This invention provides methods for attaching a nucleic acid to a solid surface and for sequencing nucleic acid by detecting the identity of each nucleotide analogue after the nucleotide analogue is incorporated into a growing strand of dna in a polymerase reaction. The invention also provides nucleotide analogues which comprise unique labels attached to the nucleotide analogue through a cleavable linker, and a cleavable chemical group to cap the —OH group at the 3′-position of the deoxyribose.

Patent
   9133511
Priority
Oct 06 2000
Filed
Aug 05 2013
Issued
Sep 15 2015
Expiry
Oct 06 2020

TERM.DISCL.
Assg.orig
Entity
Large
42
277
EXPIRED<2yrs
1. A method of sequencing nucleic acid, comprising:
a) reacting a dna strand containing an azido group with a phosphine;
b) growing a double-stranded dna containing said dna strand by incorporating a fluorescently labeled nucleotide into said strand; and
c) identifying the fluorescently labeled nucleotide, so as to sequence the nucleic acid.
15. A method of simultaneously sequencing a plurality of different nucleic acids, comprising:
a) reacting each of a plurality of different dna strands containing an azido group with a phosphine;
b) growing a plurality of double-stranded dna, each of which comprises one of said dna strands, by incorporating a fluorescently labeled nucleotide; and
c) identifying each fluorescently labeled nucleotide, so as to simultaneously sequence the plurality of different nucleic acids.
8. A method of sequencing nucleic acid comprising:
a) providing a nucleic acid template hybridized to a primer, the primer comprising an azido group;
b) reacting said azido group with a phosphine;
c) extending the primer hybridized to said nucleic acid template with a fluorescently labeled nucleotide or nucleotide analogue,
wherein said fluorescently labeled nucleotide or nucleotide analogue has the label linked to the base and a blocking group on the 3′-hydroxyl group; and
d) identifying the fluorescently labeled nucleotide, so as to sequence the nucleic acid.
2. The method of claim 1, wherein said fluorescently labeled nucleotide has the label linked to the base and a blocking group on the 3′-hydroxyl group.
3. The method of claim 2, wherein the label is attached to the base via a cleavable linker.
4. The method of claim 1, wherein the phosphine is a triarylphosphine.
5. The method of claim 1, wherein the azido group is attached to the deoxyribose at a 5′ position.
6. The method of claim 1, wherein the azido group is attached to the deoxyribose via a linker.
7. The method of claim 1, wherein the nucleotide analogue comprises a deazapurine base.
9. The method of claim 8, wherein said fluorescently labeled nucleotide or nucleotide analogue has the label on the base and a blocking group on the 3′-hydroxyl group.
10. The method of claim 9, wherein the label is attached to the base via a cleavable linker.
11. The method of claim 8, wherein the phosphine is a triarylphosphine.
12. The method of claim 8, wherein the azido group is attached to the deoxyribose at a 5′ position.
13. The method of claim 8, wherein the azido group is attached to the deoxyribose via a linker.
14. The method of claim 8, wherein the nucleotide analogue comprises a deazapurine base.
16. The method of claim 15, wherein said fluorescently labeled nucleotide or nucleotide analogue has the label linked to the base and a blocking group on the 3′-hydroxyl group.
17. The method of claim 16, wherein the label is attached to the base via a cleavable linker.
18. The method of claim 15, wherein the phosphine is a triarylphosphine.
19. The method of claim 15, wherein the azido group is attached to the deoxyribose at a 5′ position via a linker.
20. The method of claim 15, wherein the nucleotide analogue comprises a deazapurine base.

This application is a continuation of U.S. Ser. No. 13/672,437, filed Nov. 8, 2012, which is a continuation of U.S. Ser. No. 13/339,089, filed Dec. 28, 2011, now abandoned, a continuation of U.S. Ser. No. 12/804,284, filed Jul. 19, 2010, now U.S. Pat. No. 8,088,575, issued Jan. 3, 2012, a continuation of U.S. Ser. No. 11/810,509, filed Jun. 5, 2007, now U.S. Pat. No. 7,790,869, issued Sep. 7, 2010, a continuation of U.S. Ser. No. 10/702,203, filed Nov. 4, 2003, now U.S. Pat. No. 7,345,159, issued Mar. 18, 2008, a divisional of U.S. Ser. No. 09/972,364, filed Oct. 5, 2001, now U.S. Pat. No. 6,664,079, issued Dec. 16, 2003, claiming benefit of U.S. Provisional Application No. 60/300,894, filed Jun. 26, 2001, and is a continuation-in-part of U.S. Ser. No. 09/684,670, filed Oct. 6, 2000, now abandoned, the contents of each of which are hereby incorporated in their entireties into this application.

This invention was made with government support under grant no. BES0097793 awarded by the National Science Foundation. The government has certain rights in the invention.

Throughout this application, various publications are referenced in parentheses by author and year. Full citations for these references may be found at the end of the specification immediately preceding the claims. The disclosures of these publications in their entireties are hereby incorporated by reference into this application to more fully describe the state of the art to which this invention pertains.

The ability to sequence deoxyribonucleic acid (DNA) accurately and rapidly is revolutionizing biology and medicine. The confluence of the massive Human Genome Project is driving an exponential growth in the development of high throughput genetic analysis technologies. This rapid technological development involving chemistry, engineering, biology, and computer science makes it possible to move from studying single genes at a time to analyzing and comparing entire genomes.

With the completion of the first entire human genome sequence map, many areas in the genome that are highly polymorphic in both axons and introns will be known. The pharmacogenomics challenge is to comprehensively identify the genes and functional polymorphisms associated with the variability in drug response (Roses, 2000). Resequencing of polymorphic areas in the genome that are linked to disease development will contribute greatly to the understanding of diseases, such as cancer, and therapeutic development. Thus, high-throughput accurate methods for resequencing the highly variable intron/exon regions of the genome are needed in order to explore the full potential of the complete human genome sequence map. The current state-of-the-art technology for high throughput DNA sequencing, such as used for the Human Genome Project (Pennisi 2000), is capillary array DNA sequencers using laser induced fluorescence detection (Smith et al., 1986; Ju at al. 1995, 1996; Kheterpal at al. 1996; Salas-Solano at al. 1998). Improvements in the polymerase that lead to uniform termination efficiency and the introduction of thermostable polymerases have also significantly improved the quality of sequencing data (Tabor and Richardson, 1987, 1995). Although capillary array DNA sequencing technology to some extent addresses the throughput and read length requirements of large scale DNA sequencing projects, the throughput and accuracy required for mutation studies needs to be improved for a wide variety of applications ranging from disease gene discovery to forensic identification. For example, electrophoresis based DNA sequencing methods have difficulty detecting heterozygotes unambiguously and are not 100% accurate in regions rich in nucleotides comprising guanine or cytosine due to compressions (Bowling et al. 1991; Yamakawa et al. 1997). In addition, the first few bases after the priming site are often masked by the high fluorescence signal from excess dye-labeled primers or dye-labeled terminators, and are therefore difficult to identify. Therefore, the requirement of electrophoresis for DNA sequencing is still the bottleneck for high-throughput DNA sequencing and mutation detection projects.

The concept of sequencing DNA by synthesis without using electrophoresis was first revealed in 1988 (Hyman, 1988) and involves detecting the identity of each nucleotide as it is incorporated into the growing strand of DNA in a polymerase reaction. Such a scheme coupled with the chip format and laser-induced fluorescent detection has the potential to markedly increase the throughput of DNA sequencing projects. Consequently, several groups have investigated such a system with an aim to construct an ultra high-throughput DNA sequencing procedure (Cheeseman 1994, Metzker at al. 1994). Thus far, no complete success of using such a system to unambiguously sequence DNA has been reported. The pyrosequencing approach that employs four natural nucleotides (comprising a base of adenine (A), cytosine (C), guanine (G), or thymine (T)) and several other enzymes for sequencing DNA by synthesis is now widely used for mutation detection (Ronaghi 1998). In this approach, the detection is based on the pyrophosphate (PPi) released during the DNA polymerase reaction, the quantitative conversion of pyrophosphate to adenosine triphosphate (ATP) by sulfurylase, and the subsequent production of visible light by firefly luciferase. This procedure can only sequence up to 30 base pairs (bps) of nucleotide sequences, and each of the 4 nucleotides needs to be added separately and detected separately. Long stretches of the same bases cannot be identified unambiguously with the pyrosequencing method.

More recent work in the literature exploring DNA sequencing by a synthesis method is mostly focused on designing and synthesizing a photocleavable chemical moiety that is linked to a fluorescent dye to cap the 3′-OH group of deoxynucleoside triphosphates (dNTPs) (Welch et al. 1999). Limited success for the incorporation of the 3′-modified nucleotide by DNA polymerase is reported. The reason is that the 3′-position on the deoxyribose is very close to the amino acid residues in the active site of the polymerase, and the polymerase is therefore sensitive to modification in this area of the deoxyribose ring. On the other hand, it is known that modified DNA polymerases (Thermo Sequenase and Taq FS polymerase) are able to recognize nucleotides with extensive modifications with bulky groups such as energy transfer dyes at the 5-position of the pyrimidines (T and C) and at the 7-position of purines (G and A) (Rosenblum at al. 1997, Zhu et al. 1994). The ternary complexes of rat DNA polymerase, a DNA template-primer, and dideoxycytidine triphosphate (ddCTP) have been determined (Pelletier et al. 1994) which supports this fact. As shown in FIG. 1, the 3-D structure indicates that the surrounding area of the 3′-position of the deoxyribose ring in ddCTP is very crowded, while there is ample space for modification on the 5-position the cytidine base.

The approach disclosed in the present application is to make nucleotide analogues by linking a unique label such as a fluorescent dye or a mass tag through a cleavable linker to the nucleotide base or an analogue of the nucleotide base, such as to the 5-position of the pyrimidines (T and C) and to the 7-position of the purines (G and A), to use a small cleavable chemical moiety to cap the 3′-OH group of the deoxyribose to make it nonreactive, and to incorporate the nucleotide analogues into the growing DNA strand as terminators. Detection of the unique label will yield the sequence identity of the nucleotide. Upon removing the label and the 3′-OH capping group, the polymerase reaction will proceed to incorporate the next nucleotide analogue and detect the next base.

It is also desirable to use a photocleavable group to cap the 3′-OH group. However, a photocleavable group is generally bulky and thus the DNA polymerase will have difficulty to incorporate the nucleotide analogues containing a photocleavable moiety capping the 3′-OH group. If small chemical moieties that can be easily cleaved chemically with high yield can be used to cap the 3′-OH group, such nucleotide analogues should also be recognized as substrates for DNA polymerase. It has been reported that 3′-O-methoxy-deoxynucleotides are good substrates for several polymerases (Axelrod et al. 1978). 3′-O-allyl-dATP was also shown to be incorporated by Ventr(exo-) DNA polymerase in the growing strand of DNA (Metzker et al. 1994). However, the procedure to chemically cleave the methoxy group is stringent and requires anhydrous conditions. Thus, it is not practical to use a methoxy group to cap the 3′-OH group for sequencing DNA by synthesis. An ester group was also explored to cap the 3′-OH group of the nucleotide, but it was shown to be cleaved by the nucleophiles in the active site in DNA polymerase (Canard at al. 1995). Chemical groups with electrophiles such as ketone groups are not suitable for protecting the 3′-OH of the nucleotide in enzymatic reactions due to the existence of strong nucleophiles in the polymerase. It is known that MOM (—CH2OCH3) and allyl (—CH2CH═CH2) groups can be used to cap an —OH group, and can be cleaved chemically with high yield (Ireland at al. 1986; Kamal et al. 1999). The approach disclosed in the present application is to incorporate nucleotide analogues, which are labeled with cleavable, unique labels such as fluorescent dyes or mass tags and where the 3′-OH is capped with a cleavable chemical moiety such as either a MOM group (—CH2OCH3) or an allyl group (—CH2CH═CH2), into the growing strand DNA as terminators. The optimized nucleotide set (3′-RO-A-LABEL1, 3′-RO-C-LABEL2, 3′-RO-G-LABEL3, 3′-RO-T-LABEL4, where R denotes the chemical group used to cap the 3′-OH) can then be used for DNA sequencing by the synthesis approach.

There are many advantages of using mass spectrometry (MS) to detect small and stable molecules. For example, the mass resolution can be as good as one dalton. Thus, compared to gel electrophoresis sequencing systems and the laser induced fluorescence detection approach which have overlapping fluorescence emission spectra, leading to heterozygote detection difficulty, the MS approach disclosed in this application produces very high resolution of sequencing data by detecting the cleaved small mass tags instead of the long DNA fragment. This method also produces extremely fast separation in the time scale of microseconds. The high resolution allows accurate digital mutation and heterozygote detection. Another advantage of sequencing with mass spectrometry by detecting the small mass tags is that the compressions associated with gel based systems are completely eliminated.

In order to maintain a continuous hybridized primer extension product with the template DNA, a primer that contains a stable loop to form an entity capable of self-priming in a polymerase reaction can be ligated to the 3′ end of each single stranded DNA template that is immobilized on a solid surface such as a chip. This approach will solve the problem of washing off the growing extension products in each cycle.

Saxon and Bertozzi (2000) developed an elegant and highly specific coupling chemistry linking a specific group that contains a phosphine moiety to an azido group on the surface of a biological cell. In the present application, this coupling chemistry is adopted to create a solid surface which is coated with a covalently linked phosphine moiety, and to generate polymerase chain reaction (PCR) products that contain an azido group at the 5′ end for specific coupling of the DNA template with the solid surface. One example of a solid surface is glass channels which have an inner wall with an uneven or porous surface to increase the surface area. Another example is a chip.

The present application discloses a novel and advantageous system for DNA sequencing by the synthesis approach which employs a stable DNA template, which is able to self prime for the polymerase reaction, covalently linked to a solid surface such as a chip, and 4 unique nucleotides analogues (3′-RO-A-LABEL1, 3′-RO-C-LABEL2, 3′-RO-G-LABEL3, 3′-RO-T-LABEL4). The success of this novel system will allow the development of an ultra high-throughput and high fidelity DNA sequencing system for polymorphism, pharmacogenetics applications and for whole genome sequencing. This fast and accurate DNA resequencing system is needed in such fields as detection of single nucleotide polymorphisms (SNPs) (Chee et al. 1996), serial analysis of gene expression (SAGE) (Velculescu et al. 1995), identification in forensics, and genetic disease association studies.

This invention is directed to a method for sequencing a nucleic acid by detecting the identity of a nucleotide analogue after the nucleotide analogue is incorporated into a growing strand of DNA in a polymerase reaction, which comprises the following steps:

The invention provides a method of attaching a nucleic acid to a solid surface which comprises:

The invention provides a nucleotide analogue which comprises:

The invention provides a parallel mass spectrometry system, which comprises a plurality of atmospheric pressure chemical ionization mass spectrometers for parallel analysis of a plurality of samples comprising mass tags.

FIG. 1: The 3D structure of the ternary complexes of rat DNA polymerase, a DNA template-primer, and dideoxycytidine triphosphate (ddCTP). The left side of the illustration shows the mechanism for the addition of ddCTP and the right side of the illustration shows the active site of the polymerase. Note that the 3′ position of the dideoxyribose ring is very crowded, while ample space is available at the 5 position of the cytidine base.

FIG. 2A-2B: Scheme of sequencing by the synthesis approach. A: Example where the unique labels are dyes and the solid surface is a chip. B: Example where the unique labels are mass tags and the solid surface is channels etched into a glass chip. A, C, G, T; nucleotide triphosphates comprising bases adenine, cytosine, guanine, and thymine; d, deoxy; dd, dideoxy; R, cleavable chemical group used to cap the —OH group; Y, cleavable linker.

FIG. 3: The synthetic scheme for the immobilization of an azido (N3) labeled DNA fragment to a solid surface coated with a triarylphosphine moiety. Me, methyl group; P, phosphorus; Ph, phenyl.

FIG. 4: The synthesis of triarylphosphine N-hydroxysuccinimide (NHS) ester.

FIG. 5: The synthetic scheme for attaching an azido (N3) group through a linker to the 5 end of a DNA fragment, which is then used to couple with the triarylphosphine moiety on a solid surface. DMSO, dimethylsulfonyl oxide.

FIG. 6A-6B: Ligate the looped primer (B) to the immobilized single stranded DNA template forming a self primed DNA template moiety on a solid surface. P (in circle), phosphate.

FIG. 7: Examples of structures of four nucleotide analogues for use in the sequencing by synthesis approach. Each nucleotide analogue has a unique fluorescent dye attached to the base through a photocleavable linker and the 3′-OH is either exposed or capped with a MOM group or an allyl group. FAM, 5-carboxyfluorescein; R6G, 6-carboxyrhodamine-6G; TAM, N,N,N′,N′-tetramethyl-6-carboxyrhodamine; ROX, 6-carboxy-X-rhodamine. R═H, CH2OCH3 (MOM) or CH2CH═CH2 (Allyl).

FIG. 8: A representative scheme for the synthesis of the nucleotide analogue 3′-RO-G-Tam. A similar scheme can be used to create the other three modified nucleotides: 3′-RO-A-Dye1, 3′-RO-C-Dye2, 3′-RO-T-Dye4. (i) tetrakis(triphenylphosphine)palladium(0); (ii) POCl3, Bn4N+pyrophosphate; (iii) NH4OH; (iv) Na2CO3/NaHCO3 (pH=9.0)/DMSO.

FIG. 9: A scheme for testing the sequencing by synthesis approach. Each nucleotide, modified by the attachment of a unique fluorescent dye, is added one by one, based on the complimentary template. The dye is detected and cleaved to test the approach. Dye1=Fam; Dye2=R6G; Dye3=Tam; Dye4=Rox.

FIG. 10: The expected photocleavage products of DNA containing a photo-cleavable dye (Tam). Light absorption (300-360 nm) by the aromatic 2-nitrobenzyl moiety causes reduction of the 2-nitro group to a nitroso group and an oxygen insertion into the carbon-hydrogen bond located in the 2-position followed by cleavage and decarboxylation (Pillai 1980).

FIG. 11: Synthesis of PC-LC-Biotin-FAM to evaluate the photolysis efficiency of the fluorophore coupled with the photocleavable linker 2-nitrobenzyl group.

FIG. 12: Fluorescence spectra (λex=480 nm) of PC-LC-Biotin-FAM immobilized on a microscope glass slide coated with streptavidin (a); after 10 min photolysis (λirr=350 nm; ˜0.5 mW/cm2) (b); and after washing with water to remove the photocleaved dye (c).

FIG. 13A-13B: Synthetic scheme for capping the 3′-OH of nucleotide.

FIG. 14: Chemical cleavage of the MOM group (top row) and the allyl group (bottom row) to free the 3′-OH in the nucleotide. CITMS=chlorotrimethylsilane.

FIG. 15A-15B: Examples of energy transfer coupled dye systems, where Fam or Cy2 is employed as a light absorber (energy transfer donor) and Cl2Fam, Cl2R6G, Cl2Tam, or Cl2Rox as an energy transfer acceptor. Cy2, cyanine; FAM, 5-carboxyfluorescein; R6G, 6-carboxyrhodamine-6G; TAM, N,N,N′,N′-tetramethyl-6-carboxyrhodamine; ROX, 6-carboxy-X-rhodamine.

FIG. 16: The synthesis of a photocleavable energy transfer dye-labeled nucleotide. DMF, dimethylformide. DEC=1-(3-dimethylaminopropyl)-3-ethylcarbodimide hydrochloride. R═H, CH2OCH3 (MOM) or CH2CH═CH2 (Allyl).

FIG. 17: Structures of four mass tag precursors and four photoactive mass tags. Precursors: a) acetophenone; b) 3-fluoroacetophenone; c) 3,4-difluoroacetophenone; and d) 3,4-dimethoxyacetophenone. Four photoactive mass tags are used to code for the identity of each of the four nucleotides (A, C, G, T).

FIG. 18: Atmospheric. Pressure Chemical Ionization (APCI) mass spectrum of mass tag precursors shown in FIG. 17.

FIG. 19: Examples of structures of four nucleotide analogues for use in the sequencing by synthesis approach. Each nucleotide analogue has a unique mass tag attached to the base through a photocleavable linker, and the 3′-OH, is either exposed or capped with a MOM group or an allyl group. The square brackets indicated that the mass tag is cleavable. R═H, CH2OCH3 (MOM) or CH2CH═CH2 (Allyl).

FIG. 20: Example of synthesis of NHS ester of one mass tag (Tag-3). A similar scheme is used to create other mass tags.

FIG. 21: A representative scheme for the synthesis of the nucleotide analogue 3′-RO-G-Tag3. A similar scheme is used to create the other three modified bases 3′-RO-A-Tag1, 3′-RO-C-Tag2, 3′-RO-T-Tag4. (i) tetrakis(triphenylphosphine)palladium(0); (ii) POCl3, Bn4N+pyrophosphate; (iii) NH4OH; (iv) Na2CO3/NaHCO3 (pH=9.0)/DMSO.

FIG. 22: Examples of expected photocleavage products of DNA containing a photocleavable mass tag.

FIG. 23: System for DNA sequencing comprising multiple channels in parallel and multiple mass spectrometers in parallel. The example shows 96 channels in a silica glass chip.

FIG. 24: Parallel mass spectrometry system for DNA sequencing. Example shows three mass spectrometers in parallel. Samples are injected into the ion source where they are mixed with a nebulizer gas and ionized. A′ turbo pump is used to continuously sweep away free radicals, neutral compounds and other undesirable elements coming from the ion source. A second turbo pump is used to generate a continuous vacuum in all three analyzers and detectors simultaneously. The acquired signal is then converted to a digital signal by the A/D converter. All three signals are then sent to the data acquisition processor to convert the signal to identify the mass tag in the injected sample and thus identify the nucleotide sequence.

The following definitions are presented as an aid in understanding this invention.

As used herein, to cap an —OH group means to replace the “H” in the —OH group with a chemical group. As disclosed herein, the —OH group of the nucleotide analogue is capped with a cleavable chemical group. To uncap an —OH group means to cleave the chemical group from a capped —OH group and to replace the chemical group with “H”, i.e., to replace the “R” in —OR with “H” wherein “R” is the chemical group used to cap the —OH group.

The nucleotide bases are abbreviated as follows: adenine (A), cytosine (C), guanine (G), thymine (T), and uracil (U).

An analogue of a nucleotide base refers to a structural and functional derivative of the base of a nucleotide which can be recognized by polymerase as a substrate. That is, for example, an analogue of adenine (A) should form hydrogen bonds with thymine (T), a C analogue should form hydrogen bonds with G, a G analogue should form hydrogen bonds with C, and a T analogue should form hydrogen bonds with A, in a double helix format. Examples of analogues of nucleotide bases include, but are not limited to, 7-deaza-adenine and 7-deaza-guanine, wherein the nitrogen atom at the 7-position of adenine or guanine is substituted with a carbon atom.

A nucleotide analogue refers to a chemical compound that is structurally and functionally similar to the nucleotide, i.e. the nucleotide analogue can be recognized by polymerase as a substrate. That is, for example, a nucleotide analogue comprising adenine or an analogue of adenine should form hydrogen bonds with thymine, a nucleotide analogue comprising C or an analogue of C should form hydrogen bonds with G, a nucleotide analogue comprising G or an analogue of G should form hydrogen bonds with C, and a nucleotide analogue comprising T or an analogue of T should form hydrogen bonds with A, in a double helix format. Examples of nucleotide analogues disclosed herein include analogues which comprise an analogue of the nucleotide base such as 7-deaza-adenine or 7-deaza-guanine, wherein the nitrogen atom at the 7-position of adenine or guanine is substituted with a carbon atom. Further examples include analogues in which a label is attached through a cleavable linker to the 5-position of cytosine or thymine or to the 7-position of deaza-adenine or deaza-guanine. Other examples include analogues in which a small chemical moiety such as —CH2OCH3 or —CH2CH═CH2 is used to cap the —OH group at the 3′-position of deoxyribose. Analogues of dideoxynucleotides can similarly be prepared.

As used herein, a porous surface is a surface which contains pores or is otherwise uneven, such that the surface area of the porous surface is increased relative to the surface area when the surface is smooth.

The present invention is directed to a method for sequencing a nucleic acid by detecting the identity of a nucleotide analogue after the nucleotide analogue is incorporated into a growing strand of DNA in a polymerase reaction, which comprises the following steps:

In one embodiment of any of the nucleotide analogues described herein, the nucleotide base is adenine. In one embodiment, the nucleotide base is guanine. In one embodiment, the nucleotide base is cytosine. In one embodiment, the nucleotide base is thymine. In one embodiment, the nucleotide base is uracil. In one embodiment, the nucleotide base is an analogue of adenine. In one embodiment, the nucleotide base is an analogue of guanine. In one embodiment, the nucleotide base is an analogue of cytosine. In one embodiment, the nucleotide base is an analogue of thymine. In one embodiment, the nucleotide base is an analogue of uracil.

In different embodiments of any of the inventions described herein, the solid surface is glass, silicon, or gold. In different embodiments, the solid surface is a magnetic bead, a chip, a channel in a chip, or a porous channel in a chip. In one embodiment, the solid surface is glass. In one embodiment, the solid surface is silicon. In one embodiment, the solid surface is gold. In one embodiments, the solid surface is a magnetic bead. In one embodiment, the solid surface is a chip. In one embodiment, the solid surface is a channel in a chip. In one embodiment, the solid surface is a porous channel in a chip. Other materials can also be used as long as the material does not interfere with the steps of the method.

In one embodiment, the step of attaching the nucleic acid to the solid surface comprises:

In one embodiment, the step of coating the solid surface with the phosphine moiety comprises:

In one embodiment, the nucleic acid that is attached to the solid surface is a single-stranded deoxyribonucleic acid (DNA). In another embodiment, the nucleic acid that is attached to the solid surface in step (i) is a double-stranded DNA, wherein only one strand is directly attached to the solid surface, and wherein the strand that is not directly attached to the solid surface is removed by denaturing before proceeding to step (ii). In one embodiment, the nucleic acid that is attached to the solid surface is a ribonucleic acid (RNA), and the polymerase in step (iii) is reverse transcriptase.

In one embodiment, the primer is attached to a 3′ end of the nucleic acid in step (ii), and the attached primer comprises a stable loop and an —OH group at a 3′-position of a deoxyribose capable of self-priming in the polymerase reaction. In one embodiment, the step of attaching the primer to the nucleic acid comprises hybridizing the primer to the nucleic acid or ligating the primer to the nucleic acid. In one embodiment, the primer is attached to the nucleic acid through a ligation reaction which links the 3′ end of the nucleic acid with the 5′ end of the primer.

In one embodiment, one or more of four different nucleotide analogs is added in step (iii), wherein each different nucleotide analogue comprises a different base selected from the group consisting of thymine or uracil or an analogue of thymine or uracil, adenine or an analogue of adenine, cytosine or an analogue of cytosine, and guanine or an analogue of guanine, and wherein each of the four different nucleotide analogues comprises a unique label.

In one embodiment, the cleavable chemical group that caps the —OH group at the 3′-position of the deoxyribose in the nucleotide analogue is —CH2OCH3 or —CH2CH═CH2. Any chemical group could be used as long as the group 1) is stable during the polymerase reaction, 2) does not interfere with the recognition of the nucleotide analogue by polymerase as a substrate, and 3) is cleavable.

In one embodiment, the unique label that is attached to the nucleotide analogue is a fluorescent moiety or a fluorescent semiconductor crystal. In further embodiments, the fluorescent moiety is selected from the group consisting of 5-carboxyfluorescein, 6-carboxyrhodamine-6G, N,N,N′,N′-tetramethyl-6-carboxyrhodamine, and 6-carboxy-X-rhodamine. In one embodiment, the fluorescent moiety is 5-carboxyfluorescein. In one embodiment, the fluorescent moiety is 6-carboxyrhodamine-6G, N,N,N′,N′-tetramethyl-6-carboxyrhodamine. In one embodiment, the fluorescent moiety is 6-carboxy-X-rhodamine.

In one embodiment, the unique label that is attached to the nucleotide analogue is a fluorescence energy transfer tag which comprises an energy transfer donor and an energy transfer acceptor. In further embodiments, the energy transfer donor is 5-carboxyfluorescein or cyanine, and wherein the energy transfer acceptor is selected from the group consisting of dichlorocarboxyfluorescein, dichloro-6-carboxyrhodamine-6G, dichloro-N,N,N′,N′-tetramethyl-6-carboxyrhodamine, and dichloro-6-carboxy-X-rhodamine. In one embodiment, the energy transfer acceptor is dichlorocarboxyfluorescein. In one embodiment, the energy transfer acceptor is dichloro-6-carboxyrhodamine-6G. In one embodiment, the energy transfer acceptor is dichloro-N,N,N′,N′-tetramethyl-6-carboxyrhodamine. In one embodiment, the energy transfer acceptor is dichloro-6-carboxy-X-rhodamine.

In one embodiment, the unique label that is attached to the nucleotide analogue is a mass tag that can be detected and differentiated by a mass spectrometer. In further embodiments, the mass tag is selected from the group consisting of a 2-nitro-α-methyl-benzyl group, a 2-nitro-α-methyl-3-fluorobenzyl group, a 2-nitro-α-methyl-3,4-difluorobenzyl group, and a 2-nitro-α-methyl-3,4-dimethoxybenzyl group. In one embodiment, the mass tag is a 2-nitro-α-methyl-benzyl group. In one embodiment, the mass tag is a 2-nitro-α-methyl-3-fluorobenzyl group. In one embodiment, the mass tag is a 2-nitro-α-methyl-3,4-difluorobenzyl group. In one embodiment, the mass tag is a 2-nitro-α-methyl-3,4-dimethoxybenzyl group. In one embodiment, the mass tag is detected using a parallel mass spectrometry system which comprises a plurality of atmospheric pressure chemical ionization mass spectrometers for parallel analysis of a plurality of samples comprising mass tags.

In one embodiment, the unique label is attached through a cleavable linker to a 5-position of cytosine or thymine or to a 7-position of deaza-adenine or deaza-guanine. The unique label could also be attached through a cleavable linker to another position in the nucleotide analogue as long as the attachment of the label is stable during the polymerase reaction and the nucleotide analog can be recognized by polymerase as a substrate. For example, the cleavable label could be attached to the deoxyribose.

In one embodiment, the linker between the unique label and the nucleotide analogue is cleaved by a means selected from the group consisting of one or more of a physical means, a chemical means, a physical chemical means, heat, and light. In one embodiment, the linker is cleaved by a physical means. In one embodiment, the linker is cleaved by a chemical means. In one embodiment, the linker is cleaved by a physical chemical means. In one embodiment, the linker is cleaved by heat. In one embodiment, the linker is cleaved by light. In one embodiment, the linker is cleaved by ultraviolet light. In a further embodiment, the cleavable linker is a photocleavable linker which comprises a 2-nitrobenzyl moiety.

In one embodiment, the cleavable chemical group used to cap the —OH group at the 3′-position of the deoxyribose is cleaved by a means selected from the group consisting of one or more of a physical means, a chemical means, a physical chemical means, heat, and light. In one embodiment, the linker is cleaved by a physical chemical means. In one embodiment, the linker is cleaved by heat. In one embodiment, the linker is cleaved by light. In one embodiment, the linker is cleaved by ultraviolet light.

In one embodiment, the chemical compounds added in step (vi) to permanently cap any unreacted —OH group on the primer, attached to the nucleic acid or on the primer extension strand are a polymerase and one or more different dideoxynucleotides or analogues of dideoxynucleotides. In further embodiments, the different dideoxynucleotides are selected from the group consisting of 2′,3′-dideoxyadenosine 5′-triphosphate, 2′,3′-dideoxyguanosine 5′-triphosphate, 2′,3′-dideoxycytidine 5′-triphosphate, 2′,3′-dideoxythymidine 5′-triphosphate, 2′,3′-dideoxyuridine 5′-triphosphase, and their analogues. In one embodiment, the dideoxynucleotide is 2′,3′-dideoxyadenosine 5′-triphosphate. In one embodiment, the dideoxynucleotide is 2′,3′-dideoxyguanosine 5′-triphosphate. In one embodiment, the dideoxynucleotide is 2′,3′-dideoxycytidine 5′-triphosphate. In one embodiment, the dideoxynucleotide is 2′,3′-dideoxythymidine 5′-triphosphate. In one embodiment, the dideoxynucleotide is 2′,3′-dideoxyuridine 5′-triphosphase. In one embodiment, the dideoxynucleotide is an analogue of 2′,3′-dideoxyadenosine 5′-triphosphate. In one embodiment, the dideoxynucleotide is an analogue of 2′,3′-dideoxyguanosine 5′-triphosphate. In one embodiment, the dideoxynucleotide is an analogue of 2′,3′-dideoxycytidine 5′-triphosphate. In one embodiment, the dideoxynucleotide is an analogue of 2′,3′-dideoxythymidine 5′-triphosphate. In one embodiment, the dideoxynucleotide is an analogue of 2′,3′-dideoxyuridine 5′-triphosphase.

In one embodiment, a polymerase and one or more of four different dideoxynucleotides are added in step (vi), wherein each different dideoxynucleotide is selected from the group consisting of 2′,3′-dideoxyadenosine 5′-triphosphate or an analogue of 2′,3′-dideoxyadenosine 5′-triphosphate; 2′,3′-dideoxyguanosine 5′-triphosphate or an analogue of 2′,3′-dideoxyguanosine 5′-triphosphate; 2′,3′-dideoxycytidine 5′-triphosphate or an analogue of 2′,3′-dideoxycytidine 5′-triphosphate; and 2′,3′-dideoxythymidine 5′-triphosphate or 2′,3′-dideoxyuridine 5′-triphosphase or an analogue of 2′,3′-dideoxythymidine 5′-triphosphate or an analogue of 2′,3′-dideoxyuridine 5′-triphosphase. In one embodiment, the dideoxynucleotide is 2′,3′-dideoxyadenosine 5′-triphosphate. In one embodiment, the dideoxynucleotide is an analogue of 2′,3′-dideoxyadenosine 5′-triphosphate. In one embodiment, the dideoxynucleotide is 2′,3′-dideoxyguanosine 5′-triphosphate. In one embodiment, the dideoxynucleotide is an analogue of 2′,3′-dideoxyguanosine 5′-triphosphate. In one embodiment, the dideoxynucleotide is 2′,3′-dideoxycytidine 5′-triphosphate. In one embodiment, the dideoxynucleotide is an analogue of 2′,3′-dideoxycytidine 5′-triphosphate. In one embodiment, the dideoxynucleotide is 2′,3′-dideoxythymidine 5′-triphosphate. In one embodiment, the dideoxynucleotide is 2′,3′-dideoxyuridine 5′-triphosphase. In one embodiment, the dideoxynucleotide is an analogue of 2′,3′-dideoxythymidine 5′-triphosphate. In one embodiment, the dideoxynucleotide is an analogue of 2′,3′-dideoxyuridine 5′-triphosphase.

Another type of chemical compound that reacts specifically with the —OH group could also be used to permanently cap any unreacted —OH group on the primer attached to the nucleic acid or on an extension strand formed by adding one or more nucleotides or nucleotide analogues to the primer.

The invention provides a method for simultaneously sequencing a plurality of different nucleic acids, which comprises simultaneously applying any of the methods disclosed herein for sequencing a nucleic acid to the plurality of different nucleic acids. In different embodiments, the method can be used to sequence from one to over 100,000 different nucleic acids simultaneously.

The invention provides for the use of any of the methods disclosed herein for detection of single nucleotide polymorphisms, genetic mutation analysis, serial analysis of gene expression, gene expression analysis, identification in forensics, genetic disease association studies, DNA sequencing, genomic sequencing, translational analysis, or transcriptional analysis.

The invention provides a method of attaching a nucleic acid to a solid surface which comprises:

In one embodiment, the step of coating the solid surface with the phosphine moiety comprises:

In different embodiments, the solid surface is glass, silicon, or gold. In different embodiments, the solid surface is a magnetic bead, a chip, a channel in an chip, or a porous channel in a chip.

In different embodiments, the nucleic acid that is attached to the solid surface is a single-stranded or double-stranded DNA or a RNA. In one embodiment, the nucleic acid is a double-stranded DNA and only one strand is attached to the solid surface. In a further embodiment, the strand of the double-stranded DNA that is not attached to the solid surface is removed by denaturing.

The invention provides for the use of any of the methods disclosed herein for attaching a nucleic acid to a surface for gene expression analysis, microarray based gene expression analysis, or mutation detection, translational analysis, transcriptional analysis, or for other genetic applications.

The invention provides a nucleotide analogue which comprises:

In one embodiment of the nucleotide analogue, the cleavable chemical group that caps the —OH group at the 3′-position of the deoxyribose is —CH2OCH3 or —CH2CH═CH2.

In one embodiment, the unique label is a fluorescent moiety or a fluorescent semiconductor crystal. In further embodiments, the fluorescent moiety is selected from the group consisting of 5-carboxyfluorescein, 6-carboxyrhodamine-6G, N,N,N′,N′-tetramethyl-6-carboxyrhodamine, and 6-carboxy-X-rhodamine.

In one embodiment, the unique label is a fluorescence energy transfer tag which comprises an energy transfer donor and an energy transfer acceptor. In further embodiments, the energy transfer donor is 5-carboxyfluorescein or cyanine, and wherein the energy transfer acceptor is selected from the group consisting of dichlorocarboxyfluorescein, dichloro-6-carboxyrhodamine-6G, dichloro-N,N,N′,N′-tetramethyl-6-carboxyrhodamine, and dichloro-6-carboxy-X-rhodamine.

In one embodiment, the unique label is a mass tag that can be detected and differentiated by a mass spectrometer. In further embodiments, the mass tag is selected from the group consisting of a 2-nitro-α-methyl-benzyl group, a 2-nitro-α-methyl-3-fluorobenzyl group, a 2-nitro-α-methyl-3,4-difluorobenzyl group, and a 2-nitro-α-methyl-3,4-dimethoxybenzyl group.

In one embodiment, the unique label is attached through a cleavable linker to a 5-position of cytosine or thymine or to a 7-position of deaza-adenine or deaza-guanine. The unique label could also be attached through a cleavable linker to another position in the nucleotide analogue as long as the attachment of the label is stable during the polymerase reaction and the nucleotide analog can be recognized by polymerase as a substrate. For example, the cleavable label could be attached to the deoxyribose.

In one embodiment, the linker between the unique label and the nucleotide analogue is cleavable by a means selected from the group consisting of one or more of a physical means, a chemical means, a physical chemical means, heat, and light. In a further embodiment, the cleavable linker is a photocleavable linker which comprises a 2-nitrobenzyl moiety.

In one embodiment, the cleavable chemical group used to cap the —OH group at the 3′-position of the deoxyribose is cleavable by a means selected from the group consisting of one or more of a physical means, a chemical means, a physical chemical means, heat, and light.

In different embodiments, the nucleotide analogue is selected from the group consisting of:

##STR00001##

In different embodiments, the nucleotide analogue is selected from the group consisting of:

##STR00002##

In different embodiments, the nucleotide analogue is selected from the group consisting of:

##STR00003##

In different embodiments, the nucleotide analogue is selected from the group consisting of:

##STR00004##

The invention provides for the use any of the nucleotide analogues disclosed herein for detection of single nucleotide polymorphisms, genetic mutation analysis, serial analysis of gene expression, gene expression analysis, identification in forensics, genetic disease association studies, DNA sequencing, genomic sequencing, translational analysis, or transcriptional analysis.

The invention provides a parallel mass spectrometry system, which comprises a plurality of atmospheric pressure chemical ionization mass spectrometers for parallel analysis of a plurality of samples comprising mass tags. In one embodiment, the mass spectrometers are quadrupole mass spectrometers. In one embodiment, the mass spectrometers are time-of-flight mass spectrometers. In one embodiment, the mass spectrometers are contained in one device. In one embodiment, the system further comprises two turbo-pumps, wherein one pump is used to generate a vacuum and a second pump is used to remove undesired elements. In one embodiment, the system comprises at least three mass spectrometers. In one embodiment, the mass tags have molecular weights between 150 daltons and 250 daltons. The invention provides for the use of the system for DNA sequencing analysis, detection of single nucleotide polymorphisms, genetic mutation analysis, serial analysis of gene expression, gene expression analysis, identification in forensics, genetic disease association studies, DNA sequencing, genomic sequencing, translational analysis, or transcriptional analysis.

This invention will be better understood from the Experimental Details which follow. However, one skilled in the art will readily appreciate that the specific methods and results discussed are merely illustrative of the invention as described more fully in the claims which follow thereafter.

Experimental Details

1. The Sequencing by Synthesis Approach

Sequencing DNA by synthesis involves the detection of the identity of each nucleotide as it is incorporated into the growing strand of DNA in the polymerase reaction. The fundamental requirements for such a system to work are: (1) the availability of 4 nucleotide analogues (aA, aC, aG, aT) each labeled with a unique label and containing a chemical moiety capping the 3′-OH group; (2) the 4 nucleotide analogues (aA, aC, aG, aT) need to be efficiently and faithfully incorporated by DNA polymerase as terminators in the polymerase reaction; (3) the tag and the group capping the 3′-OH need to be removed with high yield to allow the incorporation and detection of the next nucleotide; and (4) the growing strand of DNA should survive the washing, detection and cleavage processes to remain annealed to the DNA template.

The sequencing by synthesis approach disclosed herein is illustrated in FIG. 2A-2B. In FIG. 2A, an example is shown where the unique labels are fluorescent dyes and the surface is a chip; in FIG. 2B, the unique labels are mass tags and the surface is channels etched into a chip. The synthesis approach uses a solid surface such as a glass chip with an immobilized DNA template that is able to self prime for initiating the polymerase reaction, and four nucleotide analogues (3′-RO-A-LABEL1, 3′-RO-C-LABEL2, 3′-RO-G-LABEL3, 3′-RO-T-LABEL4) each labeled with a unique label, e.g. a fluorescent dye or a mass tag, at a specific location on the purine or pyrimidine base, and a small cleavable chemical group (R) to cap the 3′-OH group. Upon adding the tour nucleotide analogues and DNA polymerase, only one nucleotide analogue that is complementary to the next nucleotide on the template is incorporated by the polymerase on each spot of the surface (step 1 in FIGS. 2A and 2B).

As shown in FIG. 2A, where the unique labels are dyes, after removing the excess reagents and washing away any unincorporated nucleotide analogues on the chip, a detector is used to detect the unique label. For example, a four color fluorescence imager is used to image the surface of the chip, and the unique fluorescence emission from a specific dye on the nucleotide analogues on each spot of the chip will reveal the identity of the incorporated nucleotide (step 2 in FIG. 2A). After imaging, the small amount of unreacted 3′-OH group on the self-primed template moiety is capped by excess dideoxynucleoside triphosphates (ddNTPs) (ddATP, ddGTP, ddTTP, and ddCTP) and DNA polymerase to avoid interference with the next round of synthesis (step 3 in FIG. 2A), a concept similar to the capping step in automated solid phase DNA synthesis (Caruthers, 1985). The ddNTPs, which lack a 3′-hydroxyl group, are chosen to cap the unreacted 3′-OH of the nucleotide due to their small size compared with the dye-labeled nucleotides, and the excellent efficiency with which they are incorporated by DNA polymerase. The dye moiety is then cleaved by light (˜350 nm), and the R group protecting the 3′-OH is removed chemically to generate free 3′-OH group with high yield (step 4 in FIG. 2A). A washing step is applied to wash away the cleaved dyes and the R group. The self-primed DNA moiety on the chip at this stage is ready for the next cycle of the reaction to identify the next nucleotide sequence of the template DNA (step 5 in FIG. 2A).

It is a routine procedure now to immobilize high density (>10,000 spots per chip) single stranded DNA on a 4 cm×1 cm glass chip (Schena et al. 1995). Thus, in the DNA sequencing system disclosed herein, more than 10,000 bases can be identified after each cycle and after 100 cycles, a million base pairs will be generated from one sequencing chip.

Possible DNA polymerases include Thermo Sequenase, Tag FS DNA polymerase, T7 DNA polymerase, and Vent (exo-) DNA polymerase. The fluorescence emission from each specific dye can be detected using a fluorimeter that is equipped with an accessory to detect fluorescence from a glass slide. For large scale evaluation, a multi-color scanning system capable of detecting multiple different fluorescent dyes (500 nm-700 nm) (GSI Lumonics ScanArray 5000 Standard Biochip Scanning System) on a glass slide can be used.

An example of the sequencing by synthesis approach using mass tags is shown in FIG. 2B. The approach uses a solid surface, such as a porous silica glass channels in a chip, with immobilized DNA template that is able to self prime for initiating the polymerase reaction, and four nucleotide analogues (3′-RO-A-Tag1, 3′-RO-C-Tag2, 3′-RO-G-Tag3, 3′-RO-T-Tag4) each labeled with a unique photocleavable mass tag on the specific location of the base, and a small cleavable chemical group (R) to cap the 3′-OH group. Upon adding the four nucleotide analogues and DNA polymerase, only one nucleotide analogue that is complementary to the next nucleotide on the template is Incorporated by polymerase in each channel of the glass chip (step 1 in FIG. 2B). After removing the excess reagents and washing away any unincorporated nucleotide analogues on the chip, the small amount of unreacted 3′-OH group on the self-primed template moiety is capped by excess ddNTPs (ddATP, ddGTP, ddTTP and ddCTP) and DNA polymerase to avoid interference with the next round of synthesis (step 2 in FIG. 2B). The ddNTPs are chosen to cap the unreacted 3′-OH of the nucleotide due to their small size compared with the labeled nucleotides, and their excellent efficiency to be incorporated by DNA polymerase. The mass tags are cleaved by irradiation with light (˜350 nm) (step 3 in FIG. 2B) and then detected with a mass spectrometer. The unique mass of each tag yields the identity of the nucleotide in each channel (step 4 in FIG. 2B). The R protecting group is then removed chemically and washed away to generate free 3′-OH group with high yield (step 5 in FIG. 2B). The self-primed DNA moiety on the chip at this stage is ready for the next cycle of the reaction to identify the next nucleotide sequence of the template DNA (step 6 in FIG. 2B).

Since the development of new ionization techniques such as matrix assisted laser desorption ionization (MALDI) and electrospray ionization (ESI), mass spectrometry has become an indispensable tool in many areas of biomedical research. Though these ionization methods are suitable for the analysis of bioorganic molecules, such as peptides and proteins, improvements in both detection and sample preparation are required for implementation of mass spectrometry for DNA sequencing applications. Since the approach disclosed herein uses small and stable mass tags, there is no need to detect large DNA sequencing fragments directly and it is not necessary to use MALDI or ESI methods for detection. Atmospheric pressure chemical ionization (APCI) is an ionization method that uses a gas-phase ion-molecular reaction at atmospheric pressure (Dizidic et al. 1975). In this method, samples are introduced by either chromatography or flow injection into a pneumatic nebulizer where they are converted into small droplets by a high-speed beam of nitrogen gas. When the heated gas and solution arrive at the reaction area, the excess amount of solvent is ionized by corona discharge. This ionized mobile phase acts as the ionizing agent toward the samples and yields pseudo molecular (M+H)+ and (M−H) ions. Due to the corona discharge ionization method, high ionization efficiency is attainable, maintaining stable ionization conditions with detection sensitivity lower than femtomole region for small and stable organic compounds. However, due to the limited detection of large molecules, ESI and MALDI have replaced APCI for analysis of peptides and nucleic acids. Since in the approach disclosed the mass tags to be detected are relatively small and very stable organic molecules, the ability to detect large biological molecules gained by using ESI and MALDI is not necessary. APCI has several advantages over ESI and MALDI because it does not require any tedious sample preparation such as desalting or mixing with matrix to prepare crystals on a target plate. In ESI, the sample nature and sample preparation conditions (i.e. the existence of buffer or inorganic salts) suppress the ionization efficiency. MALDI requires the addition of matrix prior to sample introduction into the mass spectrometer and its speed is often limited by the need to search for an ideal irradiation spot to obtain interpretable mass spectra. These limitations are overcome by APCI because the mass tag solution can be injected directly with no additional sample purification or preparation into the mass spectrometer. Since the mass tagged samples are volatile and have small mass numbers, these compounds are easily detectable by APCI ionization with high sensitivity. This system can be scaled up into a high throughput operation.

Each component of the sequencing by synthesis system is described in more detail below.

2. Construction of a Surface Containing Immobilized Self-Primed DNA Moiety

The single stranded DNA template immobilized on a surface is prepared according to the scheme shown in FIG. 3. The surface can be, for example, a glass chip, such as a 4 cm×1 cm glass chip, or channels in a glass chip. The surface is first treated with 0.5 M NaOH, washed with water, and then coated with high density 3-aminopropyltrimethoxysilane in aqueous ethanol (Woolley et al. 1994) forming a primary amine surface. N-Hydroxy Succinimidyl (NHS) ester of triarylphosphine (1) is covalently coupled with the primary amine group converting the amine surface to a novel triarylphosphine surface, which specifically reacts with DNA containing an azido group (2) forming a chip with immobilized DNA. Since the azido group is only located at the 5′ end of the DNA and the coupling reaction is through the unique reaction of the triarylphosphine moiety with the azido group in aqueous solution (Saxon and Bertozzi 2000), such a DNA surface will provide an optimal condition for hybridization.

The NHS ester of triarylphosphine (1) is prepared according to the scheme shown in FIG. 4. 3-diphenylphosphino-4-methoxycarbonyl-benzoic acid (3) is prepared according to the procedure described by Bertozzi at al. (Saxon and Bertozzi 2000). Treatment of (3) with N-Hydroxysuccinimide forms the corresponding NHS ester (4). Coupling of (4) with an amino carboxylic acid moiety produces compound (5) that has a long linker (n=1 to 10) for optimized coupling with DNA on the surface. Treatment of (5) with N-Hydroxysuccinimide generates the NHS ester (1) which is ready for coupling with the primary amine coated surface (FIG. 3).

The azido labeled DNA (2) is synthesized according to the scheme shown in FIG. 5. Treatment of ethyl ester of 5-bromovaleric acid with sodium azide and then hydrolysis produces 5-azidovaleric acid (Khoukhi at al., 1987), which is subsequently converted to a NHS ester for coupling with an amino linker modified oligonucleotide primer. Using the azido-labeled primer to perform polymerase chain reaction (PCR) reaction generates azido-labeled DNA template (2) for coupling with the triarylphosphine-modified surface (FIG. 3).

The self-primed DNA template moiety on the sequencing chip is constructed as shown in FIGS. 6 (A & B) using enzymatic ligation. A 5′-phosphorylated, 3′-OH capped loop oligonucleotide primer (B) is synthesized by a solid phase DNA synthesizer. Primer (B) is synthesized using a modified C phosphoramidite whose 3′-OH is capped with either a MOM (—CH2OCH) group or an allyl (—CH2CH═CH2) group (designated by “R” in FIG. 6) at the 3′-end of the oligonucleotide to prevent the self ligation of the primer in the ligation reaction. Thus, the looped primer can only ligate to the 3′-end of the DNA templates that are immobilized on the sequencing chip using T4 RNA ligase (Zhang et al. 1996) to form the self-primed DNA template moiety (A). The looped primer (B) is designed to contain a very stable loop (Antao et al. 1991) and a stem containing the sequence of M13 reverse DNA sequencing primer for efficient priming in the polymerase reaction once the primer is ligated to the immobilized DNA on the sequencing chip and the 3′-OH cap group is chemically cleaved off (Ireland at al. 1986; Kamal et al. 1999).

3. Sequencing by Synthesis Evaluation Using Nucleotide Analogues 3′-HO-A-Dye1, 3′-HO-C-Dye2, 3′-HO-G-Dye3, 3′-HO-T-Dye4

A scheme has been developed for evaluating the photocleavage efficiency using different dyes and testing the sequencing by synthesis approach. Four nucleotide analogues 3′-HO-A-Dye1, 3′-HO-C-Dye2, 3′-HO-C-Dye2, 3′-HO-G-Dye3, 3′-HO-T-Dye4 each labeled with a unique fluorescent dye through a photocleavable linker are synthesized and used in the sequencing by synthesis approach. Examples of dyes include, but are not limited to: Dye1=FAM, 5-carboxyfluorescein; Dye2=R6G, 6-carboxyrhodamine-6G; Dye3=TAM, N,N,N′,N′-tetramethyl-6-carboxyrhodamine; and Dye4=ROX, 6-carboxy-X-rhodamine. The structures of the 4 nucleotide analogues are shown in FIG. 7 (R═H).

The photocleavable 2-nitrobenzyl moiety has been used to link biotin to DNA and protein for efficient removal by UV light (˜350 nm) (Olejnik et al. 1995, 1999). In the approach disclosed herein the 2-nitrobenzyl group is used to bridge the fluorescent dye and nucleotide together to form the dye labeled nucleotides as shown in FIG. 7.

As a representative example, the synthesis of 3′-HO-G-Dye3 (Dye3=Tam) is shown in FIG. 8. 7-deaza-alkynylamino-dGTP is prepared using well-established procedures (Prober at al. 1987; Lee at al. 1992 and Hobbs et al. 1991). Linker-Tam is synthesized by coupling the Photocleavable Linker (Rollaf 1982) with NHS-Tam. 7-deaza-alkynylamino-dGTP is then coupled with the Linker-Tam to produce 3′-HO-G-Tam. The nucleotide analogues with a free 3′-OH (i.e., R═H) are good substrates for the polymerase. An immobilized DNA template is synthesized (FIG. 9) that contains a portion of nucleotide sequence ACGTACGACGT (SEQ ID NO: 1) that has no repeated sequences after the priming site. 3′-HO-A-Dye1 and DNA polymerase are added to the self-primed DNA moiety and it is incorporated to the 3′ site of the DNA. Then the steps in FIG. 2A are followed (the chemical cleavage step is not required here because the 3′-OH is free) to detect the fluorescent signal from Dye-1 at 520 nm. Next, 3′-HO-C-Dye2 is added to image the fluorescent signal from Dye-2 at 550 nm. Next, 3′-HO-G-Dye3 is added to image the fluorescent signal from Dye-3 at 580 nm, and finally 3′-HO-T-Dye4 is added to image the fluorescent signal from Dye-4 at 610 nm.

Results on Photochemical Cleavage Efficiency

The expected photolysis products of DNA containing a photocleavable fluorescent dye at the 3′ end of the DNA are shown in FIG. 10. The 2-nitrobenzyl moiety has been successfully employed in a wide range of studies as a photocleavable-protecting group (Pillai 1980). The efficiency of the photocleavage step depends on several factors including the efficiency of light absorption by the 2-nitrobenzyl moiety, the efficiency of the primary photochemical step, and the efficiency of the secondary thermal processes which lead to the final cleavage process (Turro 1991). Burgess at al. (1997) have reported the successful photocleavage of a fluorescent dye attached through a 2-nitrobenzyl linker on a nucleotide moiety, which shows that the fluorescent dye is not quenching the photocleavage process. A photoliable protecting group based on the 2-nitrobenzyl chromophore has also been developed for biological labeling applications that involve photocleavage (Olejnik et al. 1999). The protocol disclosed herein is used to optimize the photocleavage process shown in FIG. 10. The absorption spectra of 2-nitro benzyl compounds are examined and compared quantitatively to the absorption spectra of the fluorescent dyes. Since there will be a one-to-one relationship between the number of 2-nitrobenzyl moieties and the dye molecules, the ratio of extinction coefficients of these two species will reflect the competition for light absorption at specific wavelengths. From this information, the wavelengths at which the 2-nitrobenzyl moieties absorbed most competitively can be determined, similar to the approach reported by Olejnik et al. (1995).

A photolysis setup can be used which allows a high throughput of monochromatic light from a 1000 watt high pressure xenon lamp (LX1000UV, ILC) in conjunction with a monochromator (Kratos, Schoeffel Instruments). This instrument allows the evaluation of the photocleavage of model systems as a function of the intensity and excitation wavelength of the absorbed light. Standard analytical analysis is used to determine the extent of photocleavage. From this information, the efficiency of the photocleavage as a function of wavelength can be determined. The wavelength at which photocleavage occurs most efficiently can be selected as for use in the sequencing system.

Photocleavage results have been obtained using a model system as shown in FIG. 11. Coupling of PC-LC-Biotin-NHS ester (Pierce, Rockford Ill.) with 5-(aminoacetamido)-fluorescein (5-aminoFAM) (Molecular Probes, Eugene Oreg.) in dimethylsulfonyl oxide (DMSO)/NaHCO3 (pH=8.2) overnight at room temperature produces PC-LC-Biotin-FAM which is composed of a biotin at one end, a photocleavable 2-nitrobenzyl group in the middle, and a dye tag (FAM) at the other end. This photocleavable moiety closely mimics the designed photocleavable nucleotide analogues shown in FIG. 10. Thus the successful photolysis of the PC-LC-Biotin-FAM moiety provides proof of the principle of high efficiency photolysis as used in the DNA sequencing system. For photolysis study, PC-LC-Biotin-FAM is first immobilized on a microscope glass slide coated with streptavidin (XENOPORE, Hawthorne N.J.). After washing off the non-immobilized PC-LC-Biotin-FAM, the fluorescence emission spectrum of the immobilized PC-LC-Biotin-FAM was taken as shown in FIG. 12 (Spectrum a). The strong fluorescence emission indicates that PC-LC-Biotin-FAM is successfully immobilized to the streptavidin coated slide surface. The photocleavability of the 2-nitrobenzyl linker by irradiation at 350 nm was then tested. After 10 minutes of photolysis (λirr=350 nm; ˜0.5 mW/cm2) and before any washing, the fluorescence emission spectrum of the same spot on the slide was taken that showed no decrease in intensity (FIG. 12, Spectrum b), indicating that the dye (FAM) was not bleached during the photolysis process at 350 nm. After washing the glass slide with HPLC water following photolysis, the fluorescence emission spectrum of the same spot on the slide showed significant intensity decrease (FIG. 12, Spectrum c) which indicates that most of the fluorescence dye (FAM) was cleaved from the immobilized biotin moiety and was removed by the washing procedure. This experiment shows that high efficiency cleavage of the fluorescent dye can be obtained using the 2-nitrobenzyl photocleavable linker.

4. Sequencing by Synthesis Evaluation Using Nucleotide Analogues 3′-RO-A-Dye1, 3′-RO-C-Dye2, 3′-RO-G-Dye3, 3′-RO-T-Dye4

Once the steps and conditions in Section 3 are optimized, the synthesis of nucleotide analogues 3′-RO-A-Dye1, 3′-RO-C-Dye2, 3′RO-G-Dye3, 3′-RO-T-Dye4 can be pursued for further study of the system. Here the 3′-OH is capped in all four nucleotide analogues, which then can be mixed together with DNA polymerase and used to evaluate the sequencing system using the scheme in FIG. 9. The is MOM (—CH2OCH3) or allyl (—CH2CH═CH2) group is used to cap the 3′-OH group using well-established synthetic procedures (FIG. 13) (Fuji et al. 1975, Metzker at al. 1994). These groups can be removed chemically with high yield as shown in FIG. 14 (Ireland, et al. 1986; Kamal et al. 1999). The chemical cleavage of the MOM and allyl groups is fairly mild and specific, so as not to degrade the DNA template moiety. For example, the cleavage of the allyl group takes 3 minutes with more than 93% yield (Kamal et al. 1999), while the MOM group is reported to be cleaved with close to 100% yield (Ireland, at al. 1986).

5. Using Energy Transfer Coupled Dyes to Optimize the Sequencing by Synthesis System

The spectral property of the fluorescent tags can be optimized by using energy transfer (ET) coupled dyes. The ET primer and ET dideoxynucleotides have been shown to be a superior set, of reagents for 4-color DNA sequencing that allows the use of one laser to excite multiple sets of fluorescent tags (Ju et al. 1995). It has been shown that DNA polymerase (Thermo Sequenase and Taq FS) can efficiently incorporate the ET dye labeled dideoxynucleotides (Rosenblum et al. 1997). These ET dye-labeled sequencing reagents are now widely used in large scale DNA sequencing projects, such as the human genome project. A library of ET dye labeled nucleotide analogues can be synthesized as shown in FIG. 15 for optimization of the DNA sequencing system. The ET dye set (FAM-Cl2FAM, FAM-Cl2R6G, FAM-Cl2TAM, FAM-Cl2ROX) using FAM as a donor and dichloro(FAM, R6G, TAM, ROX) as acceptors has been reported in the literature (Lee et al. 1997) and constitutes a set of commercially available DNA sequencing reagents. These ET dye sets have been proven to produce enhanced fluorescence intensity, and the nucleotides labeled with these ET dyes at the 5-position of T and C and the 7-position of G and A are excellent substrates of DNA polymerase. Alternatively, an ET dye set can be constructed using cyanine (Cy2) as a donor and Cl2FAM, Cl2R6G, Cl2TAM, or Cl2ROX as energy acceptors. Since Cy2 possesses higher molar absorbance compared with the rhodamine and fluorescein derivatives, an ET system using Cy2 as a donor produces much stronger fluorescence signals than the system using FAM as a donor (Hung et al. 1996). FIG. 16 shows a synthetic scheme for an ET dye labeled nucleotide analogue with Cy2 as a donor and Cl2FAM as an acceptor using similar coupling chemistry as for the synthesis of an energy transfer system using FAM as a donor (Lee et al. 1997). Coupling of Cl2FAM (I) with spacer 4-aminomethylbenzoic acid (II) produces III, which is then converted to NHS ester IV. Coupling of IV with amino-Cy2, and then converting the resulting compound to a NHS ester produces V, which subsequently couples with amino-photolinker nucleotide VI yields the ET dye labeled nucleotide VII.

6. Sequencing by Synthesis Evaluation Using Nucleotide Analogues 3′-HO-A-Tag1, 3′-HO-C-Tag2, 3′-HO-G-Tag3, 3′-HO-T-Tag4

The precursors of four examples of mass tags are shown in FIG. 17. The precursors are: (a) acetophenone; (b) 3-fluoroacetophenone; (c) 3,4-difluoroacetophenone; and (d) 3,4-dimethoxyacetophenone. Upon nitration and reduction, four photoactive tags are produced from the four precursors and used to code for the identity of each of the four nucleotides (A, C, G, T). Clean APCI mass spectra are obtained for the four mass tag precursors (a, b, c, d) as shown in FIG. 18. The peak with m/z of 121 is a, 139 is b, 157 is c, and 181 is d. This result shows that these four mass tags are extremely stable and produce very high resolution data in an APCI mass spectrometer with no cross talk between the mass tags. In the examples shown below, each of the unique m/z from each mass tag translates to the identity of the nucleotide [Tag-1 (m/z, 150)=A; Tag-2 (m/z, 168)=C; Tag-3 (m/z, 186)=G; Tag-4 (m/z, 210)=T].

Different combinations of mass tags and nucleotides can be used, as indicated by the general scheme: 3′-HO-A-Tag1, 3′-HO-C-Tag2, 3′-HO-G-Tag3, 3′-HO-T-Tag4 where Tag1, Tag2, Tag3, and Tag4 are four different unique cleavable mass tags. Four specific examples of nucleotide analogues are shown in FIG. 19. In FIG. 19, “R” is H when the 3′-OH group is not capped. As discussed above, the photo cleavable 2-nitro benzyl moiety has been used to link biotin to DNA and protein for efficient removal by UV light (˜350 nm) irradiation (Olejnik at al. 1995, 1999). Four different 2-nitro benzyl groups with different molecular weights as mass tags are used to form the mass tag labeled nucleotides as shown in FIG. 19: 2-nitro-α-methyl-benzyl (Tag-1) codes for A; 2-nitro-α-methyl-3-fluorobenzyl (Tag-2) codes for C; 2-nitro-α-methyl-3,4-difluorobenzyl (Tag-3) codes for G; 2-nitro-α-methyl-3,4-dimethoxybenzyl (Tag-4) codes for T.

As a representative example, the synthesis of the NHS ester of one mass tag (Tag-3) is shown in FIG. 20. A similar scheme is used to create the other mass tags. The synthesis of 3′-HO-G-Tag3 is shown in FIG. 21 using well-established procedures (Prober et al. 1987; Lee et al. 1992 and Hobbs et al. 1991). 7-propargylamino-dGTP is first prepared by reacting 7-I-dGTP with N-trifluoroacetylpropargyl amine, which is then coupled with the NHS-Tag-3 to produce 3′-HO-G-Tag3. The nucleotide analogues with a free 3′-OH are good substrates for the polymerase.

The sequencing by synthesis approach can be tested using mass tags using a scheme similar to that show for dyes in FIG. 9. A DNA template containing a portion of nucleotide sequence that has no repeated sequences after the priming site, is synthesized and immobilized to a glass channel. 3′-HO-A-Tag1 and DNA polymerase are added to the self-primed DNA moiety to allow the incorporation of the nucleotide into the 3 site of the DNA. Then the steps in FIG. 2B are followed (the chemical cleavage is not required here because the 3′-OH is free) to detect the mass tag from Tag-1 (m/z=150). Next, 3′-HO-C-Tag2 is added and the resulting mass spectra is measured after cleaving Tag-2 (m/z=168). Next, 3′-HO-G-Tag3 and 3′-HO-T-Tag4 are added in turn and the mass spectra of the cleavage products Tag-3 (m/z=186) and Tag-4 (m/z=210) are measured. Examples of expected photocleavage products are shown in FIG. 22. The photocleavage mechanism is as described above for the case where the unique labels are dyes. Light absorption (300-360 nm) by the aromatic 2-nitro benzyl moiety causes reduction of the 2-nitro group to a nitroso group and an oxygen insertion into the carbon-hydrogen bond located in the 2-position followed by cleavage and decarboxylation (Pillai 1980).

The synthesis of nucleotide analogues 3′-RO-A-Tag1, 3′-RO-C-Tag2, 3′-RO-G-Tag3, 3′-RO-T-Tag4 can be pursued for further study of the system a discussed above for the case where the unique labels are dyes. Here the 3′-OH is capped in all four nucleotide analogues, which then can be mixed together with DNA polymerase and used to evaluate the sequencing system using a scheme similar to that in FIG. 9. The MOM (—CH2OCH3) or allyl (—CH2CH═CH2) group is used to cap the 3′-OH group using well-established synthetic procedures (FIG. 13) (Fuji at al. 1975, Metzker et al. 1994). These groups can be removed chemically with high yield as shown in FIG. 14 (Ireland, et al. 1986; Kamal at al. 1999). The chemical cleavage of the MOM and allyl groups is fairly mild and specific, so as not to degrade the DNA template moiety.

7. Parallel Channel System for Sequencing by Synthesis

FIG. 23 illustrates an example of a parallel channel system. The system can be used with mass tag labels as shown and also with dye labels. A plurality of channels in a silica glass chip are connected on each end of the channel to a well in a well plate. In the example shown there are 96 channels each connected to its own wells. The sequencing system also permits a number of channels other than 96 to be used. 96 channel devices for separating DNA sequencing and sizing fragments have been reported (Woolley and Mathies 1994, Woolley at al. 1997, Simpson at al. 1998). The chip is made by photolithographic masking and chemical etching techniques. The photolithographically defined channel patterns are etched in a silica glass substrate, and then capillary channels (id˜100 μm) are formed by thermally bonding the etched substrate to a second silica glass slide. Channels are porous to increase surface area. The immobilized single stranded DNA template chip is prepared according to the scheme shown in FIG. 3. Each channel is first treated with 0.5 M NaOH, washed with water, and is then coated with high density 3-aminopropyltrimethoxysilane in aqueous ethanol (Woolley et al. 1994) forming a primary amine surface. Succinimidyl (NHS) ester of triarylphosphine (1) is covalently coupled with the primary amine group converting the amine surface to a novel triarylphosphine surface, which specifically reacts with DNA containing an azido group (2) forming a chip with immobilized DNA. Since the azido group is only located at the 5′ end of the DNA and the coupling reaction is through the unique reaction of triarylphosphine moiety with azido group in aqueous solution (Saxon and Bertozzi 2000), such a DNA surface provides an optimized condition for hybridization. Fluids, such as sequencing reagents and washing solutions, can be easily pressure driven between the two 96 well plates to wash and add reagents to each channel in the chip for carrying out the polymerase reaction as well as collecting the photocleaved labels. The silica chip is transparent to ultraviolet light (λ ˜350 nm). In the Figure, photocleaved mass tags are detected by an APCI mass spectrometer upon irradiation with a UV light source.

8. Parallel Mass Tag Sequencing by Synthesis System

The approach disclosed herein comprises detecting four unique photoreleased mass tags, which can have molecular weights from 150 to 250 daltons, to decode the DNA sequence, thereby obviating the issue of detecting large DNA fragments using a mass spectrometer as well as the stringent sample requirement for using mass spectrometry to directly detect long DNA fragments. It takes 10 seconds or less to analyze each mass tag using the APCI mass spectrometer. With 8 miniaturized APCI mass spectrometers in a system, close to 100,000 bp of high quality digital DNA sequencing data could be generated each day by each instrument using this approach. Since there is no separation and purification requirements using this approach, such a system is cost effective.

To make mass spectrometry competitive with a 96 capillary array method for analyzing DNA, a parallel mass spectrometer approach is needed. Such a complete system has not been reported mainly due to the fact that most of the mass spectrometers are designed to achieve adequate resolution for large biomolecules. The system disclosed herein requires the detection of four mass tags, with molecular weight range between 150 and 250 daltons, coding for the identity of the four nucleotides (A, C, G, T). Since a mass spectrometer dedicated to detection of these mass tags only requires high resolution for the mass range of 150 to 250 daltons instead of covering a wide mass range, the mass spectrometer can be miniaturized and have a simple design. Either quadrupole (including ion trap detector) or time-of-flight mass spectrometers can be selected for the ion optics. While modern mass spectrometer technology has made it possible to produce miniaturized mass spectrometers, most current research has focused on the design of a single stand-alone miniaturized mass spectrometer. Individual components of the mass spectrometer has been miniaturized for enhancing the mass spectrometer analysis capability (Liu at al. 2000, Zhang et al. 1999). A miniaturized mass spectrometry system using multiple analyzers (up to 10) in parallel has been reported (Badman and Cooks 2000). However, the mass spectrometer of Badman and Cook was designed to measure only single samples rather than multiple samples in parallel. They also noted that the miniaturization of the ion trap limited the capability of the mass spectrometer to scan wide mass ranges. Since the approach disclosed herein focuses on detecting four small stable mass tags (the mass range is less than 300 daltons), multiple miniaturized APCI mass spectrometers are easily constructed and assembled into a single unit for parallel analysis of the mass tags for DNA sequencing analysis.

A complete parallel mass spectrometry system includes multiple APCI sources interfaced with multiple analyzers, coupled with appropriate electronics and power supply configuration. A mass spectrometry system with parallel detection capability will overcome the throughput bottleneck issue for application in DNA analysis. A parallel system containing multiple mass spectrometers in a single device is illustrated in FIGS. 23 and 24. The examples in the figures show a system with three mass spectrometers in parallel. Higher throughput is obtained using a greater number of in parallel mass spectrometers.

As illustrated in FIG. 24, the three miniature mass spectrometers are contained in one device with two turbo-pumps. Samples are injected into the ion source where they are mixed with a nebulizer gas and ionized. One turbo pump is used as a differential pumping system to continuously sweep away free radicals, neutral compounds and other undesirable elements coming from the ion source at the orifice between the ion source and the analyzer. The second turbo pump is used to generate a continuous vacuum in all three analyzers and detectors simultaneously. Since the corona discharge mode and scanning mode of mass spectrometers are the same for each miniaturized mass spectrometer, one power supply for each analyzer and the ionization source can provide the necessary power for all three instruments. One power supply for each of the three independent detectors is used for spectrum collection. The data obtained are transferred to three independent A/D converters and processed by the data system simultaneously to identify the mass tag in the injected sample and thus identify the nucleotide. Despite containing three mass spectrometers, the entire device is able to fit on a laboratory bench top.

9. Validate the Complete Sequencing by Synthesis System by Sequencing P53 Genes

The tumor suppressor gene p53 can be used as a model system to validate the DNA sequencing system. The p53 gene is one of the most frequently mutated genes in human cancer (O'Connor et al. 1997). First, a base pair DNA template (shown below) is synthesized containing an azido group at the 5′ end and a portion of the sequences from exon 7 and exon 8 of the p53 gene:

(SEQ ID NO: 2)
5′-N3-TTCCTGCATGGGCGGCATGAACCCGAGGCCCATCCTCACCAT
CATCACACTGGAAGACTCCAGTGGTAATCTACTGGGACGGAACAGCTT
TGAGGTGCATT-3′.

This template is chosen to explore the use of the sequencing system for the detection of clustered hot spot single base mutations. The potentially mutated bases are underlined (A, G, C and T) in the synthetic template. The synthetic template is immobilized on a sequencing chip or glass channels, then the loop primer is ligated to the immobilized template as described in FIG. 6, and then the steps in FIG. 2 are followed for sequencing evaluation. DNA templates generated by PCR can be used to further validate the DNA sequencing system. The sequencing templates can be generated by PCR using flanking primers (one of the pair is labeled with an azido group at the 5′ end) in the intron region located at each p53 exon boundary from a pool of genomic DNA (Boehringer, Indianapolis, Ind.) as described by Fu et al. (1998) and then immobilized on the DNA chip for sequencing evaluation.

Hyman E D, (1988) A new method of sequencing DNA. Analytical Biochemistry 174: 423-436.

Ju, Jingyue, Li, Zengmin, Edwards, John Robert, Itagaki, Yasuhiro

Patent Priority Assignee Title
10240195, Mar 24 2014 GENIA TECHNOLOGIES, INC Chemical methods for producing tagged nucleotides
10246479, Apr 09 2012 THE UNITED STATES OF AMERICA, AS REPRESENTED BY THE SECRETARY OF COMMERCE Method of preparation of nanopore and uses thereof
10260094, Oct 19 2007 The Trustees of Columbia University in the City of New York DNA sequencing with non-fluorescent nucleotide reversible terminators and cleavable label modified nucleotide terminators
10407458, Oct 06 2000 The Trustees of Columbia University in the City of New York Massive parallel method for decoding DNA and RNA
10407459, Oct 06 2000 The Trustees of Columbia University in the City of New York Massive parallel method for decoding DNA and RNA
10428380, Oct 06 2000 The Trustees of Columbia University in the City of New York Massive parallel method for decoding DNA and RNA
10435742, Oct 06 2000 The Trustees of Columbia University in the City of New York Massive parallel method for decoding DNA and RNA
10443096, Dec 17 2010 The Trustees of Columbia University in the City of New York DNA sequencing by synthesis using modified nucleotides and nanopore detection
10457984, Oct 06 2000 The Trustees of Columbia University in the City of New York Massive parallel method for decoding DNA and RNA
10570446, Oct 06 2000 THE TRUSTEE OF COLUMBIA UNIVERSITY IN THE CITY OF NEW YORK Massive parallel method for decoding DNA and RNA
10577652, Oct 06 2000 The Trustees of Columbia University in the City of New York Massive parallel method for decoding DNA and RNA
10633700, Oct 06 2000 The Trustees of Columbia University in the City of New York Massive parallel method for decoding DNA and RNA
10648026, Mar 15 2013 The Trustees of Columbia University in the City of New York Raman cluster tagged molecules for biological imaging
10648028, Oct 06 2000 The Trustees of Columbia University in the City of New York Massive parallel method for decoding DNA and RNA
10662472, Oct 06 2000 The Trustees of Columbia University in the City of New York Massive parallel method for decoding DNA and RNA
10669582, Oct 06 2000 The Trustees of Columbia University in the City of New York Massive parallel method for decoding DNA and RNA
10689412, May 23 2011 The Trustees of Columbia University in the City of New York DNA sequencing by synthesis using Raman and infrared spectroscopy detection
10732183, Mar 15 2013 The Trustees of Columbia University in the City of New York Method for detecting multiple predetermined compounds in a sample
10738072, Oct 25 2018 Singular Genomics Systems, Inc. Nucleotide analogues
10822653, Jan 08 2019 Singular Genomics Systems, Inc. Nucleotide cleavable linkers and uses thereof
10907194, Oct 31 2005 The Trustees of Columbia University in the City of New York Synthesis of four-color 3′-O-allyl modified photocleavable fluorescent nucleotides and related methods
11085076, Sep 28 2015 The Trustees of Columbia University in the City of New York Synthesis of novel disulfide linker based nucleotides as reversible terminators for DNA sequencing by synthesis
11111487, Oct 28 2015 SILICON VALLEY SCIENTIFIC, INC Method and apparatus for encoding cellular spatial position information
11242561, Oct 19 2007 The Trustees of Columbia University in the City of New York DNA sequencing with non-fluorescent nucleotide reversible terminators and cleavable label modified nucleotide terminators
11266673, May 23 2016 The Trustees of Columbia University in the City of New York Nucleotide derivatives and methods of use thereof
11396677, Mar 24 2014 The Trustees of Columbia University in the City of New York; ROCHE SEQUENCING SOLUTIONS, INC. Chemical methods for producing tagged nucleotides
11499186, Dec 17 2010 The Trustees of Columbia University in the City of New York DNA sequencing by synthesis using modified nucleotides and nanopore detection
11591647, Mar 06 2017 Singular Genomics Systems, Inc.; SINGULAR GENOMICS SYSTEMS, INC Nucleic acid sequencing-by-synthesis (SBS) methods that combine SBS cycle steps
11608523, Jun 20 2012 ROCHE SEQUENCING SOLUTIONS INC Nucleic acid sequencing by nanopore detection of tag molecules
11667907, Oct 28 2015 SILICON VALLEY SCIENTIFIC, INC. Method and apparatus for encoding cellular spatial position information
11773439, Mar 06 2017 Singular Genomics Systems, Inc. Nucleic acid sequencing-by-synthesis (SBS) methods that combine SBS cycle steps
11795191, Apr 09 2012 The Trustees of Columbia University in the City of New York; Government of the United States, As Represented by the Secretary of Commerce Method of preparation of nanopore and uses thereof
11878993, Oct 25 2018 Singular Genomics Systems, Inc. Nucleotide analogues
9624539, May 23 2011 The Trustees of Columbia University in the City of New York DNA sequencing by synthesis using Raman and infrared spectroscopy detection
9708358, Oct 06 2000 The Trustees of Columbia University in the City of New York Massive parallel method for decoding DNA and RNA
9718852, Oct 06 2000 The Trustees of Columbia University in the City of New York Massive parallel method for decoding DNA and RNA
9719139, Oct 06 2000 The Trustees of Columbia University in the City of New York Massive parallel method for decoding DNA and RNA
9725480, Oct 06 2000 The Trustees of Columbia University in the City of New York Massive parallel method for decoding DNA and RNA
9856285, Mar 17 2015 KAOHSIUNG MEDICAL UNIVERSITY Reagents for universal site-specific labeling and modifications of nucleic acids
9868985, Oct 06 2000 The Trustees of Columbia University in the City of New York Massive parallel method for decoding DNA and RNA
9890426, Mar 09 2015 The Trustees of Columbia University in the City of New York Pore-forming protein conjugate compositions and methods
9909177, Jun 21 2005 The Trustees of Columbia University in the City of New York Pyrosequencing methods and related compositions
Patent Priority Assignee Title
4711955, Apr 17 1981 Yale University Modified nucleotides and methods of preparing and using same
4772691, Jun 05 1985 The Medical College of Wisconsin, Inc. Chemically cleavable nucleotides
4804748, Aug 16 1985 Boehringer Mannheim GmbH 7-deaza-2'-deoxyguanosine nucleotides
4824775, Jan 03 1985 MILES INC A CORP OF INDIANA Cells labeled with multiple Fluorophores bound to a nucleic acid carrier
4863849, Jul 18 1985 Biotage AB Automatable process for sequencing nucleotide
4888274, Sep 18 1985 Yale University RecA nucleoprotein filament and methods
5043272, Apr 27 1989 Life Technologies, Incorporated Amplification of nucleic acid sequences using oligonucleotides of random sequence as primers
5047519, Jul 02 1986 NEN LIFE SCIENCE PRODUCTS, INC Alkynylamino-nucleotides
5118605, Oct 16 1984 Chiron Diagnostics Corporation Polynucleotide determination with selectable cleavage sites
5151507, Jul 02 1986 NEN LIFE SCIENCE PRODUCTS, INC Alkynylamino-nucleotides
5174962, Jun 20 1988 Beckman Coulter, Inc Apparatus for determining DNA sequences by mass spectrometry
5175269, Jan 30 1984 Enzo Diagnostics, Inc. Compound and detectable molecules having an oligo- or polynucleotide with modifiable reactive group
5242796, Jul 02 1986 NEN LIFE SCIENCE PRODUCTS, INC Method, system and reagents for DNA sequencing
5302509, Aug 14 1989 BECKMAN INSTRUMENTS, INC , A CORP OF DELAWARE Method for sequencing polynucleotides
5308990, May 15 1991 Hitachi, Ltd. Method for measuring microparticles, quantitative measuring method therefor and instrument for measuring microparticles
5328824, Apr 17 1981 Yale University Methods of using labeled nucleotides
5332666, Jul 02 1986 NEN LIFE SCIENCE PRODUCTS, INC Method, system and reagents for DNA sequencing
5383858, Aug 17 1992 MEDRAD, INC Front-loading medical injector and syringe for use therewith
5436143, Dec 23 1992 Method for enzymatic synthesis of oligonucleotides
5437975, Feb 25 1991 CALIFORNIA INSTITUTE OF BIOLOGICAL RESEARCH A CORPORATION OF CA Consensus sequence primed polymerase chain reaction method for fingerprinting genomes
5449767, Apr 17 1981 Yale University Modified polynucleotides and methods of preparing same
5476928, Apr 17 1981 Yale University Modified nucleotides and polynucleotides and complexes form therefrom
5516664, Jul 30 1993 Enzymatic synthesis of repeat regions of oligonucleotides
5534424, May 12 1992 Cemu Bioteknik AB Chemical method for the analysis of DNA sequences
5547839, Jun 07 1989 Affymetrix, Inc Sequencing of surface immobilized polymers utilizing microflourescence detection
5547859, Aug 02 1993 SOUTHERN CALIFORNIA UNIVERSITY OF; University of Southern California Chain-terminating nucleotides for DNA sequencing methods
5556748, Jul 30 1991 Xenopore Corporation Methods of sandwich hybridization for the quantitative analysis of oligonucleotides
5599675, Apr 04 1994 LYNX THERAPEUTICS, INC DNA sequencing by stepwise ligation and cleavage
5602000, Jul 30 1993 Method for enzymatic synthesis of oligonucleotides
5637469, May 01 1992 Trustees of the University of Pennsylvania Methods and apparatus for the detection of an analyte utilizing mesoscale flow systems
5654419, Feb 01 1994 Regents of the University of California, The Fluorescent labels and their use in separations
5658736, Jan 16 1996 Genetics Institute, LLC Oligonucleotide population preparation
5709999, Aug 12 1994 University of Utah Research Foundation Linked breast and ovarian cancer susceptibility gene
5714330, Apr 04 1994 LYNX THERAPEUTICS, INC DNA sequencing by stepwise ligation and cleavage
5728528, Sep 20 1995 The Regents of the University of California Universal spacer/energy transfer dyes
5763594, Sep 02 1994 SOLEXA, INC 3' protected nucleotides for enzyme catalyzed template-independent creation of phosphodiester bonds
5770365, Aug 25 1995 TM BIOSCIENCE CORPORATION Nucleic acid capture moieties
5770367, Jul 30 1993 Oxford Gene Technology IP Limited Tag reagent and assay method
5789167, Sep 10 1993 GeneVue, Inc. Optical detection of position of oligonucleotides on large DNA molecules
5798210, Mar 26 1993 Institut Pasteur Derivatives utilizable in nucleic acid sequencing
5804386, Jan 15 1997 INCYTE PHARMACEUTICALS, INC Sets of labeled energy transfer fluorescent primers and their use in multi component analysis
5808045, Sep 02 1994 ILLUMINA, INC Compositions for enzyme catalyzed template-independent creation of phosphodiester bonds using protected nucleotides
5814454, Jan 15 1997 Incyte Pharmaceuticals, Inc. Sets of labeled energy transfer fluorescent primers and their use in multi component analysis
5821356, Aug 12 1996 Applied Biosystems, LLC Propargylethoxyamino nucleotides
5834203, Aug 25 1997 Applied Spectral Imaging Method for classification of pixels into groups according to their spectra using a plurality of wide band filters and hardwire therefore
5844106, Nov 06 1995 Sanofi-Aventis Deutschland GmbH Modified oligonucleotides, their preparation and their use
5849542, Nov 17 1993 AMERSHAM PHARMACIA BIOTECH UK LIMITED, A BRITISH COMPANY; AMERSHAM INTERNATIONAL PLC TO NYCOMED AMERSHAM PLC ; NYCOMED AMERSHAM PLC TO AMERSHAM PHARMACIA BIOTECH UK LIMITED Primer extension mass spectroscopy nucleic acid sequencing method
5853992, Oct 04 1996 Regents of the University of California, The Cyanine dyes with high-absorbance cross section as donor chromophores in energy transfer labels
5856104, Mar 07 1997 AFFYMETRIX, INC , A DELAWARE CORPORATION Polymorphisms in the glucose-6 phosphate dehydrogenase locus
5869255, Feb 01 1994 The Regents of the University of California Probes labeled with energy transfer couples dyes exemplified with DNA fragment analysis
5872244, Sep 02 1994 ILLUMINA, INC 3' protected nucleotides for enzyme catalyzed template-independent creation of phosphodiester bonds
5876936, Jan 15 1997 INCYTE PHARMARCEUTICALS, INC Nucleic acid sequencing with solid phase capturable terminators
5885775, Oct 04 1996 Applied Biosystems, LLC Methods for determining sequences information in polynucleotides using mass spectrometry
5908755, Jun 14 1996 Beckman Coulter, Inc Sequential step method for sequencing and identifying polynucleotides
5945283, Dec 17 1996 Washington University Methods and kits for nucleic acid analysis using fluorescence resonance energy transfer
5948648, May 29 1998 Applied Biosystems, LLC Nucleotide compounds including a rigid linker
5952180, Jan 15 1997 Incyte Pharmaceuticals, Inc. Sets of labeled energy transfer fluorescent primers and their use in multi component analysis
5959089, Jul 19 1993 Amino-cyclodextrin syntheses
5962228, Nov 17 1995 SOLEXA, INC DNA extension and analysis with rolling primers
6001566, Jun 01 1995 Roche Diagnostics GmbH DNA polymerase having 3'-intrinsic editing activity
6001611, Mar 20 1997 Roche Molecular Systems, Inc. Modified nucleic acid amplification primers
6008379, Oct 01 1997 Applied Biosystems, LLC Aromatic-substituted xanthene dyes
6013445, Jun 06 1996 ILLUMINA, INC Massively parallel signature sequencing by ligation of encoded adaptors
6028190, Feb 01 1994 Regents of the University of California, The Probes labeled with energy transfer coupled dyes
6046005, Jan 15 1997 INCYTE PHARMACEUTICALS, INC Nucleic acid sequencing with solid phase capturable terminators comprising a cleavable linking group
6074823, Mar 19 1993 BIOSCIENCES ACQUISITION COMPANY; AGENA BIOSCIENCE, INC DNA sequencing by mass spectrometry via exonuclease degradation
6087095, Apr 22 1992 Boehringer Mannheim GmbH DNA sequencing method
6136543, Jan 31 1997 Hitachi, Ltd. Method for determining nucleic acids base sequence and apparatus therefor
6175107, May 27 1998 Owens-Brockway Glass Container Inc. Inspection of containers employing a single area array sensor and alternately strobed light sources
6197557, Mar 06 1997 REGENTS OF THE UNIVERSITY OF MICHIGAN, THE Compositions and methods for analysis of nucleic acids
6207831, Dec 21 1998 Novartis AG Fluorescent dyes (AIDA) for solid phase and solution phase screening
6210891, Sep 27 1996 Qiagen GmbH Method of sequencing DNA
6214987, Sep 02 1994 SOLEXA, INC Compositions for enzyme catalyzed template-independent formation of phosphodiester bonds using protected nucleotides
6218118, Jul 09 1998 Agilent Technologies Inc Method and mixture reagents for analyzing the nucleotide sequence of nucleic acids by mass spectrometry
6218530, Jun 02 1998 AMBERGEN, INC Compounds and methods for detecting biomolecules
6221592, Oct 20 1998 Wisconsin Alumni Research Foundation Computer-based methods and systems for sequencing of individual nucleic acid molecules
6232465, Sep 02 1994 ILLUMINA, INC Compositions for enzyme catalyzed template-independent creation of phosphodiester bonds using protected nucleotides
6242193, Jul 30 1999 Hitachi, Ltd. Apparatus for determining base sequence of nucleic acid
6245507, Aug 18 1998 Beckman Coulter, Inc In-line complete hyperspectral fluorescent imaging of nucleic acid molecules
6255083, Dec 14 1998 PACIFIC BIOSCIENCES OF CALIFORNIA, INC System and methods for nucleic acid sequencing of single molecules by polymerase synthesis
6255475, Jan 31 1995 Fluidigm Corporation Chain terminators, the use thereof for nucleic acid sequencing and synthesis and a method of their preparation
6274320, Sep 16 1999 454 Life Sciences Corporation Method of sequencing a nucleic acid
6277607, May 24 1999 Rutgers, The State University of New Jersey High specificity primers, amplification methods and kits
6287821, Jun 11 1998 Beckman Coulter, Inc Nucleotide analogues with 3'-pro-fluorescent fluorophores in nucleic acid sequence analysis
6294324, Feb 11 1994 Institut Pasteur; Centre National de la Recherche Scientifique Processing for attaching an end of a nucleic acid to a surface by utilizing pH
6309829, May 27 1997 Applied Biosystems, LLC Length determination of nucleic acid repeat sequences by discontinuous primer extension
6309836, Oct 05 1999 Fluidigm Corporation Compounds for protecting hydroxyls and methods for their use
6312893, Jan 23 1996 Agilent Technologies, Inc Methods and compositions for determining the sequence of nucleic acid molecules
6316230, Aug 13 1999 Applied Biosystems, LLC Polymerase extension at 3' terminus of PNA-DNA chimera
6361940, Sep 24 1996 Agilent Technologies, Inc Compositions and methods for enhancing hybridization and priming specificity
6380378, Dec 24 1998 TOAGOSEI CO , LTD Nucleotide compound, nucleotide block oligonucleotide, and method for producing them
6524829, Sep 30 1998 Fluidigm Corporation Method for DNA- or RNA-sequencing
6555349, Jan 22 1993 ROCKEFELLER UNIVERSITY, THE; Cornell Research Foundation, Inc Methods for amplifying and sequencing nucleic acid molecules using a three component polymerase
6613508, Jan 23 1996 Agilent Technologies, Inc Methods and compositions for analyzing nucleic acid molecules utilizing sizing techniques
6613513, Feb 23 1999 CALIPER TECHNOLOGIES CORP Sequencing by incorporation
6627748, Sep 11 2000 TRUSTEES OF COLUMBIA UNIVERSITY IN THE CITY OF NEW YORK, THE Combinatorial fluorescence energy transfer tags and their applications for multiplex genetic analyses
6632655, Feb 23 1999 CALIPER TECHNOLOGIES CORP Manipulation of microparticles in microfluidic systems
6639088, Oct 05 1999 Fluidigm Corporation Compounds for protecting hydroxyls and methods for their use
6664079, Oct 06 2000 The Trustees of Columbia University in the City of New York Massive parallel method for decoding DNA and RNA
6664399, Sep 02 1999 E I DU PONT DE NEMOURS AND COMPANY Triazole linked carbohydrates
6713255, Jun 07 1999 FUJI PHOTO FILM CO , LTD DNA chip, PNA chip, and their preparation methods
6780591, May 01 1998 Life Technologies Corporation Method of determining the nucleotide sequence of oligonucleotides and DNA molecules
6787308, Jul 30 1998 SOLEXA LTD Arrayed biomolecules and their use in sequencing
6818395, Jun 28 1999 California Institute of Technology Methods and apparatus for analyzing polynucleotide sequences
6833246, Sep 29 1999 SOLEXA, LTD Polynucleotide sequencing
6864052, Jan 06 1999 COMPLETE GENOMICS INC Enhanced sequencing by hybridization using pools of probes
6911345, Jun 28 1999 California Institute of Technology Methods and apparatus for analyzing polynucleotide sequences
6934636, Oct 22 1999 SERONO GENETICS INSTITUTE S A Methods of genetic cluster analysis and uses thereof
6982146, Aug 30 1999 GOVERNMENT OF UNITED STATES OF AMERICA AS REPRESENTED BY THE SECRETARY OF THE DEPARTMENT OF HEALTH AND HUMAN SERVICES, THE High speed parallel molecular nucleic acid sequencing
7037687, May 01 1998 Life Technologies Corporation Method of determining the nucleotide sequence of oligonucleotides and DNA molecules
7056661, May 19 1999 Cornell Research Foundation, Inc Method for sequencing nucleic acid molecules
7056666, Dec 06 1990 Affymetrix, Inc. Analysis of surface immobilized polymers utilizing microfluorescence detection
7057026, Aug 23 2002 Illumina Cambridge Limited Labelled nucleotides
7057031, Jul 13 2001 AMBERGEN, INC Nucleotide compositions comprising photocleavable markers and methods of preparation thereof
7074597, Jul 12 2002 TRUSTEES OF COLUMBIA UNIVERSITY IN THE CITY OF NEW YORK, THE Multiplex genotyping using solid phase capturable dideoxynucleotides and mass spectrometry
7078499, Jun 01 2000 AMERSHAM BIOSCIENCES UK LTD Nucleotide analogues comprising a reporter moiety and a polymerase enzyme blocking moiety
7105300, Feb 23 1999 Caliper Life Sciences, Inc Sequencing by incorporation
7279563, Oct 05 1999 Fluidigm Corporation Compounds for protecting hydroxyls and methods for their use
7329496, Dec 06 1990 Affymetrix, Inc. Sequencing of surface immobilized polymers utilizing microflourescence detection
7345159, Oct 06 2000 The Trustees of Columbia University in the City of New York Massive parallel method for decoding DNA and RNA
7393533, Nov 08 2004 LA JOLLA INSTITUTE FOR ALLERGY AND IMMUNOLOGY H3L envelope protein immunization methods and H3L envelope passive protection methods
7414116, Aug 22 2003 Illumina Cambridge Limited Labelled nucleotides
7427673, Dec 04 2001 Illumina Cambridge Limited Labelled nucleotides
7459275, Apr 02 1997 Affymetrix, Inc. Sequencing of surface immobilized polymers utilizing microfluorescence detection
7566537, Dec 04 2001 Illumina Cambridge Limited Labelled nucleotides
7622279, Mar 03 2004 TRUSTEES OF COLUMBIA UNIVERSITY IN THE CITY OF NEW YORK, THE Photocleavable fluorescent nucleotides for DNA sequencing on chip constructed by site-specific coupling chemistry
7635578, Oct 06 2000 The Trustees of Columbia University in the City of New York Massive parallel method for decoding DNA and RNA
7713698, Oct 06 2000 The Trustees of Columbia University in the City of New York Massive parallel method for decoding DNA and RNA
7785790, Oct 10 1997 President and Fellows of Harvard College Replica amplification of nucleic acid arrays
7790869, Oct 06 2000 The Trustees of Columbia University in the City of New York Massive parallel method for decoding DNA and RNA
7883869, Dec 01 2006 COLUMBIA UNIVERSITY IN THE CITY OF NEW YORK, THE TRUSTEES OF Four-color DNA sequencing by synthesis using cleavable fluorescent nucleotide reversible terminators
7982029, Oct 31 2005 TRUSTEES OF COLUMBIA UNIVERSITY IN THE CITY OF NEW YORK, THE Synthesis of four color 3′O-allyl, modified photocleavable fluorescent nucleotides and related methods
8088575, Oct 06 2000 The Trustees of Columbia University in the City of New York Massive parallel method for decoding DNA and RNA
8158346, Dec 04 2001 Illumina Cambridge Limited Labelled nucleotides
8298792, Dec 01 2006 The Trustees of Columbia University in the City of New York Four-color DNA sequencing by synthesis using cleavable fluorescent nucleotide reversible terminators
8399188, Sep 28 2006 ILLUMINA, INC Compositions and methods for nucleotide sequencing
8796432, Oct 31 2005 TRUSTEES OF COLUMBIA UNIVERSITY IN THE CITY OF NEW, THE Chemically cleavable 3'-o-allyl-DNTP-allyl-fluorophore fluorescent nucleotide analogues and related methods
8889348, Jun 07 2006 TRUSTEES OF COLUMBIA UNVIERSITY IN THE CITY OF NEW YORK, THE DNA sequencing by nanopore using modified nucleotides
20020012966,
20020102586,
20020168642,
20030008285,
20030022225,
20030027140,
20030044871,
20030054360,
20030099972,
20030166282,
20030180769,
20030186256,
20030190680,
20030198982,
20040014096,
20040096825,
20040185466,
20050032081,
20050239134,
20060003352,
20060057565,
20060105461,
20060160081,
20060240439,
20060252038,
20060252938,
20070166705,
20070275387,
20080131895,
20080199868,
20080319179,
20090088332,
20090240030,
20090263791,
20090298072,
20090325154,
20100159531,
20100323350,
20110014611,
20110039259,
20110124054,
20120052489,
20120142006,
20120156680,
20130264207,
20130280700,
20140093869,
20140315191,
20140377743,
CA2408143,
CA2425112,
DE20122767,
DE4141178,
EP251786,
EP808320,
EP992511,
EP995804,
EP1182267,
EP1218391,
EP1291354,
EP1337541,
EP1790736,
EP2209911,
GB20000013276,
GB20010029012,
GB2446083,
GB2446084,
GB2457402,
WO2895,
WO6770,
WO9753,
WO15844,
WO18956,
WO21974,
WO50172,
WO50642,
WO53805,
WO53812,
WO70073,
WO116375,
WO123610,
WO125247,
WO127625,
WO132930,
WO157248,
WO157249,
WO192284,
WO202813,
WO2072892,
WO2079519,
WO2088381,
WO2088382,
WO221098,
WO222883,
WO229003,
WO3002767,
WO3020968,
WO3048178,
WO3048387,
WO3085135,
WO2004007773,
WO2004018493,
WO2004018497,
WO2004055160,
WO2004108497,
WO2005084367,
WO2006073436,
WO2007002204,
WO2007053702,
WO2007053719,
WO2007062105,
WO2008069973,
WO2009051807,
WO200957321,
WO2013154999,
WO2013191793,
WO2014144883,
WO2014144898,
WO8909282,
WO8910977,
WO8911548,
WO9013666,
WO9106678,
WO9210587,
WO9305183,
WO9312340,
WO9321340,
WO9414972,
WO9607669,
WO9623807,
WO9627025,
WO9708183,
WO9727317,
WO9735033,
WO9830720,
WO9833939,
WO9844151,
WO9905315,
WO9949082,
//
Executed onAssignorAssigneeConveyanceFrameReelDoc
Aug 05 2013The Trustees of Columbia University in the City of New York(assignment on the face of the patent)
Jun 12 2014COLUMBIA UNIV NEW YORK MORNINGSIDENATIONAL SCIENCE FOUNDATIONCONFIRMATORY LICENSE SEE DOCUMENT FOR DETAILS 0332670093 pdf
Date Maintenance Fee Events
Mar 12 2019M1551: Payment of Maintenance Fee, 4th Year, Large Entity.
May 08 2023REM: Maintenance Fee Reminder Mailed.
Oct 23 2023EXP: Patent Expired for Failure to Pay Maintenance Fees.


Date Maintenance Schedule
Sep 15 20184 years fee payment window open
Mar 15 20196 months grace period start (w surcharge)
Sep 15 2019patent expiry (for year 4)
Sep 15 20212 years to revive unintentionally abandoned end. (for year 4)
Sep 15 20228 years fee payment window open
Mar 15 20236 months grace period start (w surcharge)
Sep 15 2023patent expiry (for year 8)
Sep 15 20252 years to revive unintentionally abandoned end. (for year 8)
Sep 15 202612 years fee payment window open
Mar 15 20276 months grace period start (w surcharge)
Sep 15 2027patent expiry (for year 12)
Sep 15 20292 years to revive unintentionally abandoned end. (for year 12)