM2 protein along with p53, demonstrating an association in vitro (FIG. 2, lanes 5 and 6). As a control, a protein of similar electrophoretic mobility from another gene (MCC (Kinzler et al., 1991, Science 251: 1366-1370) ) was mixed with p53. No co-precipitation of the MCC protein was observed (FIG. 2, lanes 8 and 9). When an in vitro translated mutant form of p53 (175his) was mixed with hMDM2 protein, a similar co-precipitation of hMDM2 and p53 proteins was also observed.
In the converse of the experiments described above, the anti-hMDM2 antibodies immunoprecipitated p53 when mixed with hMDM2 protein (FIG. 2, lane 15) but failed to precipitate p53 alone (FIG. 5, lane 13). Preimmune rabbit serum failed to precipitate either hMDM2 or p53 (FIG. 2, lane 16).
In order to ascertain the chromosomal localization of hMDM2, somatic cell hybrids were screened with an hMDM2 cDNA probe. A human-hamster hybrid containing only human chromosome 12 was found to hybridize to the probe. Screening of hybrids containing portions of chromosome 12 (Turc-Carel et al., 1986, Cancer Genet. Cytogenet. 23:291-299) with the same probe narrowed the localization to chromosome 12q12-14.
Previous studies have shown that this region of chromosome 12 is often aberrant in human sarcomas. Mandahl et al., 1987, Genes Chromosomes & Cancer 1:9-14; Turc-Carel et al., 1986, Cancer Genet. Cytogenet. 23:291-299; Meltzer et al., 1991, Cell Growth & Differentiation 2:495-501. To evaluate the possibility that hMDM2 was genetically altered in such cancers, Southern blot analysis was performed.
FIG. 3 shows examples of the amplification of the hMDM2 gene in sarcomas. Cellular DNA (5 μg) was digested with EcoRI, separated by agarose gel electrophoresis, and transferred to nylon as described by Reed and Mann (Nucl. Acids Res., 1985, 13:7207-7215). The cellular DNA was derived from five primary sarcomas (lanes 1-4, 6) and one sarcoma cell line (OsA-Cl, lane 5). The filters were then hybridized with an hMDM2 cDNA fragment probe nucleotide 1-949 (see FIG. 1 or SEQ ID NO: 1), or to a control probe which identifies fragments of similar size (DCC gene, 1.65 cDNA fragment). Fearon, 1989, Science 247:49-56. Hybridization was performed as described by Vogelstein et al. (Cancer Research, 1987, 47:4806-4813). A striking amplification of hMDM2 sequences was observed in several of these tumors. (See FIG. 3, lanes 2, 3 and 5). Of 47 sarcomas analyzed, 17 exhibited hMDM2 amplification ranging from 5 to 50 fold. These tumors included 7 to 13 liposarcomas, 7 of 22 malignant fibrous histiocytomas (MFH), 3 of 11 osteosarcomas, and 0 and 1 rhabdomyosarcomas. Five benign soft tissue tumors (lipomas) and twenty-seven carcinomas (colorectal or gastric) were also tested by Southern blot analysis and no amplification was observed.
This example illustrates that gene amplification is associated with increased expression.
FIG. 4A illustrates hMDM2 expression as demonstrated by Northern blot analysis. Because of RNA degradation in the primary sarcomas, only the cell lines could be productively analyzed by Northern blot. RNA was separated by electrophoresis in a MOPS-formaldehyde gel and electrophoretically transferred to nylon filters. Transfer and hybridization were performed as described by Kinzler et at. (Nature, 1988, 332:371-374). The RNA was hybridized to the hMDM2 fragment described in FIG. 3. Ten μg of total RNA derived, respectively, from two sarcoma cell lines (OsA-CL, lane 1 and RC13, lane 2) and the colorectal cancer cell line (CaCo-2) used to make the cDNA library (lane 3). Lane 4 contains 10 μg of polyadenylated CaCo-2 RNA. RNA sizes are shown in kb. In the one available sarcoma cell line with hMDM2 amplification, a single transcript of approximately 5.5 kb was observed (FIG. 4A, lane 1). The amount of this transcript was much higher than in a sarcoma cell line without amplification (FIG. 4A, lane 2) or in a carcinoma cell line (FIG. 4A, lane 3). When purified mRNA (rather than total RNA) from the carcinoma cell line was used for analysis, an hMDM2 transcript of 5.5 kb could also be observed (FIG. 4A, lane 4).
FIG. 4B illustrates hMDM2 expression as demonstrated by Western blot analysis of the sarcoma cell lines RC13 (lane 1), OsA-CL (lane 3), HOS (lane 4), and the carcinoma cell line CaCo-2 (lane 2).
FIG. 4C illustrates hMDM2 expression as demonstrated by Western blot analysis of primary sarcomas. Lanes 1 to 3 contain protein from sarcomas with hMDM2 amplifications, and lanes 4 and 5 contain protein from sarcomas without hMDM2 amplification.
Western blots using affinity purified MDM2 Ab were performed with 50 μg protein per lane as described by Kinzler et al. (Mol. Cell. Biol., 1990, 10:634-642), except that the membranes were blocked in 10% nonfat dried milk and 10% goat serum, and secondary antibodies were coupled to horseradish peroxidase, permitting chemiluminescent detection (Amersham ECL). MDM2 Ab was affinity purified with a pATH-hMDM2 fusion protein using methods described in Kinzler et al. (Mol. Cell. Biol., 1990, 10:634-642). Non-specifically reactive proteins of 85, 120 and 200 kd were observed in all lanes, irrespective of hMDM2 amplification status. hMDM2 proteins, of 97 kd, were observed only in the hMDM2-amplified tumors. Protein marker sizes are shown in kd.
A protein of approximately 97 kilodaltons was expressed at high levels in the sarcoma cell line with hMDM2 amplification (FIG. 4B, lane 3), whereas no expression was evident in two sarcoma cell lines without amplification or in the carcinoma cell line (FIG. 4B, lanes 1, 2 and 4). Five primary sarcomas were also examined by Western blot analysis. Three primary sarcomas with amplification expressed the same size protein as that observed in the sarcoma cell line (FIG. 4C, lanes 1-3), while no protein was observed in the two sarcomas without amplification (FIG. 4C, lanes 4 and 5).
Expression of the hMDM2 RNA in the sarcoma with amplification was estimated to be at least 30 fold higher than that in the other lines examined. This was consistent with the results of Western blot analysis.
The above examples demonstrate that hMDM2 binds to p53 in vitro and is genetically altered (i.e., amplified) in a significant fraction of sarcomas, including MFH, liposarcomas, and osteosarcomas. These are the most common sarcomas of soft tissue and bone. Weiss and Enzinger, 1978, Cancer 41:2250-2266; Malawer et al., 1985, In: Cancer: Principles and Practice of Oncology, DeVita et al., Eds., pp. 1293-1342 (Lippincott, Philadelphia).
Human MDM2 amplification is useful for understanding the pathogenesis of these often lethal cancers.
MDM2 may functionally inactivate p53 in ways similar to those employed by virally encoded oncoproteins such as SV40 T-antigen, adenovirus E1B, and HPV E6. Lane and Bechimol, 1990, Genes and Development 4:1-8; Werness et al., 1990, Science 248:76. Consistent with this hypothesis, no sarcomas with hMDM2 amplification had any of the p53 gene mutations that occur commonly in other tumors. hMDM2 amplification provides a parallel between viral carcinogenesis and the naturally occurring genetic alterations underlying sporadic human cancer. The finding that expression of hMDM2 is correspondingly elevated in tumors with amplification of the gene are consistent with the finding that MDM2 binds to p53, and with the hypothesis that overexpression of MDM2 in sarcomas allows escape from p53 regulated growth control. This mechanism of tumorigenesis has striking parallels to that previously observed for virally induced tumors (Lane and Bechimol, 1990, Genes and Development 4:1-8; Werness et al., 1990, Science 248:76), in which vital oncogene products bind to and functionally inactivate p53.
| __________________________________________________________________________ |
| SEQUENCE LISTING |
| (1) GENERAL INFORMATION: |
| (iii) NUMBER OF SEQUENCES: 4 |
| (2) INFORMATION FOR SEQ ID NO:1: |
| (i) SEQUENCE CHARACTERISTICS: |
| (A) LENGTH: 2372 base pairs |
| (B) TYPE: nucleic acid |
| (C) STRANDEDNESS: double |
| (D) TOPOLOGY: linear |
| (ii) MOLECULE TYPE: cDNA |
| (iii) HYPOTHETICAL: NO |
| (iv) ANTI-SENSE: NO |
| (vi) ORIGINAL SOURCE: |
| (A) ORGANISM: Homo sapiens |
| (H) CELL LINE: CaCo-2 |
| (viii) POSITION IN GENOME: |
| (B) MAP POSITION: 12q12-14 |
| (ix) FEATURE: |
| (A) NAME/KEY: CDS |
| (B) LOCATION: 312..1784 |
| (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1: |
| GCACCGCGCGAGCTTGGCTGCTTCTGGGGCC TGTGTGGCCCTGTGTGTCGGAAAGATGGA60 |
| GCAAGAAGCCGAGCCCGAGGGGCGGCCGCGACCCCTCTGACCGAGATCCTGCTGCTTTCG120 |
| CAGCCAGGAGCACCGTCCCTCCCCGGATTAGTGCGTACGAGCGCCCAGTGCCCTGGCCCG180 |
| GAGAGT GGAATGATCCCCGAGGCCCAGGGCGTCGTGCTTCCGCAGTAGTCAGTCCCCGTG240 |
| AAGGAAACTGGGGAGTCTTGAGGGACCCCCGACTCCAAGCGCGAAAACCCCGGATGGTGA300 |
| GGAGCAGGCAAATGTGCAATACCAACATGTCTGTACCTACTG ATGGTGCT350 |
| MetCysAsnThrAsnMetSerValProThrAspGlyAla |
| 1510 |
| GTAACCACCTCACAGATTCCAGCTTCGGAACAAGAGACCCTG GTTAGA398 |
| ValThrThrSerGlnIleProAlaSerGluGlnGluThrLeuValArg |
| 152025 |
| CCAAAGCCATTGCTTTTGAAGTTATTAAAGTCTGTTGGTGCACAAAAA 446 |
| ProLysProLeuLeuLeuLysLeuLeuLysSerValGlyAlaGlnLys |
| 30354045 |
| GACACTTATACTATGAAAGAGGTTCTTTTTTATCTTGGCCAG TATATT494 |
| AspThrTyrThrMetLysGluValLeuPheTyrLeuGlyGlnTyrIle |
| 505560 |
| ATGACTAAACGATTATATGATGAGAAGCAACAACATATT GTATATTGT542 |
| MetThrLysArgLeuTyrAspGluLysGlnGlnHisIleValTyrCys |
| 657075 |
| TCAAATGATCTTCTAGGAGATTTGTTTGGCGTGCCAAGC TTCTCTGTG590 |
| SerAsnAspLeuLeuGlyAspLeuPheGlyValProSerPheSerVal |
| 808590 |
| AAAGAGCACAGGAAAATATATACCATGATCTACAGGAACTTG GTAGTA638 |
| LysGluHisArgLysIleTyrThrMetIleTyrArgAsnLeuValVal |
| 95100105 |
| GTCAATCAGCAGGAATCATCGGACTCAGGTACATCTGTGAGTGAGAAC 686 |
| ValAsnGlnGlnGluSerSerAspSerGlyThrSerValSerGluAsn |
| 110115120125 |
| AGGTGTCACCTTGAAGGTGGGAGTGATCAAAAGGACCTTGTA CAAGAG734 |
| ArgCysHisLeuGluGlyGlySerAspGlnLysAspLeuValGlnGlu |
| 130135140 |
| CTTCAGGAAGAGAAACCTTCATCTTCACATTTGGTTTCT AGACCATCT782 |
| LeuGlnGluGluLysProSerSerSerHisLeuValSerArgProSer |
| 145150155 |
| ACCTCATCTAGAAGGAGAGCAATTAGTGAGACAGAAGAA AATTCAGAT830 |
| ThrSerSerArgArgArgAlaIleSerGluThrGluGluAsnSerAsp |
| 160165170 |
| GAATTATCTGGTGAACGACAAAGAAAACGCCACAAATCTGAT AGTATT878 |
| GluLeuSerGlyGluArgGlnArgLysArgHisLysSerAspSerIle |
| 175180185 |
| TCCCTTTCCTTTGATGAAAGCCTGGCTCTGTGTGTAATAAGGGAGATA 926 |
| SerLeuSerPheAspGluSerLeuAlaLeuCysValIleArgGluIle |
| 190195200205 |
| TGTTGTGAAAGAAGCAGTAGCAGTGAATCTACAGGGACGCCA TCGAAT974 |
| CysCysGluArgSerSerSerSerGluSerThrGlyThrProSerAsn |
| 210215220 |
| CCGGATCTTGATGCTGGTGTAAGTGAACATTCAGGTGAT TGGTTGGAT1022 |
| ProAspLeuAspAlaGlyValSerGluHisSerGlyAspTrpLeuAsp |
| 225230235 |
| CAGGATTCAGTTTCAGATCAGTTTAGTGTAGAATTTGAA GTTGAATCT1070 |
| GlnAspSerValSerAspGlnPheSerValGluPheGluValGluSer |
| 240245250 |
| CTCGACTCAGAAGATTATAGCCTTAGTGAAGAAGGACAAGAA CTCTCA1118 |
| LeuAspSerGluAspTyrSerLeuSerGluGluGlyGlnGluLeuSer |
| 255260265 |
| GATGAAGATGATGAGGTATATCAAGTTACTGTGTATCAGGCAGGGGAG 1166 |
| AspGluAspAspGluValTyrGlnValThrValTyrGlnAlaGlyGlu |
| 270275280285 |
| AGTGATACAGATTCATTTGAAGAAGATCCTGAAATTTCCTTA GCTGAC1214 |
| SerAspThrAspSerPheGluGluAspProGluIleSerLeuAlaAsp |
| 290295300 |
| TATTGGAAATGCACTTCATGCAATGAAATGAATCCCCCC CTTCCATCA1262 |
| TyrTrpLysCysThrSerCysAsnGluMetAsnProProLeuProSer |
| 305310315 |
| CATTGCAACAGATGTTGGGCCCTTCGTGAGAATTGGCTT CCTGAAGAT1310 |
| HisCysAsnArgCysTrpAlaLeuArgGluAsnTrpLeuProGluAsp |
| 320325330 |
| AAAGGGAAAGATAAAGGGGAAATCTCTGAGAAAGCCAAACTG GAAAAC1358 |
| LysGlyLysAspLysGlyGluIleSerGluLysAlaLysLeuGluAsn |
| 335340345 |
| TCAACACAAGCTGAAGAGGGCTTTGATGTTCCTGATTGTAAAAAAACT 1406 |
| SerThrGlnAlaGluGluGlyPheAspValProAspCysLysLysThr |
| 350355360365 |
| ATAGTGAATGATTCCAGAGAGTCATGTGTTGAGGAAAATGAT GATAAA1454 |
| IleValAsnAspSerArgGluSerCysValGluGluAsnAspAspLys |
| 370375380 |
| ATTACACAAGCTTCACAATCACAAGAAAGTGAAGACTAT TCTCAGCCA1502 |
| IleThrGlnAlaSerGlnSerGlnGluSerGluAspTyrSerGlnPro |
| 385390395 |
| TCAACTTCTAGTAGCATTATTTATAGCAGCCAAGAAGAT GTGAAAGAG1550 |
| SerThrSerSerSerIleIleTyrSerSerGlnGluAspValLysGlu |
| 400405410 |
| TTTGAAAGGGAAGAAACCCAAGACAAAGAAGAGAGTGTGGAA TCTAGT1598 |
| PheGluArgGluGluThrGlnAspLysGluGluSerValGluSerSer |
| 415420425 |
| TTGCCCCTTAATGCCATTGAACCTTGTGTGATTTGTCAAGGTCGACCT 1646 |
| LeuProLeuAsnAlaIleGluProCysValIleCysGlnGlyArgPro |
| 430435440445 |
| AAAAATGGTTGCATTGTCCATGGCAAAACAGGACATCTTATG GCCTGC1694 |
| LysAsnGlyCysIleValHisGlyLysThrGlyHisLeuMetAlaCys |
| 450455460 |
| TTTACATGTGCAAAGAAGCTAAAGAAAAGGAATAAGCCC TGCCCAGTA1742 |
| PheThrCysAlaLysLysLeuLysLysArgAsnLysProCysProVal |
| 465470475 |
| TGTAGACAACCAATTCAAATGATTGTGCTAACTTATTTC CCC1784 |
| CysArgGlnProIleGlnMetIleValLeuThrTyrPhePro |
| 480485490 |
| TAGTTGACCTGTCTATAAGAGAATTATATATTTCTAACTATATAACCCTAGGAATTTAG A1844 |
| CAACCTGAAATTTATTCACATATATCAAAGTGAGAAAATGCCTCAATTCACATAGATTTC1904 |
| TTCTCTTTAGTATAATTGACCTACTTTGGTAGTGGAATAGTGAATACTTACTATAATTTG1964 |
| ACTTGAATATGTAGCTCATCCTTTACACCAACT CCTAATTTTAAATAATTTCTACTCTGT2024 |
| CTTAAATGAGAAGTACTTGGTTTTTTTTTTCTTAAATATGTATATGACATTTAAATGTAA2084 |
| CTTATTATTTTTTTTGAGACCGAGTCTTGCTCTGTTACCCAGGCTGGAGTGCAGTGGGTG2144 |
| ATCTTGGC TCACTGCAAGCTCTGCCCTCCCCGGGTTCGCACCATTCTCCTGCCTCAGCCT2204 |
| CCCAATTAGCTTGGCCTACAGTCATCTGCCACCACACCTGGCTAATTTTTTGTACTTTTA2264 |
| GTAGAGACAGGGTTTCACCGTGTTAGCCAGGATGGTCTCGATCTCCTGACC TCGTGATCC2324 |
| GCCCACCTCGGCCTCCCAAAGTGCTGGGATTACAGGCATGAGCCACCG2372 |
| (2) INFORMATION FOR SEQ ID NO:2: |
| (i) SEQUENCE CHARACTERISTICS: |
| (A) LENGTH: 491 amino acids |
| (B) TYPE: amino acid |
| (D) TOPOLOGY: linear |
| (ii) MOLECULE TYPE: protein |
| ( xi) SEQUENCE DESCRIPTION: SEQ ID NO:2: |
| MetCysAsnThrAsnMetSerValProThrAspGlyAlaValThrThr |
| 151015 |
| SerGlnIleProAlaSerGluGlnGluThrLeuValArgProLys Pro |
| 202530 |
| LeuLeuLeuLysLeuLeuLysSerValGlyAlaGlnLysAspThrTyr |
| 354045 |
| ThrMetLysG luValLeuPheTyrLeuGlyGlnTyrIleMetThrLys |
| 505560 |
| ArgLeuTyrAspGluLysGlnGlnHisIleValTyrCysSerAsnAsp |
| 6570 7580 |
| LeuLeuGlyAspLeuPheGlyValProSerPheSerValLysGluHis |
| 859095 |
| ArgLysIleTyrThrMetIleTyrAr gAsnLeuValValValAsnGln |
| 100105110 |
| GlnGluSerSerAspSerGlyThrSerValSerGluAsnArgCysHis |
| 115120 125 |
| LeuGluGlyGlySerAspGlnLysAspLeuValGlnGluLeuGlnGlu |
| 130135140 |
| GluLysProSerSerSerHisLeuValSerArgProSerThrSerSer |
| 145 150155160 |
| ArgArgArgAlaIleSerGluThrGluGluAsnSerAspGluLeuSer |
| 165170175 |
| GlyGluA rgGlnArgLysArgHisLysSerAspSerIleSerLeuSer |
| 180185190 |
| PheAspGluSerLeuAlaLeuCysValIleArgGluIleCysCysGlu |
| 195 200205 |
| ArgSerSerSerSerGluSerThrGlyThrProSerAsnProAspLeu |
| 210215220 |
| AspAlaGlyValSerGluHisSerGlyAspTrpLe uAspGlnAspSer |
| 225230235240 |
| ValSerAspGlnPheSerValGluPheGluValGluSerLeuAspSer |
| 245250 255 |
| GluAspTyrSerLeuSerGluGluGlyGlnGluLeuSerAspGluAsp |
| 260265270 |
| AspGluValTyrGlnValThrValTyrGlnAlaGlyGluSerAsp Thr |
| 275280285 |
| AspSerPheGluGluAspProGluIleSerLeuAlaAspTyrTrpLys |
| 290295300 |
| CysThrSerCysAsnG luMetAsnProProLeuProSerHisCysAsn |
| 305310315320 |
| ArgCysTrpAlaLeuArgGluAsnTrpLeuProGluAspLysGlyLys |
| 325 330335 |
| AspLysGlyGluIleSerGluLysAlaLysLeuGluAsnSerThrGln |
| 340345350 |
| AlaGluGluGlyPheAspValProAs pCysLysLysThrIleValAsn |
| 355360365 |
| AspSerArgGluSerCysValGluGluAsnAspAspLysIleThrGln |
| 370375380 |
| AlaSerGlnSerGlnGluSerGluAspTyrSerGlnProSerThrSer |
| 385390395400 |
| SerSerIleIleTyrSerSerGlnGluAspValLysGluPheGluArg |
| 405410415 |
| GluGluThrGlnAspLysGluGluSerValGluSerSerLeuProLeu |
| 420425430 |
| AsnAlaI leGluProCysValIleCysGlnGlyArgProLysAsnGly |
| 435440445 |
| CysIleValHisGlyLysThrGlyHisLeuMetAlaCysPheThrCys |
| 450 455460 |
| AlaLysLysLeuLysLysArgAsnLysProCysProValCysArgGln |
| 465470475480 |
| ProIleGlnMetIleValLeuThrTyrPh ePro |
| 485490 |
| (2) INFORMATION FOR SEQ ID NO:3: |
| (i) SEQUENCE CHARACTERISTICS: |
| (A) LENGTH: 1710 base pairs |
| (B) TYPE: nucleic acid |
| (C) STRANDEDNESS: double |
| (D) TOPOLOGY: linear |
| (ii) MOLECULE TYPE: cDNA |
| (iii) HYPOTHETICAL: NO |
| (iv) ANTI-SENSE: NO |
| (vi) ORIGINAL SOURCE: |
| (A) ORGANISM: Mus musculus |
| (ix) FEATURE: |
| (A) NAME/KEY: CDS |
| (B) LOCATION: 202..1668 |
| (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3: |
| GAGGAGCCGCCGCCTTCTCGTCGCTCGAGCTCTGGACGACCATGGTCGCTCAGGCCCCGT60 |
| CCGCGGGGCCTCCGCGCTCCCCGTGAA GGGTCGGAAGATGCGCGGGAAGTAGCAGCCGTC120 |
| TGCTGGGCGAGCGGGAGACCGACCGGACACCCCTGGGGGACCCTCTCGGATCACCGCGCT180 |
| TCTCCTGCGGCCTCCAGGCCAATGTGCAATACCAACATGTCTGTGTCTACC231 |
| MetCysAsnThrAsnMetSerValSerThr |
| 1510 |
| GAGGGTGCTGCAAGCACCTCACAGATTCCAGCTTCGGAACAAGAGACT 279 |
| GluGlyAlaAlaSerThrSerGlnIleProAlaSerGluGlnGluThr |
| 152025 |
| CTGGTTAGACCAAAACCATTGCTTTTGAAGTTGTTAAAGTCCGTTGGA 327 |
| LeuValArgProLysProLeuLeuLeuLysLeuLeuLysSerValGly |
| 303540 |
| GCGCAAAACGACACTTACACTATGAAAGAGATTATATTTTATATTGGC 375 |
| AlaGlnAsnAspThrTyrThrMetLysGluIleIlePheTyrIleGly |
| 455055 |
| CAGTATATTATGACTAAGAGGTTATATGACGAGAAGCAGCAGCACATT 423 |
| GlnTyrIleMetThrLysArgLeuTyrAspGluLysGlnGlnHisIle |
| 606570 |
| GTGTATTGTTCAAATGATCTCCTAGGAGATGTGTTTGGAGTCCCGAGT471 |
| Va lTyrCysSerAsnAspLeuLeuGlyAspValPheGlyValProSer |
| 75808590 |
| TTCTCTGTGAAGGAGCACAGGAAAATATATGCAATGATCTACAGAAAT 519 |
| PheSerValLysGluHisArgLysIleTyrAlaMetIleTyrArgAsn |
| 95100105 |
| TTAGTGGCTGTAAGTCAGCAAGACTCTGGCACATCGCTGAGTGAGAGC 567 |
| LeuValAlaValSerGlnGlnAspSerGlyThrSerLeuSerGluSer |
| 110115120 |
| AGACGTCAGCCTGAAGGTGGGAGTGATCTGAAGGATCCTTTGCAAGCG 615 |
| ArgArgGlnProGluGlyGlySerAspLeuLysAspProLeuGlnAla |
| 125130135 |
| CCACCAGAAGAGAAACCTTCATCTTCTGATTTAATTTCTAGACTGTCT 663 |
| ProProGluGluLysProSerSerSerAspLeuIleSerArgLeuSer |
| 140145150 |
| ACCTCATCTAGAAGGAGATCCATTAGTGAGACAGAAGAGAACACAGAT711 |
| Th rSerSerArgArgArgSerIleSerGluThrGluGluAsnThrAsp |
| 155160165170 |
| GAGCTACCTGGGGAGCGGCACCGGAAGCGCCGCAGGTCCCTGTCCTTT 759 |
| GluLeuProGlyGluArgHisArgLysArgArgArgSerLeuSerPhe |
| 175180185 |
| GATCCGAGCCTGGGTCTGTGTGAGCTGAGGGAGATGTGCAGCGGCGGC 807 |
| AspProSerLeuGlyLeuCysGluLeuArgGluMetCysSerGlyGly |
| 190195200 |
| ACGAGCAGCAGTAGCAGCAGCAGCAGCGAGTCCACAGAGACGCCCTCG 855 |
| ThrSerSerSerSerSerSerSerSerGluSerThrGluThrProSer |
| 205210215 |
| CATCAGGATCTTGACGATGGCGTAAGTGAGCATTCTGGTGATTGCCTG 903 |
| HisGlnAspLeuAspAspGlyValSerGluHisSerGlyAspCysLeu |
| 220225230 |
| GATCAGGATTCAGTTTCTGATCAGTTTAGCGTGGAATTTGAAGTTGAG951 |
| As pGlnAspSerValSerAspGlnPheSerValGluPheGluValGlu |
| 235240245250 |
| TCTCTGGACTCGGAAGATTACAGCCTGAGTGACGAAGGGCACGAGCTC 999 |
| SerLeuAspSerGluAspTyrSerLeuSerAspGluGlyHisGluLeu |
| 255260265 |
| TCAGATGAGGATGATGAGGTCTATCGGGTCACAGTCTATCAGACAGGA 1047 |
| SerAspGluAspAspGluValTyrArgValThrValTyrGlnThrGly |
| 270275280 |
| GAAAGCGATACAGACTCTTTTGAAGGAGATCCTGAGATTTCCTTAGCT 1095 |
| GluSerAspThrAspSerPheGluGlyAspProGluIleSerLeuAla |
| 285290295 |
| GACTATTGGAAGTGTACCTCATGCAATGAAATGAATCCTCCCCTTCCA1 143 |
| AspTyrTrpLysCysThrSerCysAsnGluMetAsnProProLeuPro |
| 300305310 |
| TCACACTGCAAAAGATGCTGGACCCTTCGTGAGAACTGGCTTCCAGAC1191 |
| Se rHisCysLysArgCysTrpThrLeuArgGluAsnTrpLeuProAsp |
| 315320325330 |
| GATAAGGGGAAAGATAAAGTGGAAATCTCTGAAAAAGCCAAACTGGAA1 239 |
| AspLysGlyLysAspLysValGluIleSerGluLysAlaLysLeuGlu |
| 335340345 |
| AACTCAGCTCAGGCAGAAGAAGGCTTGGATGTGCCTGATGGCAAAAAG 1287 |
| AsnSerAlaGlnAlaGluGluGlyLeuAspValProAspGlyLysLys |
| 350355360 |
| CTGACAGAGAATGATGCTAAAGAGCCATGTGCTGAGGAGGACAGCGAG 1335 |
| LeuThrGluAsnAspAlaLysGluProCysAlaGluGluAspSerGlu |
| 365370375 |
| GAGAAGGCCGAACAGACGCCCCTGTCCCAGGAGAGTGACGACTATTCC1 383 |
| GluLysAlaGluGlnThrProLeuSerGlnGluSerAspAspTyrSer |
| 380385390 |
| CAACCATCGACTTCCAGCAGCATTGTTTATAGCAGCCAAGAAAGCGTG1431 |
| Gl nProSerThrSerSerSerIleValTyrSerSerGlnGluSerVal |
| 395400405410 |
| AAAGAGTTGAAGGAGGAAACGCAGCACAAAGACGAGAGTGTGGAATCT1 479 |
| LysGluLeuLysGluGluThrGlnHisLysAspGluSerValGluSer |
| 415420425 |
| AGCTTCTCCCTGAATGCCATCGAACCATGTGTGATCTGCCAGGGGCGG 1527 |
| SerPheSerLeuAsnAlaIleGluProCysValIleCysGlnGlyArg |
| 430435440 |
| CCTAAAAATGGCTGCATTGTTCACGGCAAGACTGGACACCTCATGTCA 1575 |
| ProLysAsnGlyCysIleValHisGlyLysThrGlyHisLeuMetSer |
| 445450455 |
| TGTTTCACGTGTGCAAAGAAGCTAAAAAAAAGAAACAAGCCCTGCCCA1 623 |
| CysPheThrCysAlaLysLysLeuLysLysArgAsnLysProCysPro |
| 460465470 |
| GTGTGCAGACAGCCAATCCAAATGATTGTGCTAAGTTACTTCAAC1668 |
| Va lCysArgGlnProIleGlnMetIleValLeuSerTyrPheAsn |
| 475480485 |
| TAGCTGACCTGCTCACAAAAATAGAATTTTATATTTCTAACT1710 |
| (2) INFORMATION FOR SEQ ID NO:4: |
| (i) SEQUENCE CHARACTERISTICS: |
| (A) LENGTH: 489 amino acids |
| (B) TYPE: amino acid |
| (D) TOPOLOGY: linear |
| (ii) MOLECULE TYPE: protein |
| (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4: |
| MetCysAsnThrAsnMetSerValSerThrGluGlyAlaAlaSerThr |
| 15 1015 |
| SerGlnIleProAlaSerGluGlnGluThrLeuValArgProLysPro |
| 202530 |
| LeuLeuLeuLysLeuLeuLysSerValGlyAlaGln AsnAspThrTyr |
| 354045 |
| ThrMetLysGluIleIlePheTyrIleGlyGlnTyrIleMetThrLys |
| 505560 |
| ArgLeuT yrAspGluLysGlnGlnHisIleValTyrCysSerAsnAsp |
| 65707580 |
| LeuLeuGlyAspValPheGlyValProSerPheSerValLysGluHis |
| 859095 |
| ArgLysIleTyrAlaMetIleTyrArgAsnLeuValAlaValSerGln |
| 100105110 |
| GlnAspSerGlyThrSe rLeuSerGluSerArgArgGlnProGluGly |
| 115120125 |
| GlySerAspLeuLysAspProLeuGlnAlaProProGluGluLysPro |
| 130135 140 |
| SerSerSerAspLeuIleSerArgLeuSerThrSerSerArgArgArg |
| 145150155160 |
| SerIleSerGluThrGluGluAsnThrAspGluLeuPro GlyGluArg |
| 165170175 |
| HisArgLysArgArgArgSerLeuSerPheAspProSerLeuGlyLeu |
| 180185190 |
| CysGluLeuArgGluMetCysSerGlyGlyThrSerSerSerSerSer |
| 195200205 |
| SerSerSerGluSerThrGluThrProSerHisGlnAspLeuAspAsp |
| 210 215220 |
| GlyValSerGluHisSerGlyAspCysLeuAspGlnAspSerValSer |
| 225230235240 |
| AspGlnPheSerValGluPh eGluValGluSerLeuAspSerGluAsp |
| 245250255 |
| TyrSerLeuSerAspGluGlyHisGluLeuSerAspGluAspAspGlu |
| 260 265270 |
| ValTyrArgValThrValTyrGlnThrGlyGluSerAspThrAspSer |
| 275280285 |
| PheGluGlyAspProGluIleSerLeuAlaAspTyrTrp LysCysThr |
| 290295300 |
| SerCysAsnGluMetAsnProProLeuProSerHisCysLysArgCys |
| 305310315320 |
| T rpThrLeuArgGluAsnTrpLeuProAspAspLysGlyLysAspLys |
| 325330335 |
| ValGluIleSerGluLysAlaLysLeuGluAsnSerAlaGlnAlaGlu |
| 340345350 |
| GluGlyLeuAspValProAspGlyLysLysLeuThrGluAsnAspAla |
| 355360365 |
| LysGluProCysAlaGluGl uAspSerGluGluLysAlaGluGlnThr |
| 370375380 |
| ProLeuSerGlnGluSerAspAspTyrSerGlnProSerThrSerSer |
| 385390395 400 |
| SerIleValTyrSerSerGlnGluSerValLysGluLeuLysGluGlu |
| 405410415 |
| ThrGlnHisLysAspGluSerValGluSerSerPhe SerLeuAsnAla |
| 420425430 |
| IleGluProCysValIleCysGlnGlyArgProLysAsnGlyCysIle |
| 435440445 |
| V alHisGlyLysThrGlyHisLeuMetSerCysPheThrCysAlaLys |
| 450455460 |
| LysLeuLysLysArgAsnLysProCysProValCysArgGlnProIle |
| 465 470475480 |
| GlnMetIleValLeuSerTyrPheAsn |
| 485 |
Vogelstein, Bert, Kinzler, Kenneth
| Patent | Priority | Assignee | Title |
| 7083983, | Jul 05 1996 | CANCER RESEARCH TECHNOLOGY LIMITED | Inhibitors of the interaction between P53 and MDM2 |
| 9539327, | Nov 26 2007 | The Research Foundation of State University of New York | Small molecule cancer treatments that cause necrosis in cancer cells but do not affect normal cells |
| Patent | Priority | Assignee | Title |
| Executed on | Assignor | Assignee | Conveyance | Frame | Reel | Doc |
| Aug 04 1994 | The Johns Hopkins University | (assignment on the face of the patent) | / |
| Date | Maintenance Fee Events |
| Oct 28 1999 | M183: Payment of Maintenance Fee, 4th Year, Large Entity. |
| Oct 27 2003 | M1552: Payment of Maintenance Fee, 8th Year, Large Entity. |
| Oct 04 2007 | R1553: Refund - Payment of Maintenance Fee, 12th Year, Large Entity. |
| Oct 19 2007 | M1553: Payment of Maintenance Fee, 12th Year, Large Entity. |
| Date | Maintenance Schedule |
| May 21 1999 | 4 years fee payment window open |
| Nov 21 1999 | 6 months grace period start (w surcharge) |
| May 21 2000 | patent expiry (for year 4) |
| May 21 2002 | 2 years to revive unintentionally abandoned end. (for year 4) |
| May 21 2003 | 8 years fee payment window open |
| Nov 21 2003 | 6 months grace period start (w surcharge) |
| May 21 2004 | patent expiry (for year 8) |
| May 21 2006 | 2 years to revive unintentionally abandoned end. (for year 8) |
| May 21 2007 | 12 years fee payment window open |
| Nov 21 2007 | 6 months grace period start (w surcharge) |
| May 21 2008 | patent expiry (for year 12) |
| May 21 2010 | 2 years to revive unintentionally abandoned end. (for year 12) |