A purified monoclonal antibody, or an. antigen-binding portion thereof, which specifically binds to human clathrin heavy chain (CHC) is disclosed. The antibody, or antigen-binding portion, thereof, exhibits at least one, two, three, four, five, six, seven, or all eight of the following properties: (a) specifically binds to pancreatic adenocarcinoma cells; (b) binding to the cell surface and cytosol of cancer cells and tumor blood vessels; (c) internalized by CHC-expressing cells; (d) inhibiting tumor growth, invasion ability, migration, and angiogenesis; (e) inducing apoptosis in cancer cells and human umbilical vein endothelial cells; (f) inhibiting tumor growth and tumor blood vessels in pancreatic cancer in vivo; (g) suppressing epidermal growth factor, transferrin, and VEGF internalizations by cancer cells; and (h) suppressing hypoxia-inducible factor-1α expression and vascular endothelial growth factor secretion. Methods for inhibiting tumor cell growth and/or angiogenesis, and detecting cancer in a subject is also disclosed.
|
1. A purified monoclonal antibody or an antigen-binding fragment thereof which specifically binds to human clathrin heavy chain (CHC) comprising the amino acid sequence of SEQ ID NO: 1 and comprises a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 2.
4. An isolated monoclonal antibody or an antigen binding fragment thereof binging to human clathrin heavy chain (CHC) and comprising:
(a) a heavy chain variable region, comprising:
(i) complementarity determining region 1 (CDR1) comprising SEQ ID NO: 4;
(ii) complementarity determining region 2 (CDR2) comprising SEQ ID NO: 5; and
(iii) complementarity determining region 3 (CDR3) comprising SEQ ID NO: 6; and
(b) a light chain variable region, comprising.
(i) CDR1 comprising SEQ ID NO: 7;
(ii) CDR2 comprising SEQ ID :NO: 8; and
(iii) CDR3 comprising SEQ ID NO: 9.
2. The purified monoclonal antibody or antigen-binding fragment thereof of
wherein the purified monoclonal antibody comprises a light chain variable region comprising the amino acid sequence of SEQ ID NO: 3.
3. The purified monoclonal antibody or antigen-binding fragment thereof of
5. The isolated antibody or binding fragment of
6. The isolated antibody or binding fragment of
7. The isolated antibody or binding fragment of
8. The isolated antibody or binding fragment of
9. The isolated antibody or binding fragment
11. A method for inhibiting tumor cell growth and/or tumor angiogenesis, comprising:
administering to a subject in need thereof a composition comprising, the purified monoclonal antibody or antigen-binding portion thereof of
12. A method for inhibiting tumor growth and/or tumor angiogenesis, comprising:
administering to a subject in need thereof a composition comprising the isolated monoclonal antibody, or binding fragment thereof of
13. The method of
14. An isolated single-chain antibody comprising:
(a) the heavy chain variable region (SEQ ID NO: 2) and the light chain variable region (SEQ ID NO: 3) of the isolated antibody or binding fragment of
(b) a linker peptide connecting the heavy chain variable region (SEQ ID NO: 2) and the light chain variable region (SEQ ED NO: 3).
15. A composition comprising:
(a) the isolated monoclonal antibody or binding fragment of
(b) a pharmaceutically acceptable carrier,
16. The composition of
17. A method for detecting cancer in a subject, comprising:
(a) applying the isolated monoclonal antibody or binding fragment thereof of
(b) assaying the binding of the isolated monoclonal antibody or binding fragment thereof to the cell or the tissue sample; and
(c) comparing the binding with a normal control to determine the presence of the cancer in the subject,
wherein the cancer expresses human clathrin heavy chain.
18. The isolated monoclonal antibody or an antigen-binding fragment thereof of
(a) specifically binds to pancreatic adenocarcinoma cells;
(b) binds to the cell surface of cancer cells and tumor blood vessels;
(c) is internalized by CHC-expressing cells upon binding;
(d) inhibiting tumor growth, invasion, migration, and angiogenesis;
(e) inducing apoptosis in cancer cells and human umbilical vein endothelial cells (HUVECs);
(f) inhibiting tumor growth and tumor blood vessel formation in pancreatic cancer in vivo;
(g) suppressing epidermal growth factor (EGF), transferrin (Tf) and VEGF internalizations by cancer cells; and
(h) suppressing hypoxia-inucible factor-1α (HIF-1α) expression and vascular endothelial growth factor (VEGF) secretion.
|
The present application claims the priority to U.S. Provisional Application Ser. No. 61/543,118, filed Oct. 4, 2011, which is herein incorporated by reference in its entirety.
The present invention relates generally to anti-cancer agent, and more specifically to antibodies for treating cancers.
About 95% of pancreatic cancer cases are adenocarcinomas. The overall five-year survival rate of pancreatic adenocarcinoma is about 5%. It is the fourth leading cause of cancer death in the United States. Pancreatic cancer often recurs after initial treatment despite the use of chemotherapy or radiation therapy. At present, there is no effective treatment for pancreatic cancer. The most commonly used medicine to treat pancreatic cancer is gemcitabine (GEM), a pyrimidine nucleoside drug, but it is only moderately effective.
Two monoclonal antibody (mAbs) drugs currently in clinical trial for targeted therapy against pancreatic cancers are cetuximab and bevacizumab, targeting epidermal growth factor receptor (EGFR) and vascular endothelial growth factor (VEGF), respectively. However, clinical trial data showed that using either cetuximab or bevacizumab, in combination with small molecule drugs had no significant improvement in the overall survival of pancreatic cancer patients.
Therefore, it is important to identify a suitable target for developing targeted therapy against pancreatic cancer.
In one aspect, the invention relates to a purified monoclonal antibody, or an antigen-binding portion thereof, which specifically binds to human clathrin heavy chain (CHC) comprising the amino acid sequence of SEQ ID NO: 1.
In another aspect, the invention relates to an isolated monoclonal antibody, or a binding fragment thereof. The isolated monoclonal antibody, or a binding fragment thereof comprises a heavy chain variable region and a light chain variable region, in which the heavy chain variable region comprises: (i) complementarity determining region 1 (CDR1) comprising SEQ ID NO: 4; (ii) complementarity determining region 2 (CDR2) comprising SEQ ID NO: 5; and (iii) complementarity determining region 3 (CDR3) comprising SEQ ID NO: 6; and the light chain variable region comprises: (i) CDR1 comprising SEQ ID NO: 7; (ii) CDR2 comprising SEQ ID NO: 8; and (iii) CDR3 comprising SEQ ID NO: 9.
In another aspect, the invention relates to a method for inhibiting tumor cell growth and/or tumor angiogenesis, which comprises administering to a subject, in need thereof a composition comprising the aforementioned purified monoclonal antibody, or antigen-binding portion thereof, and a pharmaceutically acceptable carrier.
Further in another aspect, the invention relate to a method for inhibiting tumor growth and/or tumor angiogenesis, which comprises: administering to a subject in need thereof a composition composing the aforementioned isolated monoclonal antibody, or binding fragment thereof, and a pharmaceutically acceptable carrier.
Further in another aspect, the invention relate to an isolated single-chain variable fragment comprising: (a) the heavy chain variable region (SEQ ID NO: 2) and the light chain, variable .region (SEQ ID NO: 3) of the isolated antibody or binding fragment as aforementioned; and (b) a linker peptide connecting the heavy chain variable region (SEQ ID NO: 2) and the light chain variable region (SEQ ID NO: 3).
Further in another aspect, the invention relate to a method for detecting cancer in a. subject, which comprises: (a) applying the isolated monoclonal antibody, or binding fragment thereof, of claim 4 to a cell or tissue sample obtained from the subject; and (b) assaying the binding of the isolated monoclonal antibody, or binding fragment thereof to the cell or the tissue sample; and (c) comparing the binding with a normal control to determine the presence of the cancer in the subject, wherein the cancer expresses human clathrin heavy chain.
Yet in another aspect, the invention relates to a composition comprising: (a) the aforementioned isolated monoclonal antibody or binding fragment thereof; and (b) a pharmaceutically acceptable carrier.
These and other aspects will become apparent from the following description of the preferred embodiment taken in conjunction with the following drawings, although variations and modifications therein may be affected without departing from the spirit and scope of the novel concepts of the disclosure.
The accompanying drawings illustrate one or more embodiments of the invention and, together with the written description, serve to explain the principles of the invention. Wherever possible, the same reference numbers are used throughout the drawings to refer to the same or like elements of an embodiment.
The terms used in this specification generally have their ordinary meanings in the art, within the context of the invention, and in the specific context where each term is used. Certain terms that are used to describe the invention are discussed below, or elsewhere in the specification, to provide additional guidance to the practitioner regarding the description of the invention. For convenience, certain terms may be highlighted, for example using italics and/or quotation marks. The use of highlighting has no influence on the scope and meaning of a term; the scope and meaning of a term is the same, in the same context, whether or not it is highlighted. It will be appreciated that same thing can be said in more than one way. Consequently, alternative language and synonyms may be used for any one or more of the terms discussed herein, nor is any special significance to be placed upon whether or not a term is elaborated or discussed herein. Synonyms for certain terms are provided. A recital of one or more synonyms does not exclude the use of other synonyms. The use of examples anywhere in this specification including examples of any terms discussed herein is illustrative only, and in no way limits the scope and meaning of the invention or of any exemplified term. Likewise, the invention is not limited to various embodiments given in this specification.
Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. In the case of conflict, the present document, including definitions will control.
As used herein, “around”, “about” or “approximately” shall generally mean within 20 percent, preferably within 10 percent, and more preferably within 5 percent of a given value or range. Numerical quantities given herein are approximate, meaning that the term “around”, “about” or “approximately” can be inferred if not expressly stated.
Abbreviations: mAb, monoclonal antibodies; CHC, clathrin Heavy Chain; HIF-1α, Hypoxia-inducible factor 1α; VEGF, vascular endothelial growth factor; NNM, Normal nasal mucosal; FACS, flow cytometric analysis; ELISA, Enzyme-linked immunosorbent assay; EMT, epithelial-mesenchymal transition; Quantitative Reverse Transcription Polymerase Chain Reaction (RT-PCR); ChIP, Chromatin Immunoprecipitation; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; HUVEC, Human Umbilical Vein Endothelial Cells; IHC, immunohistochemistry; DFX, deferoxamine; EKE, hypoxia responsive element; UEA-1, Ulex europaeus 1 agglutinin; CDR, complementarity-determining region; LC-nanoESI-MS/MS, liquid chromatography-nano-electrospray ionization tandem mass spectrometry.
As used herein, “preparation” shall generally mean something prepared, manufactured, a substance especially prepared.
As used herein, the term “antibody” means an immunoglobulin (Ig) molecule or a fragment of an immunoglobulin molecule having the ability to specifically bind to a particular antigen. The Ig monomer is a “Y”-shaped molecule that consists of four polypeptide chains; two identical heavy chains and two identical light chains connected by disulfide bonds. The arms of the Y, for example, contain the site that bind antigen and, therefore, recognize specific foreign objects. This region of the antibody is called the Fab (fragment, antigen binding) region.
Antibodies are well known to those of ordinary skill in the science of immunology. As used herein, the term “antibody” means not only full-length antibody molecules but also fragments of antibody molecules retaining antigen binding ability. Such fragments are also well known, in the art and are regularly employed both in vitro and in vivo. In particular, as used herein, the term “antibody” means not only full-length immunoglobulin molecules but also antigen binding active fragments such as the well-known active fragments F(ab′)2, Fab, Fv, and Fd.
The fragment antigen-binding (Fab fragment) is a region on an antibody that binds to antigens. It is composed of one constant and one variable domain of each of the heavy and the light chain. The two variable domains bind the epitope on their specific antigens. Fc and Fab fragments can be generated in the laboratory. The enzyme papain can be used to cleave an immunoglobulin monomer into two Fab fragments and an Fc fragment. The enzyme pepsin cleaves below hinge region, so a F(ab′)2 fragment and a pFc′ fragment is formed. The enzyme IdeS (Immunoglobulin degrading enzyme from Streptococcus pyogenes, trade name FabRICATOR™) cleaves IgG in a sequence specific manner at neutral pH. The F(ab′)2 fragment can be split into two Fab′ fragments by mild reduction.
The variable domain of an antibody is referred to as the Fv region and is the most important region for binding to antigens.
The Fv fragment consists of the heavy chain variable domain (VH) and the light chain variable domain (VL) held together by strong noncovalent interaction. Thus, each Fv fragment contains one intact antigen-binding site and represents the minimal active fragment derivable from an antibody molecule.
The variable regions of the heavy and light chains can be fused together to form a single-chain variable fragment (scFv), which is only half the size of the Fab fragment, yet retains the original, specificity of the parent immunoglobulin.
It has been reported that “fully” human antibodies may avoid some of the side effects of humanized and chimeric antibodies. Two successful approaches were identified—phage display-generated antibodies and mice genetically engineered to produce more human-like antibodies. Phage display could be used such that variable antibody domains could be expressed on filamentous phage antibodies.
It is now well-established in the art that the non-CDR regions of a mammalian antibody may be replaced with similar regions of conspecific or heterospecific antibodies while retaining the epitopic specificity of the original antibody. This is most clearly manifested in the development and use of “humanized” antibodies in which non-human CDRs are covalently joined to human FR and/or Fc/pFc′ regions to produce a functional antibody. Thus, for example, PCT International Publication Number WO 92/04381 teaches the production and use of humanized murine RSV antibodies in which at least a portion of the murine FR regions have been replaced by FR regions of human origin. Such antibodies, including fragments of full-length antibodies with antigen-binding ability, are often referred to as “chimeric” antibodies. Such chimeric antibodies may be produced in which some or all of the FR regions of the antibody have been replaced by other homologous human PR regions.
Humanized forms of non-human (e.g., murine) antibodies are chimeric immunoglobulins, immunoglobulin chains or fragments thereof (such as Fv, Fab, Fab′, F(ab′)2 or other antigen-binding subsequences of antibodies) which contain minimal sequence derived from non-human immunoglobulin. Humanized antibodies include human immunoglobulins (recipient antibody) in which residues from a complementary determining region (CDR) of the recipient are replaced by residues from a CDR of a non-human species (donor antibody) such as mouse, rat or rabbit having the desired specificity, affinity and capacity. In some instances, Fv framework residues of the human immunoglobulin are replaced by corresponding non-human residues. Humanized antibodies may also comprise residues which are found neither in the recipient antibody nor in the imported CDR or framework sequences. In general, the humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the CDR regions correspond to those of a non-human immunoglobulin and all or substantially all of the FR regions are those of a human immunoglobulin consensus sequence. The humanized antibody optimally also will comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin [Jones et at, Nature, 321:522-525 (1986); Riechmann et al., Nature, 332:323-329 (1988): and Presta, Curr. Op. Steel Biol., 2:593-596 (1992)].
Methods for humanizing non-human antibodies are well known in the art. Generally, a humanized antibody has one or more amino acid residues introduced into it from a source which is non-human. These non-human amino acid residues are often referred to as “import” residues, which are typically taken from an “import” variable domain. Humanization can be essentially performed following the method of Winter and co-workers [Jones et al., Nature, 321:522-525 (1986); Riechmann et al., Nature, 332:323-327 (1988); Verhoeyen et al., Science, 239:1534-1536 (1988)], by substituting rodent CDRs or CDR sequences for the corresponding sequences of a human antibody. Accordingly, such “humanized” antibodies are chimeric antibodies (U.S. Pat. No. 4,816,567), wherein substantially less than an intact human variable domain has been substituted by the corresponding sequence from a non-human species. In practice, humanized antibodies are typically human antibodies in which some CDR residues and possibly some FR residues are substituted by residues from analogous sites in rodent antibodies.
Human antibodies can also be produced using various techniques known in the art, including phage display libraries. The techniques of Cole et al. and Boerner et al. are also available for the preparation of human monoclonal antibodies (Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, p. 77(1985) and Boerner et al., J. Immunol., 147(1) 86-95 (1991)]. Similarly, human antibodies can be made by introducing of human immunoglobulin loci into transgenic animals, e.g., mice in which the endogenous immunoglobulin genes have been partially or completely inactivated. Upon challenge, human antibody production is observed, which closely resembles that seen in humans in all respects, including gene rearrangement, assembly, and antibody repertoire. This approach is described, for example, in U.S. Pat. Nos. 5,545,807: 5,545,806; 5,569,825; 5,625,126; 5,633,425: 5,661,016. Such fully human or humanized monoclonal antibodies will have particular utility in that they will not evoke an immune response against the antibody itself See U.S. Pat. No. 7,622,113, which is herein incorporated by reference in its entirety.
The antibody may be labeled and may be immobilized on a solid support. The word “label” when used herein refers to a detectable compound or composition which is conjugated directly or indirectly to the antibody so as to generate a “labeled” antibody. The label may be detectable by itself (e.g. radioisotope labels or fluorescent labels) or, in the case of an enzymatic label, may catalyze chemical alteration of a substrate compound or composition which is detectable.
We have generated several mAbs recognizing pancreatic cancer cells. One of these mAbs, Pa65-2, can recognize clathrin heavy chain (CHC). Clathrin, encoded by the CLTC gene at 17q23.2, is a trimer of heavy chains (˜190 kDa each), each paired with a light chain (25-27 kDa). The basic unit of its assembly is the triskelion, which has a flexible, three-armed polyhedral cage-like structure. Clathrin plays a crucial role in clathrin-mediated endocytosis (CME) pathway, a major route for membrane trafficking. It is involved in the ubiquitous uptake of ligand-receptor complexes, membrane transporters, and adhesion molecules. Clathrin also stabilizes the fibers of the spindle apparatus during mitosis. However, the main mechanism of CHC in tumorigenesis remains unknown.
We found that CHC may regulate the stability of the α subunit of hypoxia inducible factor-1 (HIF-1α). When cells are exposed to hypoxic conditions, HIF-1α is stabilized, which subsequently upregulates several downstream genes to promote cell survival in low-oxygen conditions. HIF-1α accumulation mediates cellular and systemic adaptive, responses to maintain oxygen homeostasis. It. also upregulates hypoxia-inducible genes, which are involved, in angiogenesis, erythropoiesis, energy metabolism as well as cell survival decisions in all metazoan species. In cancerous conditions, cells within rapidly growing solid tumors are exposed to chronic or intermittent hypoxia. Therefore, tumor cells encounter powerful selective pressure from hypoxia during their progression, invasion, and metastasis. An elevated expression of hypoxia-responsive proteins is a poor prognostic sign in many types of solid tumors, and the results from several studies suggest that agents acting directly or indirectly against the expression of HIF-1α have anticancer effects.
In the present study, it was found that CHC, which is associated with the HIF-1α, increases the protein's stability and facilitates its nuclear translocation, thereby regulating VEGF gene expression in cancer cells. The newly generated Pa65-2 inhibited tumor growth and angiogenesis, suggesting that this mAb can potentially be used to inhibit tumor angiogenesis and tumorigenesis in pancreatic cancer.
In one aspect, the invention relates to a purified monoclonal, antibody, or an antigen-binding portion thereof, which specifically binds to human clathrin heavy chain (CHC) comprising the amino acid sequence of SEQ ID NO: 1.
In one embodiment of the invention, the purified monoclonal antibody or antigen-binding portion thereof comprises: (a) a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 2; and (b) a light chain variable region comprising the amino acid sequence of SEQ ID NO: 3.
In another embodiment of the invention, the purified monoclonal antibody or antigen-binding portion thereof binds to cells selected from the group consisting of pancreatic cancer cells, breast cancer cells, lung cancer cells, ovary cancer cells, oral cancer cells, and tumor-associated endothelial cells.
In another aspect, the invention relates to an isolated monoclonal antibody, or a binding fragment thereof. The isolated monoclonal antibody, or a binding fragment thereof comprises a heavy chain variable region and a light chain variable region, in which the heavy chain variable region comprises; (i) complementarity determining region 1 (CDR1) comprising SEQ ID NO: 4; (ii) complementarity determining region 2 (CDR2) comprising SEQ ID NO: 5; and (iii) complementarity determining region 3 (CDR3) comprising SEQ ID NO: 6; and the light chain variable region comprises: (i) CDR1 comprising SEQ ID NO: 7; (is) CDR2 comprising SEQ ID NO: 8; and (iii) CDR3 comprising SEQ ID NO: 9.
In one embodiment of the invention, the isolated antibody or binding fragment comprises a heavy chain variable domain (VH) SEQ ID NO: 2 and/or a light chain variable domain (VL) SEQ ID NO: 3.
In another embodiment of the invention, the binding fragment comprises an Fv fragment of the antibody.
In another embodiment of the invention, the binding fragment comprises an Fab fragment of the antibody.
In another embodiment of the invention, the antibody is a fully human monoclonal antibody.
In another embodiment of the invention, the antibody is a humanized monoclonal antibody.
In another embodiment of the invention, the aforementioned anybody, or binding fragment thereof, binds to a cancer cell expressing clathrin heavy chain (CHC).
In another embodiment of the invention, the isolated antibody or binding fragment is labeled with a detectable compound or an enzyme.
In another embodiment of the invention, the isolated antibody or binding fragment is encapsulated within a liposome.
In another aspect, the invention relates to a method for inhibiting tumor cell growth and/or tumor angiogenesis, which comprises administering to a subject in need thereof a composition comprising the aforementioned purified monoclonal antibody, or antigen-binding portion thereof, and a pharmaceutically acceptable carrier.
Further in another aspect, the invention relate to a method for inhibiting tumor growth and/or tumor angiogenesis, which comprises: administering to a subject in need thereof a composition comprising the aforementioned isolated monoclonal antibody, or binding fragment thereof, and a pharmaceutically acceptable carrier.
In one embodiment of the invention, the tumor cell expresses clathrin heavy chain (CHC). In another embodiment of the invention, the tumor cell is selected from the group consisting of pancreatic cancer cells, breast cancer cells, lung cancer cells, ovary cancer cells, oral cancer cells, and tumor-associated endothelial cells.
Further in another aspect, the invention relate to an isolated single-chain variable fragment comprising; (a) the heavy chain variable region (SEQ ID NO: 2) and the light chain variable region (SEQ ID NO: 3) of the isolated antibody or binding fragment as aforementioned; and (b) a linker peptide connecting the heavy chain variable region (SEQ ID NO: 2) and the light chain variable region (SEQ ID NO: 3).
Further in another aspect, the invention relate to a method for detecting cancer in a subject, which comprises: (a) applying the isolated monoclonal antibody, or binding fragment thereof, of claim 4 to a cell or tissue sample obtained from the subject; and (b) assaying the binding of the isolated monoclonal antibody, or binding fragment thereof to the cell or the tissue sample; and (c) comparing the binding with a. normal control to determine the presence of the cancer in the subject, wherein the cancer expresses human clathrin heavy chain.
Yet in another aspect, the invention relates to a composition comprising; (a) the aforementioned isolated monoclonal antibody or binding fragment thereof and (b) a pharmaceutically-acceptable carrier.
Alternatively, the invention relates to a composition comprising: (a) the aforementioned purified monoclonal antibody or antigen-binding portion thereof; and (b) a pharmaceutically acceptable carrier.
In one embodiment of the invention, the composition further comprises an anticancer agent. The anticancer agent may be a small molecule drug including, but not limited to, germicitabine.
In another embodiment of the invention, the aforementioned isolated monoclonal antibody, or an antigen-binding portion thereof, exhibits at. least one, two, three, four, five, six, seven, or all eight of the following properties: (a) specifically binds to pancreatic adenocarcinoma cells; (b) binds to the cell surface and cytosol. of cancer cells and tumor blood vessels; (c) is internalized by CHC-expressing cells; (d) inhibiting tumor growth, invasion ability, migration, and angiogenesis; (e) inducing apoptosis in cancer cells and human umbilical vein endothelial cells (HUVECs); (f) inhibiting tumor growth and tumor blood vessels in pancreatic cancer in vivo; (g) suppressing epidermal growth factor (EGF), transferrin (Tf), and VEGF internalizations by cancer cells; or (h) suppressing hypoxia-inducible factor-1α (HIF-1α) expression and vascular endothelial growth factor (VEGF) secretion.
Without intent, to limit the scope of the invention, exemplary instruments, apparatus, methods and their related results according to the embodiments of the present invention are given below. Note that titles or subtitles may be used in the examples for convenience of a reader, which in no way should limit the scope of the invention. Moreover, certain theories are proposed and disclosed herein; however, in no way they, whether they are right or wrong, should limit the scope of the invention so long as the invention is practiced according to the invention without regard for any particular theory or scheme of action.
Materials and Methods
Cell Lines and Culture
Human pancreatic adenocarcinoma cell lines (MIA PaCa-2 and AsPC-1), human breast carcinoma cell lines (MDA-MB-231), human ovarian cancer cell lines (SKOV3), human colon cancer cell lines (COLO 205), and a human skin fibroblast cell line (CCD-1112Sk), were purchased from American Type Culture Collection (ATCC®), These cells were cultured in accordance with cell bank protocols and had been passaged for less than 6 months after resuscitation. Normal nasal mucosal (NNM) epithelia were a primary culture derived from a nasal polyp. Human umbilical vein endothelial cells (HUVECs) were purchased (LONZA™) and grown in EBM-2 medium (LONZA™). The cell lines, including were purchased from American Type Culture Collection (ATCC®), Human oral cancer cell lines (SAS) were obtained from the Japanese Cancer Research Resources Bank. These cells were cultured by cell bank protocols and had been passaged for fewer than 6 months after resuscitation.
Generation of Monoclonal Antibodies
Monoclonal antibodies against MIA PaCa-2 were generated following a standard procedure with slight modifications. Briefly, female BALB/cJ mice were immunized intraperitoneally with MIA PaCa-2 four times at 3-week intervals. On day 4 after the final boost, splenocytes were harvested from the immunized mouse spleen and fused with NSI/1-Ag4-1 myeloma cells by 50% polyethylene glycol (GIBCO™). Those hybridomas, positive for MIA PaCa-2 but negative for NNM, were then subcloned by limited dilution and preserved in liquid nitrogen. Ascites were produced in pristane-primed BALB/cJ mice and mAbs purified with protein G Sepharose 4G gel (GE).
Identification of the Target Protein of Pa65-2
MIA PaCa-2 cell lysates were purified by protein G sepharose (GE), coupled with Pa65-2 and eluted with elution buffer. The eluates were separated by SDS-PAGE. The band of interest was cut from the gel, reduced with dithioerythreitol (DTE) alkylated with iodoacetamide (IAA) and digested with trypsin for 16 h at 37° C. The digested peptides were analyzed by LC-MS/MS sequencing in the Core Facility for Proteomics and Structural Biology Research at Academia Sinica (Taipei).
Immunoprecipitation and Immunoblotting Assay
Cells were extracted with RIPA buffer and the supernatants were immunoprecipitated using either anti-CHC antibody, Pa65-2, mAb X-22 (Affinity), or anti-HIF-1α antibody (BD), then analyzed by immunoblotting. The signals were developed using enhanced chemiluminescence reagents (ECL) (Thermo).
Enzyme-Linked Immunosorbent Assay and Flow Cytometric Analysis
Cells were cultured in 96-well polystyrene plates for 3 days and then fixed with 2% paraformaldehyde. After blocking and washing twice with PBS/0.1 % Tween 20 (PBST0.1), the hybridoma supernatants were added and the plates were incubated for 2 h at room temperature. This was followed by washing and incubating with horseradish peroxidase (HRP)-conjugated goat anti-mouse IgG for 1 h. The colorimetric reaction was developed with the substrate ortho-phenylene-diamine (OPD) according to the manufacturer's instructions (Sigma), and was stopped by adding 3 N HCl. Absorbance at 490 nm was measured using a microplate reader. Each control and test group was tested in triplicate. Each experiment was repeated at least three times. To analyse binding, cells (1×105 cells per tube) were prepared, washed, centrifuged, and resuspended in 100 μl of PBS/1% FCS containing Pa65-2 or NM-IgG. Cells were incubated at 4° C. for 1 h, washed twice with PBS/1% FCS and stained with fluorescent isothiocyanate (FITC)-labeled goat anti-mouse IgG at 4° C. for 20 min. The stained cells were washed twice and fluorescence signals were measured using a FACScan (BD). At least 5×103 cells were acquired by list mode, measurements were performed on a single cell basis, and were displayed as frequency distribution histograms or dot histograms.
MTT assay
Cells were cultured in 96-wells plates. To reduce cancer growth, the cells were culture in Dulbecco's modified Eagle's medium (DMEM) containing 50 μg/ml Pa65-2 or NM-IgG. After incubating for 0, 1, 2, 3 days, the cells were subjected to an MTT assay. The absorbance was determined with a microplate reader at 540 nm. Each assay was repeated for three times.
Inhibition of HUVEC Internalization by Pa65-2
HUVEC were washed with serum-free medium, incubated in 1% BSA in serum-free medium at 37° C., and pretreated with Pa65-2 or NM-IgG (50 μg/ml) at 37° C. They were then incubated with or without VEGF-A (40 ng/ml) at 37° C. or 4° C. After cells were washed, fixed and made permeable. The permeable cells were incubated with anti VEGF-A antibody (A-20, Santa Cruz). Finally, cells were stained using Rhodamine-conjugated secondary antibodies.
Cell Proliferation Analysis and Invasion Assays
RT-CES (ACEA), a microelectronic cell sensor system, was used to count tire number of living cells. Cells (5×103) were seeded into each sensor-containing well in microliter plates. The electronic sensors provided a continuous (every 6 h), quantitative measurement of the cell index in each well. Cell growth was measured for 72 h, and cell indices for each well were recorded at all time points. Cell invasion was assayed in 24-well Biocoat Matrigel invasion chambers (8 μm; Millipore) according to the manufacturer's directions. Cells were counted under a microscope in five predetermined fields. Assays were performed in triplicate.
shRNA Transfection and Luciferase Reporter Gene Assays
Lentiviruses (pLKO.1) containing the CHC shRNA ID TRCN0000007984 (Academia Sinica, Taipei) and pLKO.1 empty vector controls were generated and used to infect MIA PaCa-2 cells. The stable transfectants were established by puromycin selection. The VEGF reporter plasmids contains nucleotides −2274 to +379 of the VEGFgene inserted into luciferase reporter pGL2-Basic (PROMEGA™) as previously described (Forsythe et al (1996) Activation of vascular endothelial growth factor gene transcription by hypoxia-inducible factor 1. Mol Cell Biol, 16, 4604-13), VEGF promoter primer sequences are presented in Table 3. Luciferase reporter gene assays were conducted using the Renilla Luciferase Assay System (PROMEGA™) according to the manufacturer's directions. The Renilla luciferase was constructed for normalization of transfection efficiency. Relative light units were calculated as the ratio of Firefly luciferase to Renilla luciferase activity (normalized luciferase activity).
Quantitative Reverse Transcription Polymerase Chain Reaction (RT-PCR)
RNA extractions were performed using the RNeasy Mini kit (QIAGEN,) according to the manufacturer's instructions. First strand cDNA was synthesized from 1.0 μg of total RNA by SuperScript III reverse transcriptase (INVITROGEN™). CLTC, VEGF, HIF-1α, erythropoietin (EPO), platelet-derived growth factor-β (PDGF-β) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) primers sequences are presented in Table 4. Real-time PCR was performed using a LightCycler 480 System (Roche). Cycling temperatures were as follows: denaturing 94° C., annealing 60° C., and extension 70° C. Data were normalized by the expression level of GAPDH in each sample.
Hypoxia Assay
For hypoxia experiments, MIA PaCa-2 cells were grown in a Ruskinn Hypoxic Chamber (APM-50D, 18 Astec, Japan) and treated with either 1% O2, 5% CO2 for 18 h, or given DFX, deferoxamine (100 μM, Sigma) treatment for 5 or 16 h. For proteasome inhibitor treatment, MG132 (10 μM, Sigma) was added to culture medium then incubated 5 to 17 h.
Chromatin Immunoprecipitation (ChIP)
The protocol for chromatin immunoprecipitation (ChIp) has been described previously. Briefly, control and shCHC-expressing MIA PaCa-2 cells were fixed with 1% formaldehyde, lysed in lysis buffer, sonicated, and clarified by centrifugation. The supernatant was immunoprecipitated with anti-CHC, anti-HIF-1α (Abcam) or NM-IgG (Sigma) antibodies. The precipitates were then amplified by the LightCycler 480 System. The relative abundance of specific sequences in immunoprecipitated DMA was determined using the ΔΔC1 method with C1 obtained for total extracted DNA (Input DNA) as a reference value. The amount of immunoprecipitated target was quantified by real-time PCR, and the value of immunoprecipitated target was calculated as the ratio of IP DNA to the total amount of input DNA used for the immunoprecipitation (IP/input) to obtain relative-fold enrichment value. ChIP primers sequences are presented in Table 5.
Immuno-Electron Microscopy
Cells were gently scraped out of the flasks using a cell scraper (Costar) and fixed in paraformaldehyde and glutaraldehyde. Following fixation, cell pellets were washed with buffer and 30% glycerol and gently agitated overnight at room temperature. Cells were subjected to freeze substitution in an AFS (Leica), in which they were dehydrated by methanol at −91° C. for 4-5 days. Cells were later warmed to −50° C., embedded in Lowicryl HM20, and polymerized at −50° C. by UV. Ultrathin sections of 90 nm thickness were obtained using an Ultracut UC7 (Leica). The sections were incubated with the Pa65-2 mouse IgG or anti-HIF-1α rabbit IgG. The secondary antibodies (Jackson), goat anti-mouse IgG (F(ab′)2 fragment) conjugated with 18 nm gold particles, or goat anti-rabbit IgG (F(ab′)2 fragment) conjugated with 12 nm gold particles, were then applied to their respective sections. Finally, the sections were stained with uranyl acetate and lead citrate, and examined by TEM (Hitachi).
Inhibition of Cell Internalization by Pa65-2
EGF and Tf uptake assays were carried out using a fluorescence-based approach, as previously described (26). Cells were washed with serum-free medium, incubated in 1% BSA in serum-free medium at 37° C., and pretreated with Pa65-2 or NM-IgG (50 μg/ml) at 37° C. They were then incubated with or without Alex 555-EGF (1 μg/ml, INVITROGEN™) or Alex 555-transferrin (50 μg/ml) at 37° C. or 4° C. The cells were imaged using a Leica TCS SP confocal microscope (Leica).
Immunofluorescent Staining
Cells were incubated with anti-Pa65-2 and anti-HIF-1α antibodies, and then with FITC- or Rhodamine-conjugated secondary antibodies (Jackson). Images were captured by confocal microscopy (Leica).
Apoptosis Assay
Apoptosis of cultured cells was verified through the detection of caspase activity using sulforhodamine FLICA apoptosis detection kit (Immunochemistry Technologies). Cells in 96-well culture plates were treated with Pa65-2 or NM-IgG for 24 h. After incubating with FLICA, cells was read at ex/era of 550/595 nm with fluorescence plate reader (Molecular Devices).
Animal Models
All animal experiments were performed as per the guidelines of the National Laboratory Animal Center. The protocol was approved by the Committee on the Ethics of Animal Experiments of Academia Sinica (Taipei). A xenograft model was generated by injecting NOD/SCID mice with MIA PaCa-2 cells transduced with either CHC shRNA or control vector. The two kinds of transduced cells were injected into different lateral sides of the hind limbs of eight animals at the same time. For analysis of antitumor efficacy of Pa65-2, NOD/SCID mice bearing MIA PaCa-2-derived pancreatic cancer xenografts (˜50 mm3) were intravenously injected in the tail vein with Pa65-2, or gemcitabine, or NM-IgG, or equivalent
volumes of PBS. Tumors were measured by calipers every three days, and mice were observed routinely for weight loss as a symptom of drug toxicity. The tumor volumes were calculated as length×(width)2×0.52. Animals were treated following the guidelines established by Academia Sinica (Taipei).
CD31 Staining and Terminal Deoxynucleotidyl Transferase-Mediated dUTP Nick End Labeling (TUNEL) Assay
CD31 staining and TUNEL assays were carried out as described previously. The slides were then visualized under a fluorescent microscope and analyzed with MetaMorph software.
Analysis of Tissue Samples
The human pancreatic cancer gene expression arrays (Origene) were analyzed by an ABI9600 thermocycler (Applied Biosystems). Tissue arrays were purchased from Pantomics Inc. Tissue sections were stained with antibodies specific for CHC (Pa65-2), VEGF (GeneTex), HIF-1α (Millipore), NM-IgG, and UEA-1-FITC (Vector). Quantification of DAB intensity was by HistoQuest software (TissueGnostics). The protocol was approved by the institutional Review Board of Human Subjects Research Ethics Committee of Academia Sinica (Taipei).
cDNA Synthesis and Amplification of Variable Region
Total mRNA was extracted from Pa65-2-producing hybridoma cells using the FastTrack mRNA isolation kit (INVITROGEN™). The cDNA synthesis was based on Orlandi et al. (1989) “Cloning immunoglobulin variable domains for expression by the polymerase chain reaction” Proc Natl Acad Sci USA, 86, 3833-7. A reaction mixture containing 10 μg of mRNA, 20 pmol of VH1FOR primer or VK1FOR primers sequences are presented in Supplementary Table 2, 250 μM of each dNTP, 50 mM Tris-HCl pH 8.3, 140 mM KCl, 10 mM MgCl2, 10 mM dithiothreitol, and 20 units of RNAsin (PHARMACIA™/LKB Biotechnology) was heated at 70° C. for 10 min and cooled. Reverse transcriptase (Anglian Biotec) was added and the reaction incubated at 42° C. for 1 hr. For amplification by Taq DMA polymerase (PROMEGA™), a reaction mixture was made containing 5 μl of the c-DNA-RNA hybrid, 25 pmol of primers VH1FOR or VK1FOR and VH1BACK or VK1BACK primers sequences are presented in Supplementary Table 2. 250 μM of each dNTP, 67 mM Tris chloride (pH 8.8), 17 mM (NH4)2SO4, 10 mM MgCl2, 200 μg of gelatine per ml, and 2 units of Taq DNA polymerase PCR was performed for 45 cycles (1′, 95° C.; 1′, 55° C.; 2′, 72° C.) followed by gel purification. The PCR products were then cloned into TA cloning vector pCR2.1 (INVITROGEN™) according to the manufacturer's protocol and the vector was transfected into the DH5α strain of Escherichia coli (GIBCO BRL™) and sequenced.
Statistical Analyses
Statistical analyses were done using unpaired Student's t-tests where appropriate. *,p<0.05,**,p<0.01 were considered significant.
Enzyme-linked Immunosorbent Assay and Flow Cytometric Analysis
3×103 cells were cultured into each well of 96-well polystyrene plates for 3 days and fixed with 2% paraformaldehyde. Alter blocking and washing twice with PBS/0.1% Tween 20 (PBST0.1), the hybridoma supernatants were added and the plates were incubated for 2 hr at room temperature. This was followed by washing and incubation with horseradish peroxidase (HRP)-conjugated goat anti-mouse IgG for 1 hr. The colorimetric reaction was developed with the substrate ortho-phenylene-diamine (OPD) according to manufacturer's instructions (Sigma, St. Louis, Mo.), and was stopped by adding 3 N HCl. Absorbance at 490 nm was measured using a microplate reader. Each control and test group was tested in triplicate. Each experiment was repeated at least three times. To analyse binding, cells (1×105 cells per tube) were prepared, washed, centrifuged, and resuspended in 100 μl of PBS/1% PCS containing Pa65-2 or NM-IgG. Cells were incubated at 4° C. for 1 hr, washed twice with PBS/1% FCS and stained with fluorescent isothiocyanate (FITC)-labeled goat anti-mouse IgG at 4° C. for 20 min. The stained cells were washed twice and fluorescence signals were measured using a FACScan (BD Biosciences, San Jose, Calif.), At least 5×103 cells were acquired by list mode, measurements were performed on a single cell basis, and were displayed as frequency distribution histograms or dot histograms.
Quantitative Reverse Transcription Polymerase Chain Reaction (RT-PCR)
RNA extractions were performed using the RNeasy Mini kit (QIAGEN, Valencia, Calif.) according to the manufacturer's instructions. First strand cDNA was synthesized from 1.0 μg of total RNA by Superscript III reverse transcriptase (INVITROGEN™, Carlsbad, Calif.). The primers used for PCR amplification were: GAPDH-F, 5′-CTTCACCACCATGGAGGAGGC-3′ (SEQ ID NO: 30); GAPDH-R, 5′-GGCATGGACTGTGGTCATGAG-3′ (SEQ ID NO: 31); and CLTC-F, 5′-GACAAAGGTGGATAAATTAGATGC-3′ (SEQ ID NO: 20); CLTC-R, 5′-TAAACAATGGGTTGTGTCTCTGTA-3′ (SEQ ID NO: 21). Real-time PCR was performed using a LightCycler 480 System (Roche, Indianapolis, Ind.). Cycling temperatures were as follows: denaturing 94° C., annealing 60° C., and extension 70° C. Data were normalized by the expression level of GAPDH in each sample.
cDNA Synthesis and Amplification of Variable Region
Total mRNA was extracted from Pa65-2-producing hybridoma cells using the FastTrack mRNA isolation kit (INVITROGEN™, Carlsbad, Calif.). The cDNA synthesis was based on Orlandi et al. (1989) “Cloning immunoglobulin variable domains for expression by the polymerase chain reaction” Proc Natl Acad Sci USA, 86, 3833-7. A reaction mixture containing 10 μg of mRNA, 20 pmol of VH1FOR primer 5′-d(TGAGGAGACGGTGACCGTGGTCCCTTGGCCCCAG-3′ (SEQ ID NO: 36) or VH1FOR primer 5′-d(GTTAGATCTCCAGCTTGGTCCC-3′ (SEQ ID NO: 37), 250 μM of each dNTP, 50 mM Tris-HCl pH 8.3, 140 mM KCl, 10 mM MgCl2, 10 mM dithiothreitol, and 20 units of RNAsin (PHARMACIA™/LKB Biotechnology, Inc., Piscataway, N.J.) was heated at 70° C. for 10 min and cooled. Reverse transcriptase (Anglian Biotec, Colchester, U.K.) was added and the reaction incubated at 42° C. for 1 hr. For amplification by Taq DNA. polymerase (PROMEGA™, Madison, Wis., USA), a reaction mixture was made containing 5 μl of the cDNA-RNA hybrid, 25 pmol of primers VH1FOR or VH1FOR and VHIBACK 5′-d(AGGTSMARCTGCAGSAGTCWGG-3′ (in which S=C or G, M=A or C, R=A or G, and W=A or T) (SEQ ID NO: 38) or VK1BACK 5′-d(GACATTCAGCTGACCCAGTCTCCA-3′ (SEQ ID NO: 39) as appropriate, 250 μM of each dNTP, 67 mM Tris chloride (pH 8.8), 17 mM (NH4)2SO4, 10 mM MgCl2, 200 μg of gelatine per ml, and 2 units of Taq DNA polymerase. PCR was performed for 45 cycles (1′, 95° C.; 1′, 55° C.; 2′, 72° C.) followed by gel purification, The PCR products were then cloned into TA cloning vector pCR2.1 (INVITROGEN™, Carlsbad, Calif.) according to the manufacturer's protocol and the vector was transfected into the DH5α strain of Escherichia coli (GIBCO BRL™, Gaithersburg, Md., USA) and sequenced.
Wound Scratch Assay
1×105 CL1-5 cells were plated onto tissue culture dishes. After 24 hr incubation, the cells were scratched in a standardized manner with a plastic apparatus to create a cell-free zone in each well, 2 mm in width. The cells were then incubated for 14 hr at 37° C. Migration of the cells into the scratch was observed at time points of 7 hr and 14 hr.
Results
Generation and Characterization of mAbs Against Pancreatic Cancer
To obtain a potential target for pancreatic adenocarcinoma therapy, BALB/cJmice were immunized with MIA PaCa-2 cells. More than 6000 hybridoma clones were obtained. Supernatants from each fusion well were then tested for the production of specific antibodies against MIA PaCa-2 antigens by ELISA assay. Sixteen clones that exhibited higher reactivities against MIA PaCa-2 cells were selected (data not shown). One of these monoclonal antibodies, Pa65-2, was found to specifically recognize MIA PaCa-2 cells but not normal nasal mucosa (NNM) cells, as confirmed by ELSA, flow cytometry, and immunofluorescent analyses (
All 46 specimens of pancreatic cancer tissues were positively stained by Pa65-2, while two normal pancreatic tissues were not, as shown by the pancreatic cancer tissue arrays (
To identify the target of Pa65-2, MIA PaCa-2 total cell lysates were prepared and purified by Pa65-2-conjugated immunoaffinity chromatography. Silver stain and Western blotting demonstrated that Pa65-2 recognized a target protein with a molecular weight of 190 kDa (
Suppressing CHC Expression Inhibits Pancreatic Cancer Growth
To evaluate the functional role of CHC in tumorigenesis, CHC expression was knocked down by shRNA in MIA PaCa-2 cells. When CHC were knockdown in MIA PaCa-2 cells (
CHC Regulates VEGF Expression in Pancreatic Cancer
Knockdown of CHC markedly reduced tumor growth (
We further investigated the molecular mechanism of CHC on the regulation of VEGF gene expression. VEGF mRNA was increased in mock cells under hypoxia treatment, whereas it was decreased markedly under both hypoxic and normoxic conditions when CHC was knocked down (
CHC Interacts with and Stabilizes HIF-1α in MIA PaCa-2 Cells
To investigate whether CHC could interact with HIF-1α, we assessed the co-localization of CHC and HIF-1α by confocal microscopy. Interestingly, CHC was found in 80% of the nuclei of the MIA PaCa-2 cells, while HIF-1α was found in 83% of nuclei of MIA PaCa-2 cells during hypoxia. Together, 70% the nuclei of the MIA PaCa-2 cells contained both CHC and HIF-1α during hypoxia (
It was noticed that the protein level of HIF-1α, which was induced by hypoxia, was decreased in CHC knockdown cells (
Inhibition of Ligand Internalization and Cell Growth by Pa65-2
Clathrin-mediated endocytosis (CME) is a major mechanism for the internalizations of plasma-membrane receptors. We evaluated the effect of Pa65-2 on the internalization of epidermal growth factor (EGF) and transferrin (Tf), known ligands for CME (30,31). As shown in
Pa65-2 Suppression of Pancreatic Xenograft Tumor Growth
Since CHC shRNA knockdown severely affected xenograft tumor growth in vivo, we investigated whether Pa65-2 could be used to directly inhibit tumor angiogenesis and growth in pancreatic cancer, NOD/SCID mice were inoculated with MIA PaCa-2 cells. When the tumors grew up to 50 mm3, mice were administrated with Pa65-2 (10 mg/kg), NM-IgG, or PBS every three days. Results showed that in the Pa65-2-treated groups, the average tumor volume were about 2 fold smaller than the control groups at day 36 (n=6, P<0.05;
TABLE 1
VH domains (SEQ ID NO: 2)
FW1
CDR1
FW2
CDR2
EVKLVESGGGLVKPGG
NYVMS
WVRQTPEKRLEW
TISSGDNYMYYPDS
SLNISCAASGETES
(SEQ ID NO: 4)
VA
VKG
(SEQ ID NO: 10)
(SEQ ID NO: 11)
(SEQ. ID NO: 5)
FW3
CDR3
FW4
RFTISSDNAKNTLFLQM
HFDNYEGNSMDY
WGQGTSVTVSSA
SSLRSEDTALNYCAR
(SEQ ID NO: 6)
KTTPPSDYPLA
(SEQ ID NO: 12)
(SEQ. ID NO: 13)
VL domains (SEQ ID NO: 3)
FW1
CDR1
FW2
CDR2
DIVLTQSPATLSVTPGD
RASQSIRSNLH
WYQQKSHESPRL
YASQSIS
SVSLSC
(SEQ ID NO: 7)
LIK
(SEQ ID NO: 8)
(SEQ ID NO: 14)
(SEQ ID NO: 15)
FW3
CDR3
FW4
GIPSRFSGSGSGTDFILSI
QQSNSWPL
TFGAGTKLELKR
NSVATEDECNYFC
(SEQ ID NO: 9)
ADAAPTVS
(SEQ ID NO: 16)
(SEQ ID NO: 17)
Complementarity-determining regions 1-3 (CDR1-3), and framework regions 1-4 (FW1-4) for both the VH and VL domains are shown. The V domain families were aligned by igblast database.
Table 1 shows the amino acid sequences of VH and VL domains of anti-CMC monoclonal antibody, which is related to the SEQ ID NO: 1 shown in
Table 2 shows CHC expression in human pancreas cancer tissue arrays. We modified the “Quick Score” methods by reducing the original scales (Siegel et al. (2012) “Cancer statistics 2012” CA Cancer J Clin, 62, 10-29). Two indices were used in evaluating the staining results of tumors. Labeling Index (LI) indicates the number of tumor cells that were immunostained (or “positive cells”) as a proportion of the overall number of cells. A score on a scale of 0-2 was assigned; 0-10%=0, 11-49%=1, 50-100% =2. The second index is the Intensity Index (II), which measures the average intensity of the immunostaining. A score on a scale of 0-2 was assigned; no staining=0, weak staining=1, and strong staining=2. The scores from these two indices were added to give the tumor Labeling Score (LS), which ranges from 0-4.
TABLE 2
Pancreas Cancer
Stage
Labeling Score
Normal Pancreas
0
Adenocarcinoma I
T2N0M0
3
T2N1M0
2
T3N0M0
3
T3N1M0
3
Adenocarcinoma II
T2N0M0
2
T3N0M0
3
T3N1MX
3
T4N1M1
4
Adenocarcinoma III
T3N0M0
3
T3N1MX
3
Table 3 shows the list of primers for cloning. Table 4 shows the list of primers for Quantitative RT-PCR. Table 5 shows list of primers for ChIP, Table 6 shows the list of primers for cDNA synthesis and amplification of variable region.
TABLE 3
Name
Sequence (5′-3′)
VEGF f
GGTACCGGGCCACGGAGTGACTGGTGAT
(SEQ ID NO: 18)
VEGF r
CTCGAGGGAAGAGAGAGACGGGGTCAGAGAGA
SEQ ID NO: 19)
TABLE 4
Name
Sequence (5′-3′)
CLTC f
GACAAAGGTGGATAAATTAGATGC
(SEQ ID NO: 20)
CLTC r
TAAACAATGGGTTGTGTCTCTGTA
(SEQ ID NO: 21)
VEGF f
ACATCTTCCAGGAGTACCC
(SEQ ID NO: 22)
YEGf r
CTTGGTGAGGTTTGATCCG
(SEQ ID NO: 23)
HIF-1α f
GGTTCACTTTTTCAAGCAGTAGG
(SEQ ID NO: 24)
HIF-1α r
GTGGTAATCCACTTTCATCCATT
(SEQ ID NO: 25)
EPO f
AGCAGGAAGCATTCAGAGA
(SEQ ID NO: 26)
EPO r
AGGTAAATCGCCTCCAAAG
(SEQ ID NO: 27)
PDGF-β f
CTGGCATGCAAGTGTGAGAC
(SEQ ID NO: 28)
PDGF-β r
CGAATGGTCACCCGAGTTT
(SEQ ID NO: 29)
GAPDH f
CTTCACCACCATGGAGGAGGC
(SEQ ID NO: 30)
GAPDH r
GGCATGGACTGTGGTCATGAG
(SEQ ID NO: 31
TABLE 5
Name
Sequence (5′-3′)
VEGF f
GAGCCCGCGCCCGGAGG
(SEQ ID NO: 32)
VEGF r
CAGCCCAGAAGTTGGAC
(SEQ ID NO: 33)
GAPDH f
AGGTGAAGGTCGGAGTCAAC
(SEQ ID NO: 34)
GAPDH r
TCTTCTGGGTGGCAGTGATG
(SEQ ID NO: 35)
TABLE 6
Name
Sequence (5′-3′)
VH1FOR
d(TGAGGAGACGGTGACCGTGGTCCCTTGGCCCCAG)
(SEQ ID NO: 36)
VK1FOR
d(GTTAGATCTCCAGCTTGGTCCC)
(SEQ ID NO: 37)
VH1BACK
d(AGGTSMARCTGCAGSAGTCWGG-3*
(in which S = C or G, M = A or C,
R = A or G, and W = A or T)
(SEQ ID NO: 38)
VK1RACK
d(GACATTCAGCTGACCCAGTCTCCA)
(SEQ ID NO: 39)
Table 6 shows the list of primers for cDNA synthesis and amplification of the variable region of IgG, As shown in Table 6, the primer VH1BACK includes 25 different sequences. The sequence AGGTCAAACTCCAGSAGTCAGG (SEQ ID NO: 38) is a representative sequence of them.
Discussion
Pa65-2, generated by screening hybridomas against MIA PaCa-2, was found to specifically bind to the cell surface and cytosol of various cancer and tumor blood vessels through interaction with its target, CHC. This study demonstrated that CHC expression is upregulated in cancer cells as well as in tumor-associated endothelial cells. We found that inhibition of CHC by Pa65-2 or shRNA could inhibit tumor growth and angiogenesis. Chip assays indicated that CHC interacted with HIF-1α and participated in the regulation of VEGF transcription. Knockdown of CHC expression also decreased the protein stability of HIF-1α. To our knowledge, this is the first study to demonstrate that CHC promotes angiogenesis and tumor growth by stabilizing HIF-1α, followed by upregulating the expression of VEGF.
Our current study found higher expression levels of CHC in pancreatic cancer tissues as well as in other cancer types. In addition, we found that Pa65-2 binds to tumor cells as well as to tumor-associated endothelial cells. These finding suggest that the expression of CHC in tumor and tumor-associated endothelial cells may be responsible for increasing uptake of growth factors by endocytosis under pathological conditions. Diminishing CHC levels by shRNA resulted in decreased protein stability of HIF-1α and decreased expressions of HIF-1α down-stream genes.
Base on the studies, it was proposed that the CHC promotes tumor growth and angiogenic process through two pathways. One is to increase the uptake of growth factors or receptors by clathrin-mediated endocytosis; the other is to increase the expression of VEGF, possibly by interacting and stabilizing HIF-1α under hypoxic condition (
In summary, Pancreatic adenocarcinoma is an aggressive disease with a high mortality rate. Currently, treatment options are limited. In an effort to improve the efficacy of treatments for pancreatic adenocarcinoma, we have generated a monoclonal antibody (mAb), Pa65-2, which specifically binds to pancreatic cancer cells and tumor blood vessels but not to normal cells. The target protein of Pa65-2 is identified as human clathrin heavy chain (CHC; SEQ ID NO: 1). We found that knockdown of CHC or Pa65-2 treatment not only reduced cancer cell proliferation, colony formation and invasion, but it also induced cancer cell apoptosis. In vivo study showed that suppression of CHC either by shRNA or by Pa65-2 inhibited tumor growth and angiogenesis. One of the key functions of CHC was to bind with the hypoxia-inducing factor (HIF)-1α protein, increasing the stability of this protein and facilitating its nuclear translocation and hypoxia responsive element (HRE) promoter binding, thereby regulating the expression of vascular endothelial growth factor (VEGF). Knockdown of CHC results in downregulations of both HIF-1α and its downstream target gene expressions, such as VEGF, erythropoietin (EPO) and platelet-derived growth factor-β (PDGF-β). Pa65-2 treatment blocked cancer cells' uptake of epidermal growth factor (EGF) and transferrin (Tf), inhibited cancer cell proliferation, invasion, and induced cancer cell apoptosis. Taken together, our findings indicate that CHC plays a role in the processes of tumorigenesis and angiogenesis. Pa65-2 antibody or CHC shRNA can potentially be used for pancreatic cancer therapy.
The foregoing description of the exemplary embodiments of the invention has been presented only for the purposes of illustration and description and is not intended to be exhaustive or to limit the invention to the precise forms disclosed. Many modifications and variations are possible in light of the above teaching.
The embodiments and examples were chosen and described in order to explain the principles of the invention and their practical application so as to enable others skilled in the art to utilize the invention and various embodiments and with various modifications as are suited to the particular use contemplated. Alternative embodiments will become apparent to those skilled in the art to which the present invention pertains without departing from its spirit and scope. Accordingly, the scope of the present invention is defined by the appended claims rather than the foregoing description and the exemplary embodiments described therein.
Some references, which may include patents, patent applications and various publications, are cited and discussed in the description of this invention. The citation and/or discussion of such references is provided merely to clarify the description of the present invention and is not an admission that any such reference is “prior art” to the invention described herein. All references cited and discussed in this specification are incorporated herein by reference in their entireties and to the same extent as if each reference was individually incorporated by reference.
Patent | Priority | Assignee | Title |
Patent | Priority | Assignee | Title |
7473531, | Aug 08 2003 | Applied Biosystems, LLC | Pancreatic cancer targets and uses thereof |
Executed on | Assignor | Assignee | Conveyance | Frame | Reel | Doc |
Oct 04 2012 | Academia Sinica | (assignment on the face of the patent) | / |
Date | Maintenance Fee Events |
Sep 04 2018 | M1551: Payment of Maintenance Fee, 4th Year, Large Entity. |
Sep 06 2022 | M1552: Payment of Maintenance Fee, 8th Year, Large Entity. |
Date | Maintenance Schedule |
Mar 03 2018 | 4 years fee payment window open |
Sep 03 2018 | 6 months grace period start (w surcharge) |
Mar 03 2019 | patent expiry (for year 4) |
Mar 03 2021 | 2 years to revive unintentionally abandoned end. (for year 4) |
Mar 03 2022 | 8 years fee payment window open |
Sep 03 2022 | 6 months grace period start (w surcharge) |
Mar 03 2023 | patent expiry (for year 8) |
Mar 03 2025 | 2 years to revive unintentionally abandoned end. (for year 8) |
Mar 03 2026 | 12 years fee payment window open |
Sep 03 2026 | 6 months grace period start (w surcharge) |
Mar 03 2027 | patent expiry (for year 12) |
Mar 03 2029 | 2 years to revive unintentionally abandoned end. (for year 12) |